ID: 1101875837

View in Genome Browser
Species Human (GRCh38)
Location 12:108596619-108596641
Sequence CCACACAACCATCTTTTTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 219
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 198}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101875837_1101875850 24 Left 1101875837 12:108596619-108596641 CCTCAAAAAAGATGGTTGTGTGG 0: 1
1: 0
2: 0
3: 20
4: 198
Right 1101875850 12:108596666-108596688 GGGCCTCAGTTTCCCATCTGTGG 0: 1
1: 4
2: 26
3: 76
4: 331
1101875837_1101875843 3 Left 1101875837 12:108596619-108596641 CCTCAAAAAAGATGGTTGTGTGG 0: 1
1: 0
2: 0
3: 20
4: 198
Right 1101875843 12:108596645-108596667 TGGACGGCCCCTGCCCTCTCTGG 0: 1
1: 0
2: 2
3: 24
4: 252
1101875837_1101875844 4 Left 1101875837 12:108596619-108596641 CCTCAAAAAAGATGGTTGTGTGG 0: 1
1: 0
2: 0
3: 20
4: 198
Right 1101875844 12:108596646-108596668 GGACGGCCCCTGCCCTCTCTGGG 0: 1
1: 0
2: 1
3: 39
4: 295

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101875837 Original CRISPR CCACACAACCATCTTTTTTG AGG (reversed) Intronic