ID: 1101875835

View in Genome Browser
Species Human (GRCh38)
Location 12:108596603-108596625
Sequence TTTGAGGCTCTGCTGACTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 250
Summary {0: 1, 1: 0, 2: 3, 3: 26, 4: 220}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101875835_1101875843 19 Left 1101875835 12:108596603-108596625 CCTGCAGTCAGCAGAGCCTCAAA 0: 1
1: 0
2: 3
3: 26
4: 220
Right 1101875843 12:108596645-108596667 TGGACGGCCCCTGCCCTCTCTGG 0: 1
1: 0
2: 2
3: 24
4: 252
1101875835_1101875838 -7 Left 1101875835 12:108596603-108596625 CCTGCAGTCAGCAGAGCCTCAAA 0: 1
1: 0
2: 3
3: 26
4: 220
Right 1101875838 12:108596619-108596641 CCTCAAAAAAGATGGTTGTGTGG 0: 1
1: 0
2: 0
3: 24
4: 209
1101875835_1101875844 20 Left 1101875835 12:108596603-108596625 CCTGCAGTCAGCAGAGCCTCAAA 0: 1
1: 0
2: 3
3: 26
4: 220
Right 1101875844 12:108596646-108596668 GGACGGCCCCTGCCCTCTCTGGG 0: 1
1: 0
2: 1
3: 39
4: 295
1101875835_1101875839 -1 Left 1101875835 12:108596603-108596625 CCTGCAGTCAGCAGAGCCTCAAA 0: 1
1: 0
2: 3
3: 26
4: 220
Right 1101875839 12:108596625-108596647 AAAAGATGGTTGTGTGGCCCTGG 0: 1
1: 1
2: 21
3: 187
4: 795
1101875835_1101875840 3 Left 1101875835 12:108596603-108596625 CCTGCAGTCAGCAGAGCCTCAAA 0: 1
1: 0
2: 3
3: 26
4: 220
Right 1101875840 12:108596629-108596651 GATGGTTGTGTGGCCCTGGACGG 0: 1
1: 0
2: 0
3: 16
4: 212

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101875835 Original CRISPR TTTGAGGCTCTGCTGACTGC AGG (reversed) Intronic