ID: 1101875843

View in Genome Browser
Species Human (GRCh38)
Location 12:108596645-108596667
Sequence TGGACGGCCCCTGCCCTCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 279
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 252}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101875832_1101875843 24 Left 1101875832 12:108596598-108596620 CCCCACCTGCAGTCAGCAGAGCC 0: 1
1: 0
2: 2
3: 41
4: 303
Right 1101875843 12:108596645-108596667 TGGACGGCCCCTGCCCTCTCTGG 0: 1
1: 0
2: 2
3: 24
4: 252
1101875833_1101875843 23 Left 1101875833 12:108596599-108596621 CCCACCTGCAGTCAGCAGAGCCT 0: 1
1: 0
2: 0
3: 25
4: 253
Right 1101875843 12:108596645-108596667 TGGACGGCCCCTGCCCTCTCTGG 0: 1
1: 0
2: 2
3: 24
4: 252
1101875837_1101875843 3 Left 1101875837 12:108596619-108596641 CCTCAAAAAAGATGGTTGTGTGG 0: 1
1: 0
2: 0
3: 20
4: 198
Right 1101875843 12:108596645-108596667 TGGACGGCCCCTGCCCTCTCTGG 0: 1
1: 0
2: 2
3: 24
4: 252
1101875834_1101875843 22 Left 1101875834 12:108596600-108596622 CCACCTGCAGTCAGCAGAGCCTC 0: 1
1: 0
2: 2
3: 34
4: 301
Right 1101875843 12:108596645-108596667 TGGACGGCCCCTGCCCTCTCTGG 0: 1
1: 0
2: 2
3: 24
4: 252
1101875830_1101875843 29 Left 1101875830 12:108596593-108596615 CCCAGCCCCACCTGCAGTCAGCA 0: 1
1: 1
2: 4
3: 40
4: 365
Right 1101875843 12:108596645-108596667 TGGACGGCCCCTGCCCTCTCTGG 0: 1
1: 0
2: 2
3: 24
4: 252
1101875835_1101875843 19 Left 1101875835 12:108596603-108596625 CCTGCAGTCAGCAGAGCCTCAAA 0: 1
1: 0
2: 3
3: 26
4: 220
Right 1101875843 12:108596645-108596667 TGGACGGCCCCTGCCCTCTCTGG 0: 1
1: 0
2: 2
3: 24
4: 252
1101875831_1101875843 28 Left 1101875831 12:108596594-108596616 CCAGCCCCACCTGCAGTCAGCAG 0: 1
1: 0
2: 4
3: 53
4: 440
Right 1101875843 12:108596645-108596667 TGGACGGCCCCTGCCCTCTCTGG 0: 1
1: 0
2: 2
3: 24
4: 252

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101875843 Original CRISPR TGGACGGCCCCTGCCCTCTC TGG Intronic
900101968 1:965852-965874 TGCACGGCCCCCACCCTCCCTGG - Intergenic
900129064 1:1080011-1080033 TGGAAGGCCCCTCCCCGCACCGG - Intergenic
900488132 1:2933176-2933198 CAGACTGCCCCTGCCCTCTGGGG + Intergenic
900640793 1:3687262-3687284 GGCCCAGCCCCTGCCCTCTCAGG + Intronic
900659712 1:3776412-3776434 GGGCAGGCCCCTGTCCTCTCTGG + Intergenic
901500876 1:9652021-9652043 GGGACGGCCCCGGGCCTCTAGGG - Intronic
901813994 1:11783688-11783710 AGGGCAGCCCCTGCCCTCTGAGG + Intronic
902822545 1:18951999-18952021 TGGCCAACCGCTGCCCTCTCTGG - Intronic
903261470 1:22133855-22133877 TGGAGGGCCCTTGCCCTGCCAGG + Intronic
903888343 1:26554257-26554279 TGGAGGGCGCCTGCCCCCTCGGG + Intronic
904293421 1:29502482-29502504 TGGGCTGCCCCAGGCCTCTCTGG + Intergenic
