ID: 1101876602

View in Genome Browser
Species Human (GRCh38)
Location 12:108600155-108600177
Sequence GGTGAGTTAGTGGCAGGCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 333
Summary {0: 1, 1: 0, 2: 4, 3: 34, 4: 294}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101876602 Original CRISPR GGTGAGTTAGTGGCAGGCCC TGG Intergenic
900423398 1:2565283-2565305 GCTGGGTTAGTGGCAGCTCCGGG + Intronic
900468288 1:2836582-2836604 TGTGAATTAGTGTCTGGCCCTGG + Intergenic
900556111 1:3281419-3281441 GGTGTTTTATTGGCAGGCACAGG - Intronic
900615030 1:3561579-3561601 GGGGAGCTTGTGGGAGGCCCAGG + Intronic
901231870 1:7646091-7646113 GGTGAGTTGGGTGGAGGCCCTGG + Intronic
901231922 1:7646294-7646316 GGTGAGTTGGGTGGAGGCCCTGG + Intronic
901231935 1:7646336-7646358 GGTGAGTTGGGTGGAGGCCCTGG + Intronic
901231952 1:7646400-7646422 GGTGAGTTGGGTGGAGGCCCTGG + Intronic
901231992 1:7646554-7646576 GGTGAGTTGGGTGGAGGCCCTGG + Intronic
901419007 1:9137591-9137613 TATGAGTTAGTGGAAGACCCAGG + Intergenic
902362620 1:15950465-15950487 GGTGTGTGGGTGGCAAGCCCTGG + Intronic
902674543 1:17999592-17999614 GGTGAGGAAGTGGCAGAGCCAGG - Intergenic
903248928 1:22038148-22038170 AGTGAGTGGGTGCCAGGCCCTGG + Intergenic
903426245 1:23256540-23256562 AGTGAATTAGTGGCAGCTCCAGG + Intergenic
903593660 1:24477623-24477645 GGTGGGTAAGTGGCAGAGCCTGG + Intergenic
903663707 1:24994352-24994374 GGTGAGTCAGTGGCAGAACCAGG - Intergenic
903760935 1:25698310-25698332 AGTGAGTTAGTGGTGGGGCCAGG - Intronic
903990087 1:27261214-27261236 AGCTAGTTAGTGGCAGACCCAGG + Intronic
904485419 1:30821813-30821835 GGTGAGTTAAAGGCAGAGCCTGG + Intergenic
904703664 1:32374671-32374693 GGTGAGTTTGGGGCAGGTGCAGG - Intronic
906126577 1:43430789-43430811 GGTGAGTTTGAGGCAGCCCGAGG + Exonic
907551732 1:55310504-55310526 GGTGAGTAAGTAGCAGATCCTGG - Intergenic
907702714 1:56804911-56804933 GGTGAGTTAGAGGCAGGAAGTGG - Intronic
909786719 1:79622645-79622667 GGTGAGTAAGTGGTAGAACCAGG - Intergenic
911023811 1:93415555-93415577 GCTGAGTCAGTGGCAGGACCAGG - Intergenic
912164552 1:107027875-107027897 AGTGAGTAAGTGGCAGAACCGGG - Intergenic
912440182 1:109691743-109691765 CGTGAGTGAGGGGCAGGCCCCGG - Intronic
912549087 1:110472952-110472974 AGTCAGTAAGGGGCAGGCCCAGG - Intergenic
915440361 1:155941970-155941992 GGAGAGTGAGTGCCAGTCCCAGG - Exonic
918924252 1:190760375-190760397 AGTGAGTAAGTGGCAGGACATGG + Intergenic
919785189 1:201254186-201254208 GGTGAGTTAGTGCCAGAGCTGGG + Intergenic
919912148 1:202118190-202118212 AGTTAGTAAGTGGCAGGGCCAGG + Intergenic
920447499 1:206029876-206029898 GGCCAGTTAGTGGCAGAGCCAGG - Intergenic
1063482334 10:6386632-6386654 GGTGAGGAAGGGGAAGGCCCAGG - Intergenic
1065318257 10:24485321-24485343 GTTGAGTTCTTGGCAGGCCACGG - Intronic
