ID: 1101876072

View in Genome Browser
Species Human (GRCh38)
Location 12:108597703-108597725
Sequence GGCATCCACTTGCAGAAAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 147}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101876064_1101876072 19 Left 1101876064 12:108597661-108597683 CCGTCCACATCACCCTCACACAG 0: 1
1: 0
2: 2
3: 119
4: 3284
Right 1101876072 12:108597703-108597725 GGCATCCACTTGCAGAAAAGTGG 0: 1
1: 0
2: 1
3: 11
4: 147
1101876068_1101876072 6 Left 1101876068 12:108597674-108597696 CCTCACACAGATCCTGGAAGCAA 0: 1
1: 0
2: 1
3: 27
4: 266
Right 1101876072 12:108597703-108597725 GGCATCCACTTGCAGAAAAGTGG 0: 1
1: 0
2: 1
3: 11
4: 147
1101876070_1101876072 -6 Left 1101876070 12:108597686-108597708 CCTGGAAGCAACAGCCTGGCATC 0: 1
1: 0
2: 23
3: 51
4: 221
Right 1101876072 12:108597703-108597725 GGCATCCACTTGCAGAAAAGTGG 0: 1
1: 0
2: 1
3: 11
4: 147
1101876065_1101876072 15 Left 1101876065 12:108597665-108597687 CCACATCACCCTCACACAGATCC 0: 1
1: 0
2: 0
3: 32
4: 379
Right 1101876072 12:108597703-108597725 GGCATCCACTTGCAGAAAAGTGG 0: 1
1: 0
2: 1
3: 11
4: 147
1101876067_1101876072 7 Left 1101876067 12:108597673-108597695 CCCTCACACAGATCCTGGAAGCA 0: 1
1: 0
2: 0
3: 16
4: 228
Right 1101876072 12:108597703-108597725 GGCATCCACTTGCAGAAAAGTGG 0: 1
1: 0
2: 1
3: 11
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101876072 Original CRISPR GGCATCCACTTGCAGAAAAG TGG Intronic
900272408 1:1798058-1798080 GGCATGCACTTGGAGAGCAGAGG + Intronic
900704150 1:4068362-4068384 GCCCTTCACTTGCTGAAAAGGGG + Intergenic
904504155 1:30937020-30937042 GGCATCCAATCGTAGGAAAGGGG + Intronic
905537747 1:38736509-38736531 GGCAAGCACTAGCAGAAGAGAGG + Intergenic
907535770 1:55154903-55154925 AGCATCCACTTGCATAATATTGG + Intronic
908988025 1:70048937-70048959 GCCAGCCACTTGCAGACATGGGG - Intronic
909111255 1:71480687-71480709 AGAATCCACTGACAGAAAAGTGG + Intronic
909974782 1:82032774-82032796 GGCATCAGGTTTCAGAAAAGGGG - Intergenic
910134253 1:83948332-83948354 GGCAACAAGTTGCAGTAAAGAGG + Intronic
910593953 1:88958598-88958620 AGCATCCACTATCAGATAAGTGG - Intronic
915041298 1:152970255-152970277 GGCAGCAATTTGCAGAAAAAGGG + Intergenic
916453378 1:164943662-164943684 GGCATCCAAGTTGAGAAAAGAGG - Intergenic
917525983 1:175788941-175788963 AGCATCAGCTTGAAGAAAAGGGG + Intergenic
918436317 1:184516925-184516947 GGCATCCAGTTGGTGAAAACTGG + Intronic
918652056 1:186977594-186977616 AACTTCTACTTGCAGAAAAGTGG + Exonic
1065120513 10:22525786-22525808 TGCAGCAACTTGCAGAAGAGGGG - Intergenic
1065120884 10:22529732-22529754 TGCAGCAACTTGCAGAAGAGGGG - Intergenic
1068227898 10:54130497-54130519 GGCATTCACTTGAGGAAAATAGG - Intronic
1068500673 10:57837598-57837620 CCCATCCTCTTGGAGAAAAGTGG - Intergenic
1069676687 10:70253826-70253848 TGCATCAACTTGAAGAAATGTGG - Exonic
1072193519 10:93095336-93095358 GGCATTCACCTCCAGAAGAGAGG + Intergenic
1074403991 10:113165207-113165229 GGCATCTATTTGCCAAAAAGTGG - Intronic
1079509576 11:21195364-21195386 GGCAACCACTATCAGAAAATCGG + Intronic
1080052121 11:27868746-27868768 GGAATGCACCTGCAGGAAAGAGG - Intergenic
1080684706 11:34505454-34505476 GGCAACCTCTTGCAGATAAAAGG - Intronic
