ID: 1101876064

View in Genome Browser
Species Human (GRCh38)
Location 12:108597661-108597683
Sequence CTGTGTGAGGGTGATGTGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3406
Summary {0: 1, 1: 0, 2: 2, 3: 119, 4: 3284}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101876064_1101876072 19 Left 1101876064 12:108597661-108597683 CCGTCCACATCACCCTCACACAG 0: 1
1: 0
2: 2
3: 119
4: 3284
Right 1101876072 12:108597703-108597725 GGCATCCACTTGCAGAAAAGTGG 0: 1
1: 0
2: 1
3: 11
4: 147
1101876064_1101876069 -2 Left 1101876064 12:108597661-108597683 CCGTCCACATCACCCTCACACAG 0: 1
1: 0
2: 2
3: 119
4: 3284
Right 1101876069 12:108597682-108597704 AGATCCTGGAAGCAACAGCCTGG 0: 1
1: 0
2: 1
3: 18
4: 195

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101876064 Original CRISPR CTGTGTGAGGGTGATGTGGA CGG (reversed) Intronic
Too many off-targets to display for this crispr