ID: 1101876069

View in Genome Browser
Species Human (GRCh38)
Location 12:108597682-108597704
Sequence AGATCCTGGAAGCAACAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 215
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 195}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101876061_1101876069 22 Left 1101876061 12:108597637-108597659 CCGATCCCTGCACACAGGACAAT 0: 1
1: 1
2: 0
3: 24
4: 179
Right 1101876069 12:108597682-108597704 AGATCCTGGAAGCAACAGCCTGG 0: 1
1: 0
2: 1
3: 18
4: 195
1101876062_1101876069 17 Left 1101876062 12:108597642-108597664 CCCTGCACACAGGACAATACCGT 0: 1
1: 0
2: 0
3: 2
4: 73
Right 1101876069 12:108597682-108597704 AGATCCTGGAAGCAACAGCCTGG 0: 1
1: 0
2: 1
3: 18
4: 195
1101876063_1101876069 16 Left 1101876063 12:108597643-108597665 CCTGCACACAGGACAATACCGTC 0: 1
1: 0
2: 0
3: 4
4: 40
Right 1101876069 12:108597682-108597704 AGATCCTGGAAGCAACAGCCTGG 0: 1
1: 0
2: 1
3: 18
4: 195
1101876065_1101876069 -6 Left 1101876065 12:108597665-108597687 CCACATCACCCTCACACAGATCC 0: 1
1: 0
2: 0
3: 32
4: 379
Right 1101876069 12:108597682-108597704 AGATCCTGGAAGCAACAGCCTGG 0: 1
1: 0
2: 1
3: 18
4: 195
1101876064_1101876069 -2 Left 1101876064 12:108597661-108597683 CCGTCCACATCACCCTCACACAG 0: 1
1: 0
2: 2
3: 119
4: 3284
Right 1101876069 12:108597682-108597704 AGATCCTGGAAGCAACAGCCTGG 0: 1
1: 0
2: 1
3: 18
4: 195

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101876069 Original CRISPR AGATCCTGGAAGCAACAGCC TGG Intronic
900152716 1:1185700-1185722 AGGCCCCGGAAGCAGCAGCCAGG + Intronic
900946026 1:5831900-5831922 AGACCCTGGGAGCCACATCCAGG + Intergenic
901019389 1:6248280-6248302 AGAACCTGGAAGCCCCTGCCAGG + Exonic
901257815 1:7846718-7846740 AGATTGTGGAAGAAAGAGCCTGG - Intronic
901436048 1:9248042-9248064 TGATCCTGGGGGCAACAGTCTGG + Intronic
902629608 1:17696894-17696916 GGATGCTGGTAGCCACAGCCAGG - Exonic
903333699 1:22611153-22611175 GGATCCTTGCAGGAACAGCCTGG + Intergenic
903691785 1:25179311-25179333 GGAAGCTGGCAGCAACAGCCAGG - Intergenic
904289064 1:29471930-29471952 AGAGCCTGGAAACAGGAGCCAGG + Intergenic
906251722 1:44315572-44315594 TGATCCTAGAATCATCAGCCTGG + Intronic
906979388 1:50612960-50612982 AGGTCCTTGAAGACACAGCCTGG + Intronic
907698215 1:56755590-56755612 AGATCCTGAAAGCAATAGCGAGG + Intronic
907756124 1:57312597-57312619 AGATCCTGGATGCATTAGCCTGG - Intronic
908692823 1:66802024-66802046 AGATCTGGTAAGTAACAGCCAGG - Intergenic
909248144 1:73315633-73315655 AGATTCTGGAACCAACTGCCTGG - Intergenic
909940127 1:81601985-81602007 AGAGCCTGAGAGCATCAGCCAGG + Intronic
910153373 1:84182800-84182822 AGGTCCTGGAACCAACCCCCAGG + Intronic
912978394 1:114349715-114349737 AGATCCTCTAAGCAACAGAGAGG + Intergenic
918043882 1:180929453-180929475 AGATCCTGTATCCAACTGCCTGG - Intronic