1082058139 11:47837357-47837379 GGCATCCAATTGCAGATGAAAGG + Intronic
1083414241 11:62514974-62514996 TGCCTCCACTGGCAGAAATGGGG + Intronic
1083913513 11:65724998-65725020 GGCTTCCACTGGCAGAAGATGGG - Intergenic
1087947899 11:104186550-104186572 GGCATCCAATTGTCCAAAAGGGG - Intergenic
1088067984 11:105744321-105744343 AGCATGCACTTCCAAAAAAGAGG - Intronic
1088940020 11:114444217-114444239 GACATCAACTTTCAGAGAAGGGG + Intronic
1089934515 11:122349961-122349983 AGGATTCACTTGCAGAAAAATGG - Intergenic
1090384130 11:126346791-126346813 GGCTACCACCTGCAGTAAAGGGG - Intergenic
1092309861 12:7340848-7340870 TACACCAACTTGCAGAAAAGTGG - Intergenic
1096657089 12:53098447-53098469 AGCTTCCACTTGGAGAAAAGGGG + Intronic
1097139455 12:56887622-56887644 GGCATCCCCATGCAGCATAGGGG + Intergenic
1098672133 12:73244801-73244823 AGCAACAATTTGCAGAAAAGAGG - Intergenic
1098690006 12:73475054-73475076 GGCATACATATGAAGAAAAGTGG + Intergenic
1100280521 12:93114007-93114029 GGCATCTACTTTCAGAAGAAAGG + Intergenic
1101876072 12:108597703-108597725 GGCATCCACTTGCAGAAAAGTGG + Intronic
1102824364 12:115935269-115935291 GACATCCACATGCAAAAAAAGGG + Intergenic
1102976859 12:117213073-117213095 GGCAGGCACATGCAGAAAGGAGG + Exonic
1107433893 13:40364872-40364894 GGCATCCACTGCCTGAATAGTGG - Intergenic
1109053342 13:57512923-57512945 GTCATCCTCTTTCAGTAAAGGGG - Intergenic
1109424810 13:62155169-62155191 GCCATCCTCTGGGAGAAAAGTGG - Intergenic
1110776545 13:79414287-79414309 GAGATACATTTGCAGAAAAGAGG - Intergenic
1113551116 13:111193869-111193891 GCCATCCTCTGGGAGAAAAGTGG + Intronic
1115657815 14:35460673-35460695 GAAATCCATATGCAGAAAAGAGG + Intergenic
1119569735 14:75660120-75660142 GGCATACTTGTGCAGAAAAGTGG - Intronic
1120779211 14:88470957-88470979 AGCAGCCACTTGCAGAATAGAGG - Intronic
1125511226 15:40293495-40293517 GGCCTCTACTTACAGACAAGAGG - Intronic
1129012519 15:72435084-72435106 GACATCCACTTGCAAAAGAATGG - Intergenic
1132136486 15:99345610-99345632 AGAATCCACTTGCATAAAAAAGG - Intronic
1132871801 16:2118681-2118703 GGCATCCCCTTGCTGGACAGTGG - Exonic
1134520727 16:14918215-14918237 GGCATCCCCTTGCTGGACAGTGG + Intronic
1134550849 16:15137759-15137781 GGCATCCCCTTGCTGGACAGTGG - Intronic
1134708399 16:16316866-16316888 GGCATCCCCTTGCTGGACAGTGG + Intergenic
1134715614 16:16356899-16356921 GGCATCCCCTTGCTGGACAGTGG + Intergenic
1134951203 16:18351779-18351801 GGCATCCCCTTGCTGGACAGTGG - Intergenic
1134959143 16:18395260-18395282 GGCATCCCCTTGCTGGACAGTGG - Intergenic
1141665757 16:85464350-85464372 GGCAGCCGCTTAGAGAAAAGGGG + Intergenic
1145836392 17:27957176-27957198 GGAGTCCAGTTTCAGAAAAGAGG - Intergenic
1156392032 18:36659825-36659847 GGATTCCAGTGGCAGAAAAGCGG - Intronic
1156503354 18:37574006-37574028 GTCATCCACTTGCTGTAATGTGG - Intergenic
1156507985 18:37610802-37610824 GGCATCAACATACAGAAGAGAGG - Intergenic
1161745624 19:6057980-6058002 GCCATCTCCTTGCCGAAAAGTGG + Intronic
1164437742 19:28246451-28246473 GGCAAGCACATGGAGAAAAGGGG - Intergenic
1164582358 19:29442370-29442392 GGCAGCCACTGACAGAAACGAGG - Intergenic
1165268873 19:34687468-34687490 GGCTTCCACATGGAGGAAAGGGG + Intergenic