1067069175 10:43119822-43119844 GGTGGGGGAGTGGCAGGCCAGGG - Intronic
1071230681 10:83581162-83581184 GGTGAGTGAGTGAGAGCCCCTGG - Intergenic
1071572169 10:86703397-86703419 GGTGGGTTCGTGGAAGGGCCAGG + Intronic
1072034984 10:91555139-91555161 GGTGAGTTAATGTCAGGGCGGGG - Intergenic
1072813202 10:98479706-98479728 AGTGAATTAGTGGCAGGATCAGG + Intronic
1073945636 10:108746980-108747002 GGTGAGTTAGCGAAGGGCCCAGG + Intergenic
1074158338 10:110817101-110817123 GGTTCGAGAGTGGCAGGCCCAGG + Intronic
1075556872 10:123439257-123439279 GGTGACTTAGTGGCAGAGCCAGG + Intergenic
1076111090 10:127860503-127860525 AGGGAGTAAGGGGCAGGCCCCGG - Intergenic
1076947169 10:133659327-133659349 GGTGAGTGACTGGCAGCCTCAGG - Intergenic
1077355638 11:2115480-2115502 GGCGAGTGAGGGGCAGGCCGGGG - Intergenic
1077371189 11:2182367-2182389 GGAGAGCTGGTGGCACGCCCAGG + Intergenic
1077542824 11:3155513-3155535 GGTGAGTGAGTGGCAGACCTGGG - Intronic
1077542828 11:3155535-3155557 GGTGAGTGAGTGGCAGAGCTGGG - Intronic
1077542847 11:3155615-3155637 GGTGAGTGAGTGGCAGACCTGGG - Intronic
1077542851 11:3155637-3155659 GGTGAGTGAGTGGCAGAGCTGGG - Intronic
1077582160 11:3423369-3423391 GGAGAGTTTGAGGCAGGCCCAGG + Intergenic
1078094401 11:8287807-8287829 GGTGAGTTAGTGGCCAAGCCAGG - Intergenic
1078470157 11:11580139-11580161 GGTGAGTTAGTGGCAACCCCAGG - Intronic
1078905583 11:15685335-15685357 GCTGATTTAGTAGCAGGGCCAGG - Intergenic
1079348371 11:19672430-19672452 GGTCAGTTGGTGGCAGAGCCAGG - Intronic
1081547373 11:44081065-44081087 GGTGAGTTCCTGGCTGGCCTTGG + Exonic
1081586120 11:44384947-44384969 TGTGAGTGAGTGGGAGGCCAGGG + Intergenic
1081591444 11:44426009-44426031 AGTGAGTGAGTGGCAGAGCCGGG - Intergenic
1081616608 11:44595013-44595035 GTTGAGTTAGGGGGATGCCCAGG - Intronic
1082000016 11:47389154-47389176 GGTGAGTTAGTGCCCAGCACGGG - Intergenic
1083191846 11:61057673-61057695 GGCGGGTAAGTGGCAGGGCCAGG + Intergenic
1083990506 11:66243385-66243407 GGCGAGTGAGAGGCAGACCCTGG - Exonic
1084239077 11:67806186-67806208 GGAGGGTTTGAGGCAGGCCCAGG + Intergenic
1084362420 11:68677595-68677617 GGTGACTCAGCGACAGGCCCTGG - Intergenic
1084432128 11:69116944-69116966 GGTGAGTTATTGCCAGGCCTGGG + Intergenic
1084478125 11:69400421-69400443 GGTGAGTTGGAGGCAGTTCCAGG + Intergenic
1084833357 11:71786654-71786676 GGAGGGTTTGAGGCAGGCCCAGG - Intergenic
1084891866 11:72240684-72240706 GCTGAGTTTGTGGCAGGCACAGG - Intronic
1085196308 11:74673987-74674009 GGTGAGTTAGTATCAGGACAGGG + Intergenic
1085708852 11:78811164-78811186 GGCTAGTTAGTGGCAGGGCCAGG + Intronic
1087261097 11:96013567-96013589 GATGGGGTTGTGGCAGGCCCAGG - Intronic
1088969615 11:114761474-114761496 TGTAAGTTAGAGGCAGGCCCTGG + Intergenic
1089240596 11:117075372-117075394 TGTGAGTTTGAGGCTGGCCCAGG - Intronic