923048828 1:230375880-230375902 GGATTCTGGCACCAACAGCCGGG + Intronic
923048902 1:230376454-230376476 GGATTCTGGCACCAACAGCCTGG + Intronic
923197488 1:231682533-231682555 AGATAATGGAAGCAACAGAGAGG + Intronic
924156718 1:241184028-241184050 GGATCCTGGAAGCAAAGGCGAGG + Intronic
1064720787 10:18226571-18226593 AGATCGTAGAAGCAACAAACAGG - Intronic
1064749985 10:18518610-18518632 AAATCTTCAAAGCAACAGCCAGG - Intronic
1064880003 10:20040590-20040612 AGCTCCTGCAAGCTACAGTCTGG - Intronic
1068428068 10:56893319-56893341 AGATCCTGGAAGGATCTTCCAGG + Intergenic
1069852543 10:71419396-71419418 AGGCCCTGGAGGCAACACCCAGG + Intronic
1071464135 10:85924015-85924037 AGCTCCTGGAGGCCAAAGCCTGG + Intronic
1073043865 10:100624685-100624707 AGGTCCTGGAAGCAGAAACCAGG - Intergenic
1074158294 10:110816775-110816797 AGACTCTGGAAGCAAAGGCCTGG + Intronic
1075558339 10:123449383-123449405 AGATCCAGGCAGAAACATCCAGG + Intergenic
1075943885 10:126415560-126415582 AGGTCCTGGCAGCAACAATCTGG - Intergenic
1076649642 10:131979031-131979053 AGGTCCTGGAGGCAACAGGAAGG - Intronic
1077434797 11:2533785-2533807 TGATCCTGGAGACAAAAGCCAGG - Intronic
1078547428 11:12256429-12256451 AGATCCTGGAAAGAATATCCTGG + Intronic
1080758134 11:35221814-35221836 AGTCCCTGGAACCAGCAGCCTGG + Intronic
1081695818 11:45108472-45108494 AAAAGCTGGAAGCAGCAGCCAGG + Intronic
1081906424 11:46673255-46673277 AGATCCTCAAAGCAGCAGCCCGG - Intronic
1083275928 11:61597137-61597159 AAATGCTGGAAGGAACCGCCTGG - Intergenic
1084119002 11:67057963-67057985 AGATGCTGGAAGCAACTCCATGG - Intronic
1084486408 11:69450702-69450724 AGCCGCAGGAAGCAACAGCCAGG - Intergenic
1084719153 11:70892972-70892994 AGATACAGGAAGCACCAGCAGGG - Intronic
1085314638 11:75537005-75537027 AGATCCCAGCAGCAACACCCTGG - Intergenic
1089341563 11:117761412-117761434 AGACCCTGGAACCAAGAACCAGG + Intronic
1091929616 12:4384383-4384405 AGATCCTGGAAGGACCTGGCAGG + Intergenic
1092720853 12:11438951-11438973 AGATCTGGGATCCAACAGCCTGG + Intronic
1097957893 12:65505521-65505543 AGATCCTGAGAGCACCAGCCTGG - Intergenic
1098068573 12:66647045-66647067 AGACTAGGGAAGCAACAGCCAGG + Intronic
1101740739 12:107497971-107497993 ACATCCTGGAAGCAGAAGACAGG + Intronic
1101876069 12:108597682-108597704 AGATCCTGGAAGCAACAGCCTGG + Intronic
1106085317 13:26536491-26536513 AGATCCTGTGACCAACAGGCTGG - Intergenic
1112332784 13:98489513-98489535 AGTTCCTGAAAGCCAGAGCCAGG - Intronic
1113725988 13:112602137-112602159 ACAGCCAGAAAGCAACAGCCTGG - Intergenic
1114499562 14:23158278-23158300 GGATCCTGGGAGCACCACCCTGG + Intronic
1114776460 14:25487809-25487831 AGAGTCTGGGACCAACAGCCAGG + Intergenic
1115346450 14:32348098-32348120 AGAACCTGGAAGACACAGCTGGG + Intronic