904599224 1:31664677-31664699 CGGGCCACCCCTGCCCTCTCTGG + Intronic
905809057 1:40898807-40898829 TGGACAGTCCCTGCCCACTCCGG + Intergenic
906219633 1:44068661-44068683 GGGCTGGCCCCTGCCCTCACAGG + Intergenic
906511438 1:46412336-46412358 TGGGAGGACCCTGCCCTCTCGGG + Intronic
907046524 1:51303222-51303244 TCCCAGGCCCCTGCCCTCTCTGG - Intronic
907046924 1:51305183-51305205 GGGGTGGCCCCTGCCCACTCTGG - Intronic
908757107 1:67479270-67479292 TGGACTGCCCCTCCCCTCCACGG - Intergenic
909958018 1:81802122-81802144 CGGCCGGCCTCGGCCCTCTCCGG + Intronic
915309661 1:155000815-155000837 TGGACGGCTCCGGGCCCCTCCGG + Intergenic
915490109 1:156246051-156246073 TGGACGGTCCCTGCCCGCCTGGG + Exonic
916595367 1:166237279-166237301 GGGAGGGACCCTGTCCTCTCAGG - Intergenic
917725534 1:177824052-177824074 TGGACAACCCCAGCCCTGTCCGG - Intergenic
918321677 1:183370851-183370873 TGGACAGCTCCTGCCCTGTCCGG + Intronic
920125789 1:203692852-203692874 TGCACGGCCCCTGCCCAGGCTGG - Intronic
920176708 1:204106298-204106320 TAGACAGCTCCTGCTCTCTCAGG - Intronic
920919966 1:210290754-210290776 TGCACGGCACCTGCCTTCTCAGG + Intergenic
1062925743 10:1314400-1314422 CAGACGGGCCCTGCCCTCCCTGG + Intronic
1066026244 10:31362595-31362617 TGCCCGGCCCCCGCCCTGTCTGG - Intronic
1067226447 10:44379274-44379296 TGCACTGCCCCTCCCCTCCCTGG - Intronic
1067669558 10:48306765-48306787 CGGACGGCCCCTGTCCCCGCTGG + Exonic
1070602166 10:77873573-77873595 TGGAATGCCCCAGCCCTCCCAGG + Intronic
1071341775 10:84655641-84655663 TGCCCGGCCCCTGCCCTGTCTGG - Intergenic
1071404949 10:85320536-85320558 TCGAAGACTCCTGCCCTCTCTGG - Intergenic
1073071760 10:100798777-100798799 TGGACAGCACCTGACCTCTGGGG + Intronic
1073290513 10:102410977-102410999 TGGAGGGCCCTTGGCCTCCCAGG + Intronic
1073345900 10:102782752-102782774 TGCACTGCCCCTCCCCTCACAGG - Intronic
1075092959 10:119453700-119453722 TTGAGAGCCACTGCCCTCTCTGG + Intronic
1075260962 10:120963533-120963555 TGACCGGTCCCTGCCCTGTCAGG - Intergenic
1075780102 10:125011970-125011992 TGGATGGCACCTGCTCCCTCAGG - Intronic
1076068158 10:127465001-127465023 TGGAAGCCCCGTGCTCTCTCGGG - Intergenic
1076791602 10:132779643-132779665 TTGACAGCCCCTGCCTTCTGGGG + Intronic
1077103875 11:833540-833562 TGGGCGGCCCGCGCCCTATCAGG - Intronic
1077221562 11:1420294-1420316 TGGCCAGCCTCTCCCCTCTCTGG - Intronic
1079085958 11:17445095-17445117 GGTAAGGCACCTGCCCTCTCTGG + Intronic
1079366375 11:19813726-19813748 TCAACGTCCCATGCCCTCTCTGG - Intronic
1081668398 11:44929798-44929820 TGGATGGTCACTGTCCTCTCTGG - Exonic
1081869193 11:46375666-46375688 AGGCCAGACCCTGCCCTCTCTGG + Intronic
1083926320 11:65809167-65809189 TGGACGGCCTCTCCCACCTCTGG - Intergenic