1089365279 11:117917651-117917673 GGTGAGTTAGTGGCAGAGTAGGG + Intronic
1089623551 11:119737007-119737029 GGTTAGTAAATGGCAGGTCCAGG - Intergenic
1090010280 11:123039924-123039946 GTTGAGATTGTGACAGGCCCAGG - Intergenic
1090111943 11:123921420-123921442 GGTCAGTTAGTGGCATGGCCAGG - Intergenic
1091884953 12:4010010-4010032 AGTGAGTTAGTGGCAGAGCAGGG - Intergenic
1091904553 12:4173795-4173817 AGCCAGTTAGTGGCAGGGCCAGG + Intergenic
1092409766 12:8243815-8243837 GGAGGGTTTGAGGCAGGCCCAGG + Intergenic
1092505800 12:9098585-9098607 GGTGAGTTCCTGGCAGCCTCAGG - Exonic
1093143569 12:15538123-15538145 GATTGGTTAGTGTCAGGCCCAGG - Intronic
1095958018 12:47817682-47817704 GGTGAGCTAATGCAAGGCCCAGG - Intronic
1096071537 12:48778066-48778088 GGTAAGGTGGGGGCAGGCCCTGG + Intronic
1097880416 12:64681443-64681465 GGTTAGTTGGTGACAGACCCAGG + Intronic
1101481878 12:105106178-105106200 GGTTAGTAAGTGGCAGAGCCAGG + Intergenic
1101641795 12:106591026-106591048 GATGAGTAAGTGGCAGAACCAGG + Intronic
1101876328 12:108598762-108598784 GGTGAGTCAGTGGCAGGCCTTGG + Intergenic
1101876602 12:108600155-108600177 GGTGAGTTAGTGGCAGGCCCTGG + Intergenic
1102047272 12:109837305-109837327 ACTGAGTTAGTGGCAGGATCAGG - Intergenic
1103016782 12:117500845-117500867 GGGGAGGCAGTGGAAGGCCCAGG - Intronic
1103160677 12:118726601-118726623 GGTGATTAAGTGGCAGAGCCAGG - Intergenic
1103348311 12:120265595-120265617 GGTGAGTGAGCGGGAGGCCGAGG - Exonic
1104096025 12:125559085-125559107 ACTCAGTTAGTGGAAGGCCCAGG + Intronic
1104166994 12:126241798-126241820 GGTGAGTGAATGTGAGGCCCAGG - Intergenic
1104728344 12:131091725-131091747 GGTGAGGCAGTGGCAGGAGCTGG + Intronic
1104944482 12:132409535-132409557 GGAGAGGTAGGGGCAGGCCCGGG + Intergenic
1105748848 13:23402755-23402777 GGTCATTTTCTGGCAGGCCCAGG + Intronic
1108478213 13:50842416-50842438 GGTTAGTTAATGGCAAGTCCAGG + Intronic
1111337788 13:86845940-86845962 GGTGAGTGAGTGGGAGACCCTGG + Intergenic
1112203561 13:97302084-97302106 GGGGAGATAGTTGCAGGACCAGG - Intronic
1112753458 13:102605225-102605247 GGTGGGTCACTGGCAGGCCTTGG + Intronic
1113331554 13:109332809-109332831 GGTGAGTAAGTGGCAGAGCGAGG - Intergenic
1115740228 14:36379578-36379600 AGTGAGGTACTGGTAGGCCCTGG - Intergenic
1115810167 14:37098429-37098451 AGTGAGTTAGTGGCAGAGCTGGG - Intronic
1116489221 14:45486552-45486574 GGTGAGGTAGTGCCTCGCCCAGG - Intergenic
1121434037 14:93907048-93907070 GGTGAATTAGTGGCATGGTCAGG - Intergenic
1122805488 14:104254214-104254236 GGCGAGCAAGAGGCAGGCCCTGG + Intergenic
1122901062 14:104782522-104782544 GGTGCGGGAGGGGCAGGCCCAGG + Intronic
1123787249 15:23686405-23686427 GGTGATTTCGCGGCTGGCCCGGG + Exonic
1124045896 15:26149483-26149505 GCTCAGCCAGTGGCAGGCCCAGG - Intergenic