1117730484 14:58717069-58717091 AGATGCTGCCAGCAACAGTCTGG + Intergenic
1118868408 14:69721215-69721237 AGTTCCTGCCAGCAACAGCCAGG + Intergenic
1119539926 14:75431337-75431359 AGAACCTGGAACCAACCCCCAGG - Intronic
1119656749 14:76422575-76422597 AGGTCCTGGCAGCCACAGCAAGG - Intronic
1121026999 14:90623682-90623704 AGATCCCAGGAGCAACACCCTGG - Intronic
1122251337 14:100442002-100442024 AGCCCTTGGGAGCAACAGCCTGG - Intronic
1122438961 14:101717176-101717198 AGACCCTCAAAGCGACAGCCTGG - Intergenic
1124467392 15:29950560-29950582 AGAGCCTGGAAGAAACTGCAGGG - Intronic
1124880353 15:33636453-33636475 AGATCATTGAAGCATCATCCAGG - Exonic
1125398588 15:39276028-39276050 AGCTCCTTGAACCAAAAGCCTGG + Intergenic
1126096433 15:45094117-45094139 GGATACTGGAAGCAGCAGCCAGG + Exonic
1127731999 15:61810243-61810265 AGATCATGGCAAAAACAGCCGGG - Intergenic
1128747557 15:70125240-70125262 AGATGGTGGAAGCACCAGCCAGG - Intergenic
1129665953 15:77579523-77579545 AGGGCCTGGAAACAAGAGCCAGG + Intergenic
1130046542 15:80450261-80450283 AGATCCAGGAAGCCTCAGCCTGG + Intronic
1132977702 16:2718932-2718954 GGGGGCTGGAAGCAACAGCCAGG + Intronic
1133128523 16:3662357-3662379 AGCTCCTGGAGGCAGCAGCGGGG - Exonic
1134178398 16:12027456-12027478 AGCTCCTCCAAGCTACAGCCAGG - Intronic
1136633994 16:31507860-31507882 AGAGGCTGGAAGCAAACGCCTGG + Exonic
1136635770 16:31521927-31521949 AGACCCTGGAGGCAGCATCCAGG - Intergenic
1139442960 16:66977898-66977920 AGATACTGGAAGCATCTGCTAGG - Intergenic
1139970888 16:70774169-70774191 AGATCCTGGAACAAAAGGCCAGG - Intronic
1140809051 16:78559351-78559373 AGATCATGGAGGCCAGAGCCAGG + Intronic
1141461274 16:84180024-84180046 CGATCCTGGAAGGAAGAGACTGG + Exonic
1144480517 17:15625259-15625281 AGATTCTGGAAACAACAGACTGG + Intronic
1144917793 17:18738486-18738508 AGATTCTGGAAACAACAGACTGG - Intergenic
1147692108 17:42322518-42322540 AGATCATGGAACCTACAGCTAGG + Intronic
1151963318 17:77418878-77418900 GGCCCCTGGAAGCCACAGCCAGG + Intronic
1152764366 17:82128025-82128047 TGATCCTGGGAGCATCTGCCTGG - Intronic
1154179542 18:12120928-12120950 AGATCCAGGAAGGAACTGTCTGG - Intronic
1155909888 18:31495327-31495349 AGATCCTGGAGCCAAAATCCTGG + Intergenic
1156264234 18:35471521-35471543 AAATGCTGGAAGCAACATCAAGG - Intronic
1156379751 18:36547193-36547215 AGCTCCTGGCAGCACCAGGCCGG + Intronic
1157232343 18:45929847-45929869 TGATCCTGGAAAGAACATCCAGG + Intronic
1159386222 18:67728553-67728575 AGATGCTGGAACTATCAGCCAGG - Intergenic
1159493426 18:69167964-69167986 ACATCTTGGAATCAACAGACTGG + Intergenic
1160102870 18:75939351-75939373 AGCTCCTGGTAGCACCACCCTGG - Intergenic
1161000917 19:1910362-1910384 AGAGCCTGGAAGCAGAAGCGGGG - Intronic
1162510615 19:11116003-11116025 GAATTCTGGAAGAAACAGCCAGG - Intronic
1162540672 19:11294057-11294079 AGCTCCTGGAAGGAACTGGCCGG - Intergenic