1084509194 11:69592555-69592577 GGGGAGCCCCCTGCCCTCTCTGG - Intergenic
1084582050 11:70030115-70030137 TGGGAGGCCCTGGCCCTCTCAGG + Intergenic
1084953797 11:72680821-72680843 GGGCAAGCCCCTGCCCTCTCTGG + Intergenic
1085238502 11:75033049-75033071 TGGACTGCCTCTGCCCTCAATGG + Intergenic
1085409260 11:76281821-76281843 TGGAGGTCCCTGGCCCTCTCTGG + Intergenic
1085508361 11:77072904-77072926 AGGAAAGCTCCTGCCCTCTCTGG - Intronic
1087368223 11:97248580-97248602 GGGAGGGACCCTGCCCTCTGTGG - Intergenic
1088677211 11:112206151-112206173 TGCCCGGCCCCCGCCCTGTCTGG - Intronic
1088677231 11:112206231-112206253 TGCCCGGCCGCTGCCCTGTCTGG - Intronic
1088754429 11:112873959-112873981 TGCAAGTCCTCTGCCCTCTCTGG - Intergenic
1090351971 11:126113579-126113601 TGGATTCCCCCTGCACTCTCTGG + Intergenic
1093337200 12:17920781-17920803 GGGAAGGACACTGCCCTCTCTGG + Intergenic
1096683153 12:53270237-53270259 AGAAGGGCCACTGCCCTCTCAGG - Intronic
1100204626 12:92334856-92334878 GACACGGCCCCTGCCCTCTAGGG + Intergenic
1101875843 12:108596645-108596667 TGGACGGCCCCTGCCCTCTCTGG + Intronic
1104900590 12:132187831-132187853 TGGGCGGCACCTCCCCTCCCGGG + Intergenic
1105816870 13:24044095-24044117 TGGAGGGCTCCTGCCCTGGCTGG + Intronic
1106079312 13:26487482-26487504 TGGACGGCCCCTGCTTCCTCAGG + Intergenic
1117876027 14:60250034-60250056 GGGACGCCCCCTCCCCGCTCGGG - Intronic
1118047863 14:61991998-61992020 TGGAGAGCCCCTGCCCTGTGTGG + Intergenic
1121164189 14:91775999-91776021 TGGAAGTTCCCTGCCCACTCGGG - Intronic
1121951250 14:98172530-98172552 TGGCCTGCTCCTGCCTTCTCAGG - Intergenic
1122980851 14:105191806-105191828 GGGCCCGCCCCTGCACTCTCCGG - Intergenic
1124584370 15:30991657-30991679 TGCCCGGCCCCTCCCCGCTCGGG - Intergenic
1125520883 15:40347288-40347310 TGGACGCCCCATGCCCTGCCTGG - Intergenic
1128339404 15:66809849-66809871 TGGTCAGCCACTGGCCTCTCAGG - Intergenic
1128747170 15:70122910-70122932 TGGAGGGCTCCTGCCCTCTCTGG - Intergenic
1129206948 15:74043038-74043060 TGGAAGGCCCCAGCACCCTCAGG + Exonic
1129348256 15:74938077-74938099 TGTCCGGCCCCCGCCCGCTCCGG - Exonic
1129754969 15:78092624-78092646 TGGCTGTCCCCTGCCCCCTCAGG - Exonic
1129822933 15:78616992-78617014 TGGGGGGCCCACGCCCTCTCAGG - Intronic
1131329828 15:91486753-91486775 TGGTCTGCCACTGCACTCTCTGG - Intergenic
1132804604 16:1769671-1769693 GGGGAGGCCCCTGGCCTCTCCGG + Exonic
1132845579 16:1999512-1999534 TCGGCGGCCCCTGCCCACCCCGG - Exonic
1133186320 16:4101626-4101648 GGGGTGGCCCCTGCCCTCTTGGG - Intronic
1134801578 16:17089780-17089802 TAGCCGGCCTTTGCCCTCTCTGG + Intergenic
1137744214 16:50809118-50809140 TTGACAGCCCATGCCCTTTCTGG - Intergenic
1138353642 16:56360698-56360720 TGGGCTGCCCCTGGCCTCTGTGG - Intergenic