1124165329 15:27320992-27321014 GAAGGGTTAGTGACAGGCCCGGG - Intronic
1124902320 15:33835875-33835897 GGTGAGGAGGTGGCAGGGCCAGG - Intronic
1125057307 15:35376578-35376600 GGTGAGTGAATGGAAGGCCTAGG - Intronic
1127280405 15:57486060-57486082 GGTGAGTCAGGAGCAGGGCCCGG + Intronic
1128504444 15:68256821-68256843 GGCGAGCGAGAGGCAGGCCCCGG - Intronic
1129138249 15:73573640-73573662 GGTGAGTAGGAGGCAGGCCCGGG - Exonic
1129151219 15:73689024-73689046 GGTCAGACACTGGCAGGCCCAGG - Intronic
1130796937 15:87219645-87219667 GCTCAGTCAGTGGCAGTCCCAGG + Intergenic
1132980673 16:2737391-2737413 CGAGAGTTAGAGGGAGGCCCAGG - Intergenic
1133022852 16:2974485-2974507 GGGGAGATAGTGGCTGGCCATGG - Intronic
1133226583 16:4343642-4343664 AGTGAGTTACTGCCAGGTCCAGG - Intronic
1134110570 16:11513026-11513048 GGTGAGTGAGAGGCAGGGCTGGG - Intronic
1134949051 16:18343378-18343400 GGTGAGTAGGTGGCAGTCTCGGG + Intergenic
1135252329 16:20911555-20911577 GGTGAGTAAGTAGCAAGGCCAGG - Intronic
1136471574 16:30484259-30484281 TGAGGGTGAGTGGCAGGCCCTGG + Exonic
1137599633 16:49747851-49747873 GGCAAGTTAGTGGCAGAACCAGG + Intronic
1138536099 16:57661051-57661073 GGTGAGTGAGTGGTAGATCCAGG - Intronic
1139153638 16:64414925-64414947 GGTGAGTTAGATGCAGGCATGGG - Intergenic
1139245443 16:65437412-65437434 AGTGAGTTAGTGGTAGACCTGGG + Intergenic
1139550079 16:67668094-67668116 GGAGCGTGAGTGGCAGTCCCTGG + Exonic
1139562758 16:67754248-67754270 GGTAAGATGGTGGCAGGTCCAGG + Intronic
1140959980 16:79902445-79902467 GGCCAGTGAGTGGCAGGCCTTGG + Intergenic
1141455087 16:84136029-84136051 AGTGAGGCAGTGGGAGGCCCAGG - Intronic
1145994356 17:29096989-29097011 GGTGAGTGAGGGGAAGACCCAGG + Intronic
1146052991 17:29567411-29567433 GGTGAGTAAGTCGCAGCTCCGGG + Intronic
1146946556 17:36877538-36877560 AGGAAGTTAGTGGCTGGCCCTGG + Intergenic
1147322710 17:39656017-39656039 GGTGGGTGGGTGGCAGGCCTGGG + Intronic
1147686682 17:42290097-42290119 GGTGAGTCAGTGGCCAGGCCAGG - Intronic
1148067187 17:44880234-44880256 GGTGAGTCAGAGCCAGTCCCTGG - Intronic
1148092340 17:45030070-45030092 GGTGAGTGTGTAGCATGCCCTGG - Exonic
1148384392 17:47223539-47223561 GGTGAGTTAAAGAGAGGCCCCGG + Exonic
1149012227 17:51869351-51869373 AGTGAGTTGATGGCAGGACCAGG - Intronic
1149657828 17:58319528-58319550 GGTGAGTGTGTGGCAGGCCCCGG - Intronic
1151215177 17:72572150-72572172 AGTGAGTTAGTGGCAGGAGGTGG - Intergenic
1151702700 17:75751938-75751960 GCTGAGTAAGTGGCAGAGCCAGG - Intronic
1152320744 17:79607900-79607922 GTTGAGTAAGTGACAGGCGCAGG + Intergenic
1153178139 18:2402771-2402793 GGTGCGTGGGTGGGAGGCCCAGG + Intergenic
1157213639 18:45764140-45764162 AGTGAGTAAGTTCCAGGCCCTGG + Intergenic
1157313558 18:46570400-46570422 TGTCAGTGAGTGGCAGGCCTGGG - Intronic
1161580058 19:5075833-5075855 GGTGAGTCAGTTGGTGGCCCGGG + Intronic