1165106700 19:33474263-33474285 AGAGCCTGGGATCAACAGTCTGG + Intronic
1165158012 19:33799551-33799573 AGTCCCTGGAAGCCACACCCAGG - Intronic
1165933813 19:39376995-39377017 AGATCCTGGAACCACAAACCAGG - Intronic
1167377079 19:49118084-49118106 AGATCCAGGAAGCACTGGCCTGG - Intronic
1167612092 19:50512576-50512598 AGGCTCTGGAAGCAAGAGCCCGG + Exonic
928280208 2:29939732-29939754 TGGTGCTGGAAGCAACACCCTGG + Intergenic
928937449 2:36693988-36694010 AGAAGCTGGAAGCAAAGGCCTGG - Intergenic
931729157 2:65137842-65137864 ACATCGTGGAAGCAAAAGGCAGG + Intergenic
934769132 2:96896734-96896756 AGCTCCAGGAAGCAGCAGGCAGG - Intronic
934858055 2:97741256-97741278 AGATCCTGCAAGCACCTTCCAGG - Intergenic
935966218 2:108479343-108479365 CGATCTGGGAAGCAAGAGCCGGG + Intronic
937254019 2:120541959-120541981 CGATCCTGCAAGCAGCAGGCAGG - Intergenic
938061766 2:128260730-128260752 AGATCCCAGAAGCAGCAGCCAGG + Intronic
939777539 2:146405486-146405508 AGATCCTGGGAGCAACTGGAAGG - Intergenic
942179289 2:173364824-173364846 TTCTCCTGGAAGCAACACCCGGG - Exonic
942281267 2:174365904-174365926 AGATTCTGGAAGTATCAGACTGG + Intronic
942955886 2:181772903-181772925 AGATCCTGAAAGATTCAGCCTGG - Intergenic
943146556 2:184053567-184053589 AGAACCAGGAAGCTACAGCTGGG - Intergenic
944203859 2:197136594-197136616 CACTTCTGGAAGCAACAGCCCGG + Exonic
944536307 2:200713762-200713784 ACAGCCTGGACGCAACAGCCGGG - Intergenic
946467652 2:219926388-219926410 ATATCCTGGAAGAAACTGTCAGG + Intergenic
948387525 2:237590890-237590912 AGATCCTGGAAGTGAAACCCCGG - Exonic
1169488680 20:6053775-6053797 AGATCCTGGAACCTGAAGCCAGG + Intronic
1170797959 20:19566126-19566148 AGATCATTCAAGCAACAACCGGG + Intronic
1170871492 20:20210507-20210529 TGATGCTGCAGGCAACAGCCAGG - Intronic
1171149258 20:22812389-22812411 AGATCAAGGAAGCAAGATCCTGG - Intergenic
1174481300 20:50833259-50833281 AGAAACTGGCAGCAGCAGCCAGG + Intronic
1176298748 21:5088546-5088568 AGCTGCTGGAGGCAGCAGCCTGG - Intergenic
1178239309 21:30880973-30880995 AGATCCTGGAAACAGCTGGCAGG + Exonic
1179858278 21:44173403-44173425 AGCTGCTGGAGGCAGCAGCCTGG + Intergenic
1181010654 22:20038551-20038573 AGGTCCTGGCAGCAACACACGGG - Intronic
1182070456 22:27459785-27459807 AGATGCTTGAAACAACAGCACGG + Intergenic
1182168458 22:28201635-28201657 AGAGGATGGCAGCAACAGCCAGG + Intronic
1183370936 22:37432025-37432047 AGAGCCTGGAAGAAAAAGACGGG + Intergenic
1184378149 22:44128103-44128125 AGATTCTGGAAGCAGCTGCCGGG + Intronic
1185277021 22:49954196-49954218 GGATCCTGGCAGCCACCGCCTGG - Intergenic
950210691 3:11120702-11120724 AGCTCCACGAAGGAACAGCCTGG + Intergenic
954326636 3:49867675-49867697 AGAACCTTGAAGAAGCAGCCAGG - Intronic
954466480 3:50658105-50658127 AGATGTTGGAAGCCATAGCCTGG + Intergenic