1139946681 16:70646907-70646929 GGGACGGCGCCTGAGCTCTCAGG + Exonic
1142190602 16:88715567-88715589 AGGCCGGCTCCTTCCCTCTCGGG + Exonic
1142205825 16:88782705-88782727 TGGAGTGCCCCCTCCCTCTCTGG - Intronic
1143852758 17:9825039-9825061 TGTCCTGCCCCTGCCCTCTCCGG - Intronic
1144737782 17:17564553-17564575 TGAAGTGCCTCTGCCCTCTCTGG - Intronic
1145941373 17:28744929-28744951 TGAACTCCCGCTGCCCTCTCAGG + Intronic
1145992710 17:29088699-29088721 TGGCCAGCCCCTTCCATCTCTGG - Intronic
1147217453 17:38908937-38908959 TGGAACGCCCCTGCCCCATCAGG - Intronic
1148089299 17:45013258-45013280 TGGAGGGCCCCTGCAGACTCTGG + Intergenic
1149685866 17:58534359-58534381 TGAAAGTCCCTTGCCCTCTCTGG + Intronic
1152468328 17:80477587-80477609 TGGACGCCCCCAGCCACCTCCGG - Intronic
1152545971 17:81000270-81000292 TGGAGGGCTCCTGCCCAGTCCGG + Intronic
1152652072 17:81499440-81499462 TGGCCAGGCCCTGCCCTCTCTGG - Intergenic
1152716977 17:81904944-81904966 TAGACTTACCCTGCCCTCTCAGG - Exonic
1152783559 17:82236904-82236926 TGCACGGCCCCTGCCCCTCCTGG - Intronic
1152784887 17:82242384-82242406 TGGAGAGTCCCTGCCTTCTCGGG - Intronic
1153756901 18:8293387-8293409 ATGAGGGTCCCTGCCCTCTCTGG - Intronic
1155546760 18:26923922-26923944 TGTACAGCCCTTGCCATCTCTGG - Intronic
1157496422 18:48160786-48160808 CAGACTGCCACTGCCCTCTCAGG - Intronic
1157504902 18:48219261-48219283 CTGCCGGCCCCTGCCCTCCCAGG + Intronic
1157597911 18:48875049-48875071 TGGAGGGCCCCGGGTCTCTCGGG + Intergenic
1160417478 18:78721299-78721321 AGGACGGCCCCTTCTCTCACAGG - Intergenic
1160452135 18:78973457-78973479 TGGACGGCCCAGCCCCTCGCAGG - Intergenic
1160506911 18:79432436-79432458 TGGACTGCCTCTGCCCACGCAGG + Intronic
1160682400 19:417842-417864 TGGGCGGCCCCTCCCCTATGCGG - Intronic
1160735150 19:658975-658997 TGGATGTCGGCTGCCCTCTCTGG - Intronic
1160782610 19:884509-884531 TGCACCGCCCCTGCCCGGTCTGG + Intronic
1160808946 19:1004707-1004729 TGCACGGCCCCCGCCCCCACAGG + Exonic
1160846971 19:1170357-1170379 TGGCCGGCACCTGCACCCTCGGG - Intronic
1161162458 19:2768824-2768846 GGGCAGACCCCTGCCCTCTCTGG + Intronic
1161506741 19:4648293-4648315 AGGAAGGCCCCTGCCCTGTAAGG + Intronic
1161721520 19:5905079-5905101 TGGCCGGCCCCGGGCCTCACCGG - Exonic
1161936788 19:7376954-7376976 TGGAGGTCCCTTCCCCTCTCTGG - Intronic
1163288557 19:16364356-16364378 CCGACAGCGCCTGCCCTCTCAGG + Intronic
1163681467 19:18684663-18684685 ACCACAGCCCCTGCCCTCTCAGG + Intronic
1164685992 19:30167264-30167286 GGGGCGACCGCTGCCCTCTCTGG + Intergenic
1164826347 19:31287502-31287524 TTGATGGCCCCTTCCCTCTTCGG - Intronic
1164826928 19:31290689-31290711 TGGAAGGCCCCTGGTCTCCCTGG - Intronic
1165101371 19:33440489-33440511 TGCTCGGCCCCTCACCTCTCTGG + Intronic
