ID: 1101875832

View in Genome Browser
Species Human (GRCh38)
Location 12:108596598-108596620
Sequence GGCTCTGCTGACTGCAGGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 347
Summary {0: 1, 1: 0, 2: 2, 3: 41, 4: 303}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101875832_1101875844 25 Left 1101875832 12:108596598-108596620 CCCCACCTGCAGTCAGCAGAGCC 0: 1
1: 0
2: 2
3: 41
4: 303
Right 1101875844 12:108596646-108596668 GGACGGCCCCTGCCCTCTCTGGG 0: 1
1: 0
2: 1
3: 39
4: 295
1101875832_1101875843 24 Left 1101875832 12:108596598-108596620 CCCCACCTGCAGTCAGCAGAGCC 0: 1
1: 0
2: 2
3: 41
4: 303
Right 1101875843 12:108596645-108596667 TGGACGGCCCCTGCCCTCTCTGG 0: 1
1: 0
2: 2
3: 24
4: 252
1101875832_1101875836 -10 Left 1101875832 12:108596598-108596620 CCCCACCTGCAGTCAGCAGAGCC 0: 1
1: 0
2: 2
3: 41
4: 303
Right 1101875836 12:108596611-108596633 CAGCAGAGCCTCAAAAAAGATGG 0: 1
1: 0
2: 5
3: 35
4: 328
1101875832_1101875838 -2 Left 1101875832 12:108596598-108596620 CCCCACCTGCAGTCAGCAGAGCC 0: 1
1: 0
2: 2
3: 41
4: 303
Right 1101875838 12:108596619-108596641 CCTCAAAAAAGATGGTTGTGTGG 0: 1
1: 0
2: 0
3: 24
4: 209
1101875832_1101875839 4 Left 1101875832 12:108596598-108596620 CCCCACCTGCAGTCAGCAGAGCC 0: 1
1: 0
2: 2
3: 41
4: 303
Right 1101875839 12:108596625-108596647 AAAAGATGGTTGTGTGGCCCTGG 0: 1
1: 1
2: 21
3: 187
4: 795
1101875832_1101875840 8 Left 1101875832 12:108596598-108596620 CCCCACCTGCAGTCAGCAGAGCC 0: 1
1: 0
2: 2
3: 41
4: 303
Right 1101875840 12:108596629-108596651 GATGGTTGTGTGGCCCTGGACGG 0: 1
1: 0
2: 0
3: 16
4: 212

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101875832 Original CRISPR GGCTCTGCTGACTGCAGGTG GGG (reversed) Intronic