1165275297 19:34745780-34745802 GGCTTCCACATGAAGGAAAGGGG + Intergenic
926918876 2:17919511-17919533 AGCATCAACTAGCAAAAAAGAGG - Intronic
928453789 2:31401306-31401328 GGCAGGCATTGGCAGAAAAGTGG + Exonic
929724976 2:44415715-44415737 GGCAGCCACTTGAAGAAATGTGG - Intronic
930229420 2:48827880-48827902 TGCATCAACCTACAGAAAAGTGG + Intergenic
932623756 2:73282975-73282997 AAAATCCACATGCAGAAAAGGGG + Intronic
936271952 2:111055684-111055706 GGCCTCCACATGGAAAAAAGGGG + Intronic
939567979 2:143807120-143807142 AGCATTCATTTGCTGAAAAGTGG - Intergenic
940910354 2:159204671-159204693 GGCATCCCCTTCCAGAAATTAGG - Intronic
945616912 2:212082602-212082624 CGAATCCACTTGTAGAAAATAGG - Intronic
948243548 2:236458650-236458672 GGCATTCGCTGGCAGAAAATGGG + Intronic
1168816915 20:743981-744003 GGGATTCACTTCCAGAACAGTGG + Intergenic
1169823782 20:9743536-9743558 TGCATCCCAGTGCAGAAAAGGGG + Intronic
1169954624 20:11087551-11087573 GACATTCACTTACAGAAAACCGG - Intergenic
1172017649 20:31887723-31887745 AGAATCCACTTGCACAAAGGAGG + Intronic
1173052792 20:39580864-39580886 GGCAGCCACTTGAAGAAGAAAGG + Intergenic
1173656105 20:44701289-44701311 GGGATCCACTTGCAGAAAGGCGG - Intergenic
1176366291 21:6034783-6034805 GGTATCCACTGGCACAAAAGTGG + Intergenic
1178240506 21:30894239-30894261 GGCATCCTCTTTCAGAACTGTGG - Intergenic
1178683833 21:34695975-34695997 GACATCCACATGCAGAAACCAGG - Intronic
1179364775 21:40748244-40748266 GGCATCCAAATTAAGAAAAGAGG + Intronic
1179757226 21:43503762-43503784 GGTATCCACTGGCACAAAAGTGG - Intergenic
1182329191 22:29538425-29538447 GGCATACACTTACAGATAAGGGG + Intronic
950095962 3:10330601-10330623 GGCACCCACCTGCAGAGCAGTGG + Intronic
951509567 3:23486293-23486315 GGCACCCACATCCAGACAAGGGG + Intronic
953858445 3:46520812-46520834 GGCATCCACACCCAGAAAGGAGG + Intronic
955033897 3:55247997-55248019 GACATCCACCTGCAGCAAGGAGG + Intergenic
956152368 3:66257400-66257422 GGAATTCACTTGCAGAACTGGGG + Intronic
958523810 3:95226430-95226452 TGGAGCAACTTGCAGAAAAGGGG - Intergenic
959520352 3:107317345-107317367 GCAATCCCCTTACAGAAAAGTGG - Intergenic
960203138 3:114862334-114862356 GGCATCCACTTTCAAAACAGAGG - Intronic
971145176 4:23968564-23968586 GTCATCCAGTTGCAGAAATAAGG - Intergenic
971878581 4:32337923-32337945 TACATCAATTTGCAGAAAAGTGG + Intergenic
974159213 4:58115811-58115833 GGCATCCTCTTGAAGATAACAGG + Intergenic
974771533 4:66420936-66420958 GGCATCCACTTTCATAATATTGG - Intergenic
975716950 4:77214288-77214310 GACATCCACTTGGGGAAGAGTGG - Intronic
979826416 4:125239126-125239148 GGAATCCACTTGCAGGAAGATGG + Intergenic
980842504 4:138281795-138281817 GGATTCCACTGGGAGAAAAGAGG - Intergenic
981857513 4:149311993-149312015 GTGAACCACTTGCAGAAAATAGG + Intergenic
984653516 4:182293423-182293445 GGAATTCACTTACAGTAAAGAGG + Intronic
987869374 5:23593669-23593691 GTAATCCACTTACAGAAAAGTGG - Intergenic
987930922 5:24398476-24398498 CCCATCCTCTGGCAGAAAAGTGG - Intergenic
989821792 5:45801266-45801288 GGCACCCACATGTGGAAAAGGGG - Intergenic
995807266 5:116067140-116067162 GACTTCCATTTGCAGAAAAATGG - Intergenic
998462610 5:142320897-142320919 GGTGGCCACTTGCAGAAGAGTGG - Intronic
999435942 5:151563416-151563438 GGCATCCAGTTGAAGCACAGAGG + Exonic