1166119182 19:40674719-40674741 AGGAAGTCCCCTCCCCTCTCTGG + Intronic
1166565595 19:43763624-43763646 TGGGAAGCCCCTGCCCTCTCTGG + Intergenic
1167096502 19:47377460-47377482 AGCCCAGCCCCTGCCCTCTCGGG + Intronic
1167452441 19:49580023-49580045 TTGACAGCCCCTTCCCTTTCGGG - Intronic
927651260 2:24914993-24915015 TGGCTGGCCTCTGACCTCTCAGG + Intronic
927853862 2:26516072-26516094 AGGAGGGCCCCTGGCCTCTCTGG - Intronic
928403312 2:30994830-30994852 TGGAAGGCCCCTGCTCTCGAGGG + Intronic
928789274 2:34931813-34931835 TTCAAGCCCCCTGCCCTCTCAGG - Intergenic
932063078 2:68527690-68527712 TGCCCGGGCCCTGCCCTGTCTGG - Intronic
932063099 2:68527770-68527792 TGCCCGGCCCCCGCCCTCTCTGG - Intronic
932404114 2:71502657-71502679 TGGACCGCCCAGGGCCTCTCAGG + Intronic
932615185 2:73227061-73227083 GGGTGGGCACCTGCCCTCTCTGG - Exonic
935056243 2:99570080-99570102 TGGACGGCTCCAGCCCTCAGAGG - Intronic
936084154 2:109455177-109455199 TGGACGGGCCATGACCTCCCAGG - Intronic
937221281 2:120344487-120344509 TGGCCGCCCCCGGCCCTCCCGGG - Intergenic
937517083 2:122667647-122667669 TGGAAGGGCCCAGCCCTCACTGG - Intergenic
939076276 2:137606397-137606419 TGCAGGGCCCCTTTCCTCTCAGG - Intronic
940846279 2:158645582-158645604 TGGATCGCCACTGCTCTCTCAGG - Intronic
944155617 2:196604280-196604302 TCCACTGCCCCAGCCCTCTCTGG + Intergenic
944676186 2:202035237-202035259 GGGACGCCCCCTGCCATCTGAGG - Exonic
945082126 2:206096978-206097000 TGGAAGCCCCGCGCCCTCTCTGG + Intergenic
945303843 2:208239875-208239897 TGGACGTCTCCTGTCCTTTCTGG + Exonic
946168078 2:217877524-217877546 TGGCAGGCCCCCTCCCTCTCGGG + Intronic
947641192 2:231708759-231708781 TGGACGCCGCCCGCCCCCTCGGG + Intronic
948122296 2:235539984-235540006 TGGACCGCCCCATCCCTCCCAGG + Intronic
948141989 2:235680379-235680401 TGCAGGGCCCCTGACCCCTCTGG - Intronic
948597530 2:239089934-239089956 TGGGCGGCCCCTCCCCACACTGG + Intronic
1169012641 20:2263369-2263391 TGGAGGGCCCACGCCCTCTCAGG + Intergenic
1170788831 20:19491214-19491236 TGCACAGCCCTTCCCCTCTCTGG - Intronic
1172301417 20:33853069-33853091 TGGACGGCCTCTGCCTACACAGG - Intronic
1173468907 20:43307016-43307038 TTCCCGGCCCCTGCCCTCTCAGG + Intergenic
1174031524 20:47632290-47632312 TGGAGGTTCCATGCCCTCTCTGG + Intronic
1174073860 20:47918290-47918312 TGGGAGGTCCCAGCCCTCTCTGG - Intergenic
1175405361 20:58722596-58722618 GAGATGGCCCCTGCCCTCCCAGG + Intergenic
1175859558 20:62143127-62143149 CGCCCGGCCCCGGCCCTCTCTGG + Intronic
1175987539 20:62771435-62771457 TCGGGGGCCCCTGACCTCTCTGG + Intergenic
1176266605 20:64212511-64212533 AGGCCGCCCCCTGCTCTCTCGGG - Intronic
1176809695 21:13525273-13525295 TGGCCAGCCGCTGCCCTCTGCGG + Intergenic