958406046 3:93760531-93760553 ACATCCCAGAAGCGACAGCCGGG + Intergenic
960589040 3:119347636-119347658 CTGTCCTGGGAGCAACAGCCAGG - Intronic
961167288 3:124772180-124772202 AGATCCAAGTAGAAACAGCCCGG - Intronic
961757423 3:129137535-129137557 AGAAACTGGAAGGAACAGCCAGG + Intronic
962480469 3:135793866-135793888 AGATTCTGGAAGCCAAAGCTGGG + Intergenic
966298626 3:178453321-178453343 AGATCTAGGAAGCAAGAACCTGG + Intronic
967995082 3:195160493-195160515 AGGACCTGGAAGCAGCTGCCTGG + Intronic
968954307 4:3710470-3710492 AGAGCCGGGAAGCACCGGCCGGG + Intergenic
969939301 4:10714138-10714160 AGTTTGTGGAAGCCACAGCCTGG - Intergenic
971326665 4:25650168-25650190 AGTTCCCAGCAGCAACAGCCAGG + Intergenic
981573048 4:146174215-146174237 AGATGCTGAAAGCAAAAACCTGG + Intergenic
982246812 4:153361506-153361528 ATTTCATGGAAGCAGCAGCCAGG - Intronic
982885430 4:160774364-160774386 AGCAGCAGGAAGCAACAGCCTGG + Intergenic
983501830 4:168508029-168508051 AGCACCTAGAAGCAACAGCAAGG - Intronic
985126921 4:186703696-186703718 AGTTCCAGCAAGCACCAGCCTGG + Intronic
986045580 5:4034458-4034480 GCATCCTGGAAGCACCACCCAGG - Intergenic
986220309 5:5763170-5763192 AGATGCTGGAAGCATCAGGAGGG - Intergenic
988148470 5:27343611-27343633 AGATCTTGGAATCTGCAGCCTGG - Intergenic
988628275 5:32900655-32900677 AGCTCATGAAAGCAGCAGCCAGG - Intergenic
988927479 5:36004227-36004249 ACATCCTGGAAGCACTATCCCGG + Intergenic
992326288 5:75663408-75663430 TGCTCCTGGAGGCCACAGCCAGG - Exonic
998245975 5:140505736-140505758 TAATCCTGGCAGCAACAGCAGGG + Exonic
998888238 5:146717766-146717788 AGATCCTGAAAGCAAAAGTAGGG - Intronic
1000029350 5:157389019-157389041 TGATCCTGAATGCAACAGCAGGG - Intronic
1003189614 6:3862625-3862647 AGATTCTGGAAGCCACTGTCTGG + Intergenic
1003447496 6:6198252-6198274 TGACCCTGGAAGCAAGAGCATGG + Intronic
1004399679 6:15276776-15276798 GGATACTGAAAGCAACAGCCTGG - Intronic
1006715530 6:36117083-36117105 AGTCCCTGGCAGCCACAGCCAGG + Intergenic
1006814027 6:36839036-36839058 ATCTCCTCGATGCAACAGCCTGG + Intronic
1007099296 6:39233815-39233837 AGATCCTGGAAGCATGACCTTGG - Intergenic
1007439617 6:41847005-41847027 AGATCCTGGAAACAACAACCAGG + Intronic
1007706999 6:43797282-43797304 AGATTCTGGGATCCACAGCCTGG + Intergenic
1011888334 6:92125848-92125870 AGTTCCTGGAAGCAAAACCAGGG - Intergenic
1012986584 6:105882686-105882708 GGATCTTGTAAGCAAAAGCCTGG - Intergenic
1013654634 6:112233109-112233131 AGCTCCTGGAATGAGCAGCCAGG + Intronic
1016210802 6:141531436-141531458 ACATCTTGGCAGGAACAGCCTGG + Intergenic
1016813265 6:148281285-148281307 GCATCCAGGAAACAACAGCCTGG + Intronic
1017566465 6:155692491-155692513 GGATCCTGGAAGTGACAGCAGGG + Intergenic
1018902208 6:168057319-168057341 AGATCCAGGAAATGACAGCCGGG - Exonic
1018990951 6:168673519-168673541 AGATCATGGAAGCCTCAGCAAGG + Intergenic
