ID: 1101875843

View in Genome Browser
Species Human (GRCh38)
Location 12:108596645-108596667
Sequence TGGACGGCCCCTGCCCTCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 279
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 252}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101875832_1101875843 24 Left 1101875832 12:108596598-108596620 CCCCACCTGCAGTCAGCAGAGCC 0: 1
1: 0
2: 2
3: 41
4: 303
Right 1101875843 12:108596645-108596667 TGGACGGCCCCTGCCCTCTCTGG 0: 1
1: 0
2: 2
3: 24
4: 252
1101875835_1101875843 19 Left 1101875835 12:108596603-108596625 CCTGCAGTCAGCAGAGCCTCAAA 0: 1
1: 0
2: 3
3: 26
4: 220
Right 1101875843 12:108596645-108596667 TGGACGGCCCCTGCCCTCTCTGG 0: 1
1: 0
2: 2
3: 24
4: 252
1101875830_1101875843 29 Left 1101875830 12:108596593-108596615 CCCAGCCCCACCTGCAGTCAGCA 0: 1
1: 1
2: 4
3: 40
4: 365
Right 1101875843 12:108596645-108596667 TGGACGGCCCCTGCCCTCTCTGG 0: 1
1: 0
2: 2
3: 24
4: 252
1101875837_1101875843 3 Left 1101875837 12:108596619-108596641 CCTCAAAAAAGATGGTTGTGTGG 0: 1
1: 0
2: 0
3: 20
4: 198
Right 1101875843 12:108596645-108596667 TGGACGGCCCCTGCCCTCTCTGG 0: 1
1: 0
2: 2
3: 24
4: 252
1101875834_1101875843 22 Left 1101875834 12:108596600-108596622 CCACCTGCAGTCAGCAGAGCCTC 0: 1
1: 0
2: 2
3: 34
4: 301
Right 1101875843 12:108596645-108596667 TGGACGGCCCCTGCCCTCTCTGG 0: 1
1: 0
2: 2
3: 24
4: 252
1101875833_1101875843 23 Left 1101875833 12:108596599-108596621 CCCACCTGCAGTCAGCAGAGCCT 0: 1
1: 0
2: 0
3: 25
4: 253
Right 1101875843 12:108596645-108596667 TGGACGGCCCCTGCCCTCTCTGG 0: 1
1: 0
2: 2
3: 24
4: 252
1101875831_1101875843 28 Left 1101875831 12:108596594-108596616 CCAGCCCCACCTGCAGTCAGCAG 0: 1
1: 0
2: 4
3: 53
4: 440
Right 1101875843 12:108596645-108596667 TGGACGGCCCCTGCCCTCTCTGG 0: 1
1: 0
2: 2
3: 24
4: 252

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101875843 Original CRISPR TGGACGGCCCCTGCCCTCTC TGG Intronic