1179241597 21:39597763-39597785 TGGAGGCCGCCTGCCCTCCCTGG - Exonic
1180162664 21:46005320-46005342 TGGCCGGCCCCAGCCCACTGAGG - Intergenic
1180839299 22:18951529-18951551 TGCACGTCCACTGCCCTCTGTGG + Intergenic
1181062590 22:20288927-20288949 TGCACGTCCACTGCCCTCTGTGG - Intergenic
1181458306 22:23071621-23071643 TGGACTGGGCCTGCCCTCCCAGG + Intronic
1182150378 22:28023247-28023269 TGCCCGGCCTCTGCCCACTCTGG + Intronic
1183111675 22:35654102-35654124 TGGAGTTCCCATGCCCTCTCTGG + Intronic
1183212335 22:36458614-36458636 GGCAAGGCCCCTGCCCTCTCTGG + Intergenic
1183354458 22:37350858-37350880 CGGAGGGGCCCTCCCCTCTCAGG + Intergenic
1183497141 22:38153332-38153354 TGCCCGGCCCCCGCCCTGTCTGG + Intronic
1183621355 22:38974730-38974752 TGGACGGCATCTCCTCTCTCTGG + Intronic
1183622220 22:38981208-38981230 TGGACGGCCCCCGCACCGTCTGG + Intronic
1184255794 22:43286093-43286115 GGGCCAGGCCCTGCCCTCTCAGG + Intronic
1184726648 22:46351151-46351173 TGGACTTTCCCAGCCCTCTCTGG - Intronic
950644040 3:14366712-14366734 TGCACAGCCCCTGCCCTCAAAGG + Intergenic
953559078 3:43971084-43971106 TGTACCGTCCCTCCCCTCTCTGG + Intergenic
953913951 3:46906281-46906303 TGGACGGCCCCATCCCTCGCTGG + Intergenic
953919235 3:46940568-46940590 TGGTCGGCCCTTGCCACCTCTGG - Intronic
953979212 3:47405358-47405380 TGGACAGCCCCTCCCCACTGTGG + Intronic
954871247 3:53769156-53769178 GGCAAGGCCCCTGCCCTCCCTGG + Intronic
954933619 3:54306652-54306674 TGGCTGGCCGCTGCCCTCTCAGG + Intronic
958264930 3:91426916-91426938 TGGACCTTCCATGCCCTCTCTGG - Intergenic
958954368 3:100451351-100451373 TGGAAGCCCCCTGCCCACTTTGG - Intronic
961346285 3:126265534-126265556 TGGAAGGCCCCTCCCCACTTTGG + Intergenic
966237977 3:177724094-177724116 TCAACGGCCCTTGCCTTCTCTGG + Intergenic
966254091 3:177898513-177898535 TGGAAGTCCCCTGCCCTTACAGG + Intergenic
967441804 3:189517308-189517330 GGGAGGGACCCTACCCTCTCTGG + Intergenic
968747154 4:2365936-2365958 AGCACGGCCCCTGCCCCCTAAGG + Intronic
968985719 4:3873390-3873412 GGGAGGGCCTGTGCCCTCTCTGG + Intergenic
979536210 4:121823504-121823526 TGGACGGGCGCTGCCTTTTCCGG + Exonic
980544767 4:134244564-134244586 AGGACGGCCCCTTCCCACCCAGG - Intergenic
981782560 4:148444456-148444478 GGGGCCGCCCCTGCGCTCTCCGG + Intronic
983927318 4:173416041-173416063 TGCACGGCCCCTGCCCTCCCAGG - Intergenic
984693382 4:182754501-182754523 TGGACGGCCCATGCACTGTCAGG + Exonic
985892970 5:2730460-2730482 TGGGCAGCCCCCACCCTCTCTGG - Intergenic
987203062 5:15596837-15596859 TGGAGCGTCCATGCCCTCTCTGG - Intronic
989164853 5:38423957-38423979 AGGAGGGCTCCTGCCCTCACAGG + Intronic
989255306 5:39359818-39359840 CGGAGGGTCCCTGCCCTCACTGG - Intronic
991994981 5:72377978-72378000 TGGAGGGCCCCTGTAATCTCAGG - Intergenic