1019187826 6:170231203-170231225 GGATCCTGGGAGCCACGGCCAGG - Intergenic
1019361431 7:606334-606356 AGACCCTCGAAGCAACATCCTGG + Intronic
1020846383 7:13289648-13289670 AGAGCATGGATCCAACAGCCAGG - Intergenic
1021639664 7:22725199-22725221 AGGTCCTTGATGTAACAGCCAGG + Intergenic
1022338886 7:29449997-29450019 AGATCCTGGAAGCCACTTCACGG - Intronic
1022545893 7:31188583-31188605 AGATGTTGGCAGCAGCAGCCTGG - Intergenic
1022651248 7:32277557-32277579 AGAACCTGGGAGCAACTGACAGG + Intronic
1023911554 7:44560225-44560247 GGATGCTGGGAGCAACAGTCAGG - Intergenic
1024543356 7:50497279-50497301 AGATCCTATCAGCAACAGACAGG - Intronic
1024582238 7:50809600-50809622 AGATCCTTGAAGCATCCTCCTGG + Intergenic
1025142484 7:56477673-56477695 AAATCTTGGCAGTAACAGCCTGG - Intergenic
1029620059 7:101684791-101684813 AGCCCCGGGGAGCAACAGCCAGG + Intergenic
1032285156 7:130534139-130534161 AGATCGAAGAAGCAAGAGCCTGG + Intronic
1033725975 7:144118942-144118964 ACACCCAGGAAGCCACAGCCAGG + Intergenic
1033726984 7:144129538-144129560 ACACCCAGGAAGCCACAGCCAGG - Exonic
1035295099 7:157862780-157862802 AGCTCCGGGAAGCACAAGCCTGG + Intronic
1036178304 8:6560914-6560936 ATCTCCTCGAAGAAACAGCCAGG - Intronic
1037912840 8:22754222-22754244 AGATACTGGAAGCACCAGGAGGG - Intronic
1038328286 8:26588707-26588729 ACATCCAGGGAGCCACAGCCAGG - Intronic
1038887233 8:31676694-31676716 GGATTCTGGAATCAGCAGCCAGG + Intronic
1040597362 8:48852134-48852156 AGGTCCTGGAATCAATACCCAGG - Intergenic
1040761943 8:50858023-50858045 AGACCCGAGAAGCAACAGCCTGG + Intergenic
1048199195 8:132357693-132357715 AGATCACAGAAGCAACAGCTTGG - Intronic
1049320585 8:141994192-141994214 AGACCCTGGAAACACCAGCTAGG + Intergenic
1055352326 9:75402479-75402501 TTCTCCTGGAAGCAACATCCGGG + Intergenic
1055372674 9:75617112-75617134 GGATCCTGGAATCAATGGCCAGG - Intergenic
1060133946 9:121133369-121133391 AGACCTTGGAGGCAGCAGCCTGG - Intronic
1060706486 9:125806458-125806480 CCATCCTGGAAGCAGAAGCCTGG - Intronic
1061375066 9:130219391-130219413 AGCTCCTCTCAGCAACAGCCCGG - Intronic
1061597838 9:131643829-131643851 AGATCTTTGAAACAAAAGCCTGG - Intronic
1186136563 X:6527903-6527925 AGAAACTGGAAGGAACAGACTGG - Intergenic
1186386788 X:9117966-9117988 ATATGGTAGAAGCAACAGCCAGG + Intronic
1186443034 X:9602317-9602339 AGAACTTGGAAGACACAGCCAGG - Intronic
1189195995 X:39153093-39153115 AGGGCCAGGAACCAACAGCCTGG - Intergenic
1190050871 X:47147388-47147410 AGATCATGGTAGCAGCAGCGGGG + Exonic
1192181156 X:68916568-68916590 AGCTCCCGGAAGCAAGGGCCAGG + Intergenic
1192316303 X:70054466-70054488 ACACCCTGGCAGCCACAGCCAGG + Intergenic
1195331128 X:103801499-103801521 AGATCCTGGAACTGACAACCTGG + Intergenic
1200071736 X:153532554-153532576 AGCCCCTGGAGGCAGCAGCCAGG + Intronic