1000339217 5:160264365-160264387 GCCAGCCACATGCAGAAAGGAGG - Intronic
1001078308 5:168646683-168646705 GGCATCCATTTCCAAAATAGGGG - Intergenic
1001629475 5:173164061-173164083 GCCAGCTACTTGCAGAAAAGTGG - Exonic
1002436039 5:179231571-179231593 AGCATAAACTTGCAGAGAAGAGG + Intronic
1004038325 6:11947246-11947268 GTCATCCACTAGGAGAAAGGAGG + Intergenic
1005435746 6:25810053-25810075 GGTATCCACATGCAGAAGAATGG + Intronic
1007277935 6:40689241-40689263 GGCAGGCACTGGCAGACAAGAGG + Intergenic
1015834009 6:137399682-137399704 GGAATGCATTTGAAGAAAAGTGG + Intergenic
1017623253 6:156320497-156320519 GACATCCACATGCAAAAAAAGGG - Intergenic
1019093441 6:169559711-169559733 GGAATCATCTTGAAGAAAAGCGG - Intronic
1021570950 7:22064833-22064855 GGCATCCACTTGGGGCAATGGGG + Intergenic
1024208101 7:47180984-47181006 ACCATGCACTTGCAGAGAAGAGG + Intergenic
1028102640 7:86839661-86839683 GGTATACCCTTGCAGAGAAGCGG + Exonic
1028462185 7:91106719-91106741 GCCATCCACTTGGAGAACTGAGG + Intronic
1030363834 7:108624303-108624325 GGCATTCATTTGCACAAATGAGG - Intergenic
1031272224 7:119666127-119666149 GGCATCCAATTGCAGTATAAAGG - Intergenic
1036432121 8:8701656-8701678 TGCAGCCACTCGCAGAGAAGTGG - Intergenic
1036538111 8:9672272-9672294 GGCATCCACTTACATAATGGGGG + Intronic
1037486864 8:19356242-19356264 GCCAGCCACTTTGAGAAAAGGGG + Intronic
1040301233 8:46189060-46189082 GGCGACCACTTGCAAAAACGGGG + Intergenic
1040303187 8:46198695-46198717 GGCACCCACTAGCAAAAATGTGG + Intergenic
1041463663 8:58138230-58138252 GGCATCCACTAGCTGAGCAGAGG - Intronic
1042145593 8:65726136-65726158 ACCATCCACTTCAAGAAAAGTGG - Intronic
1045436063 8:102165933-102165955 GGTAACCAGTTGCAGAAATGAGG - Intergenic
1045628005 8:104079239-104079261 GGCAGCTACTTGCAGGTAAGAGG + Intronic
1046100690 8:109610768-109610790 TGCAGCCACCAGCAGAAAAGGGG - Intronic
1049077345 8:140409553-140409575 AACATCCACATGCAGAAGAGTGG + Intronic
1050715625 9:8521902-8521924 GGCATGTATATGCAGAAAAGGGG + Intronic
1051019072 9:12518240-12518262 TGCATTCACCTACAGAAAAGGGG + Intergenic
1053739889 9:41127257-41127279 GGCGGACACTTGCAGCAAAGGGG + Exonic
1054442854 9:65283251-65283273 GGCGGACACTTGCAGCAAAGGGG + Exonic
1054487424 9:65738250-65738272 GGCGGACACTTGCAGCAAAGGGG - Exonic
1054688461 9:68304056-68304078 GGCGGACACTTGCAGCAAAGGGG - Exonic
1055314855 9:75023955-75023977 GACATCCTCTTGCTGATAAGAGG + Intronic
1056693501 9:88827530-88827552 TGCACCCACTTGCTGAAAAGAGG - Intergenic
1056956832 9:91089348-91089370 GGCATCCACTTAGAGGAAGGTGG - Intergenic
1057463726 9:95292241-95292263 GATATCCACATGCAGAAAAACGG + Intronic
1062117373 9:134816696-134816718 GGCATCCCCTTTCACAGAAGGGG - Intronic
1186022027 X:5267441-5267463 GGCATCCACTTCCAGAAATATGG + Intergenic
1186086000 X:5991424-5991446 AGCATCCCCTTTCAGAAATGAGG - Intronic
1186316595 X:8377471-8377493 GTCCTGCACTTGCTGAAAAGAGG - Intergenic
1188106365 X:26152213-26152235 TGCCTCCACTTGGACAAAAGAGG + Intergenic
1189523710 X:41797902-41797924 GCCATCTACTTGCAGATAACTGG + Intronic
1191925236 X:66301966-66301988 GGCCTCCACTGGTAGAAATGGGG + Intergenic
1198567001 X:137915287-137915309 TGCATCCATTTGCACAAAGGAGG + Intergenic