992487345 5:77210088-77210110 TGTAGGGCCCCTGCCATTTCGGG + Intergenic
993634901 5:90331779-90331801 GAGATGGGCCCTGCCCTCTCAGG - Intergenic
995421073 5:111967624-111967646 TGCCCGGCCCCCGCCCTGTCTGG + Intronic
996716259 5:126590226-126590248 TGCCCGGCCGCTGCCCTGTCTGG + Intronic
997468958 5:134105952-134105974 AGAAGGGCCCCTTCCCTCTCAGG - Intergenic
997879283 5:137574930-137574952 AGGAAGGCCCCAGCCTTCTCAGG - Intronic
997980371 5:138464741-138464763 TGGGCGGCCCCTGCCCAGGCGGG + Intergenic
1000023111 5:157336070-157336092 TGGATGGCCCCTGCTCGCCCTGG + Intronic
1002197484 5:177509285-177509307 TGCTCAGCCCCTGCCGTCTCAGG + Intronic
1005243384 6:23855642-23855664 TGCCCGGCCCCCGCCCTGTCTGG + Intergenic
1006517389 6:34552566-34552588 TGGAGGGCCTCTGCCTTCCCTGG - Intronic
1008990453 6:57595744-57595766 TGGACCTTCCATGCCCTCTCTGG + Intronic
1009179029 6:60494290-60494312 TGGACCTTCCATGCCCTCTCTGG + Intergenic
1009966772 6:70586476-70586498 TAGAAGGCCCCTTCCCTCACAGG - Intronic
1009975687 6:70668243-70668265 TGGCCGGCTCCTGCCCTGACTGG + Intronic
1011068753 6:83359113-83359135 TGCCCAGCCCCTGCCCTGTCTGG - Intronic
1015761945 6:136672322-136672344 TGGAAGGCCACTTCCCTCTTTGG - Intronic
1016372686 6:143391344-143391366 TGCACCTCCCCTGCCCACTCGGG + Intergenic
1016949458 6:149566274-149566296 GGGACGGGCCCTCCCCTCCCCGG - Exonic
1018056317 6:160055255-160055277 TGGACTGCCCCCTCCTTCTCTGG + Intronic
1019392287 7:795115-795137 TGGATGGACCCTGCCCTGCCTGG - Intergenic
1019513542 7:1429969-1429991 GGGAAGGTCCCTCCCCTCTCTGG + Intronic
1022510132 7:30929775-30929797 TCCAAGGCTCCTGCCCTCTCTGG + Intergenic
1023821483 7:43983042-43983064 TGGAGGGGCCCCGCCCTCTGGGG - Intergenic
1023860012 7:44212901-44212923 AGGATGGGCCCTGCCCTCTGCGG - Exonic
1024094938 7:45975946-45975968 TGGCAGCCCCCAGCCCTCTCGGG - Intergenic
1025017340 7:55449745-55449767 TGGAGGGCTCCTGTCCCCTCGGG - Intronic
1025019999 7:55473220-55473242 AGGCAGGTCCCTGCCCTCTCGGG + Intronic
1025209749 7:57013794-57013816 GGGACTGCCCCTCTCCTCTCAGG + Intergenic
1025662204 7:63563057-63563079 GGGACTGCCCCTCTCCTCTCAGG - Intergenic
1027190255 7:75992347-75992369 GGCACCGCCCCTCCCCTCTCTGG - Intronic
1029744262 7:102507990-102508012 TGGGCAGCTCCTGCCTTCTCTGG - Intronic
1029749745 7:102536463-102536485 TGGAGGGGCCCTGCCCTCTGGGG - Intergenic
1029762253 7:102607152-102607174 TGGGCAGCTCCTGCCTTCTCTGG - Intronic
1029767695 7:102635568-102635590 TGGAGGGGCCCTGCCCTCTGGGG - Intronic
1030324200 7:108202831-108202853 TAAAAGGCCCCTGTCCTCTCAGG - Intronic
1031994736 7:128222458-128222480 AGGAATGACCCTGCCCTCTCAGG - Intergenic
1032526785 7:132583834-132583856 TCGAGGGTCCCTGCTCTCTCTGG - Intronic
1035038975 7:155913887-155913909 TGGACCAGCCCTGCCCTCACAGG - Intergenic
1035407069 7:158606052-158606074 TGGGGGTCCCCTGCCCTCTGAGG - Intergenic
1035671270 8:1419039-1419061 TGGACTCTCCGTGCCCTCTCTGG + Intergenic
1035761644 8:2073011-2073033 TGGACGGCCACTGCCCCAACCGG - Intronic
1036502453 8:9326099-9326121 TGGTGCGCCACTGCCCTCTCAGG - Intergenic
1036681580 8:10878258-10878280 TTGGCCGCCCCTGACCTCTCTGG + Intergenic
1037615743 8:20517589-20517611 GGGAGGGGCCCTGCCATCTCTGG + Intergenic
1037820187 8:22131421-22131443 TCGACTGCCCCTGCCAGCTCTGG - Exonic
1045266066 8:100619593-100619615 TGGGCAGCCGCTGGCCTCTCTGG - Intronic
1045331902 8:101162378-101162400 TGGACCTTCCATGCCCTCTCTGG - Intergenic
1049353294 8:142175587-142175609 GGGACCTCCCCTGGCCTCTCTGG - Intergenic
1049386903 8:142347419-142347441 GGGACAGGCCCTGCCCTCTTGGG - Intronic
1049439413 8:142602414-142602436 CGGACGGACCCTGCTCTTTCTGG + Intergenic
1049450924 8:142661048-142661070 TGGACTGCCCCTGACGTCGCAGG - Intronic
1049612400 8:143561664-143561686 GGGAAGGCCTCAGCCCTCTCTGG + Intronic
1052413517 9:28149458-28149480 TGCCCGGCCCCCGCCCTCTCTGG + Intronic
1053295643 9:36911211-36911233 TGGACAGTCCCTGCCCTCACTGG - Intronic
1054810520 9:69430427-69430449 TGGAAGGCCCCTTCCCTGGCAGG - Exonic
1056492285 9:87119765-87119787 TGGCCGGCCCCTCCACGCTCTGG + Intergenic
1057428172 9:94971085-94971107 TGGATGGCCCCTGAGCCCTCTGG + Intronic
1057725537 9:97565449-97565471 TGGAAGCCTCCTGCCCTCTCTGG - Intronic
1057855248 9:98596485-98596507 AGGACCACACCTGCCCTCTCTGG + Intronic
1060029733 9:120204027-120204049 TGCAGGGCCCATGGCCTCTCTGG + Intergenic
1060375028 9:123109793-123109815 TGGACTGCCCTTCCCCTCTGAGG - Intronic
1061055816 9:128222418-128222440 TGGGCTGCTCCTGCCCCCTCAGG + Intronic
1061449874 9:130662154-130662176 TGGACTGCCCCTTTCCTCTCTGG - Intergenic
1062190766 9:135246793-135246815 TCTACTGCCCCTGGCCTCTCAGG - Intergenic
1062287596 9:135779976-135779998 GGGCAGGCCCCTTCCCTCTCAGG - Intronic
1062332696 9:136051509-136051531 TGGGCCGCCCCCGCCCCCTCCGG - Intronic
1062395821 9:136352370-136352392 TGCAAGGCCCCTGCACTGTCTGG - Intronic
1062576572 9:137211702-137211724 TGGACCACCCCTGGCCTCCCGGG - Intronic
1186331022 X:8534367-8534389 TGGCCGGCCCCTCCCCTCCTGGG + Exonic
1187278631 X:17838939-17838961 GAGGCAGCCCCTGCCCTCTCAGG + Intronic
1190714187 X:53090360-53090382 GGCAAGGCCCCTTCCCTCTCTGG + Intergenic
1191877260 X:65809479-65809501 TGGCCTGCCCCACCCCTCTCTGG - Intergenic
1192432938 X:71124995-71125017 TGGACTGCCCTTCCCCTCACAGG - Exonic
1200120440 X:153787721-153787743 GGCACAGCCCCTGCCCTCTAAGG + Intronic
1200154260 X:153967015-153967037 GGGAGGGCCCCTGCCCTGCCTGG - Intronic