1161667634 19:5586665-5586687 GGTGAGGGCGTGCCAGGCCCTGG - Intergenic
1162876651 19:13625720-13625742 GGTGAGTGATTGGCAGGGGCAGG + Intergenic
1163529876 19:17842882-17842904 GCTGGGTTCGTGGGAGGCCCTGG + Intronic
1164714774 19:30383542-30383564 AGTAAGTGAGTAGCAGGCCCTGG - Intronic
1166148470 19:40853038-40853060 AGTGAGTTAGTGGCGAGCCCAGG + Intronic
1166152611 19:40884823-40884845 AGTGAGTTAGTGGCGAGCCCAGG + Intronic
1166177566 19:41085810-41085832 AGTGAGTTAGTGGAAAACCCAGG - Intergenic
1167739741 19:51317267-51317289 GGTGATTATGTGGCAGGCACCGG - Intronic
1168561371 19:57386568-57386590 GGTCAATCAGTGGCAGCCCCAGG - Intronic
926364523 2:12121054-12121076 AATGAGTCAGAGGCAGGCCCAGG + Intergenic
926722144 2:15968831-15968853 TGGGAGCCAGTGGCAGGCCCAGG + Intergenic
927162714 2:20283423-20283445 GGTGCCTTAGTGGTTGGCCCTGG - Exonic
927476239 2:23416458-23416480 AGTGAGTTGGTGGCAGAACCGGG + Intronic
927554473 2:24022492-24022514 GGACAGTTAGTACCAGGCCCTGG - Exonic
928625573 2:33136318-33136340 AGCTAGTTAGTGGCAGGACCGGG - Intronic
928875271 2:36031230-36031252 AGTGAGTTAGTGGCAGATCCAGG + Intergenic
929804932 2:45136644-45136666 GATGAGTTAGGTGCAGGCTCTGG - Intergenic
931225256 2:60323867-60323889 TGTGAGATTGTGGCTGGCCCAGG + Intergenic
932811044 2:74826521-74826543 GGGGAGTGAGTGGTTGGCCCTGG - Intergenic
933438615 2:82281448-82281470 GGTGAGTTAGCAGGAGACCCAGG + Intergenic
933691950 2:85185695-85185717 GCTGAGGTTGTGGCAGTCCCTGG + Intronic
934751907 2:96799242-96799264 GGGGAGCAGGTGGCAGGCCCAGG - Intronic
935568404 2:104633907-104633929 GTTGAGTTTGTGGAAGGCCAAGG - Intergenic
936286357 2:111184425-111184447 GGGGAGTGAGTGGAAGGCACAGG - Intergenic
937472751 2:122188092-122188114 GGTGGGAGAGAGGCAGGCCCAGG + Intergenic
938594296 2:132771570-132771592 GGTGAGTGAATGGAGGGCCCAGG - Intronic
941007545 2:160263131-160263153 GGTGAGCACGTGGCAGGCCCCGG + Intronic
942795481 2:179814112-179814134 GGGGGGTTATGGGCAGGCCCTGG + Intronic
944266793 2:197736049-197736071 GTTGAGTAAGTGGCAGATCCAGG - Intronic
946372542 2:219289786-219289808 TGTGAGTCAGAGGCAGGCCCGGG + Exonic
946855011 2:223943299-223943321 GGGGAGTGATTGGCAGGACCTGG - Intronic
948418229 2:237832812-237832834 GGTGAGTAAGTGGCAGAGCCAGG - Intronic
948629830 2:239294901-239294923 GGTGGGTGTGTGGGAGGCCCGGG + Intronic
948883469 2:240871737-240871759 GGTGAGGTGGGGACAGGCCCTGG - Intronic
1169318130 20:4609793-4609815 GGGGAGTGAGAGGCAGGCCTCGG - Intergenic
1169770275 20:9192395-9192417 GATGAGTTTTTGGCAGGGCCAGG + Intronic
1170666972 20:18394781-18394803 AGTTAGTAAGTGGCAGACCCAGG - Intronic
1171386127 20:24770451-24770473 GGTGAGTTTAAGGCAGACCCCGG + Intergenic
1174197169 20:48781677-48781699 AGTGAGTTTGTGGCAGGGCCTGG - Intronic
1174407029 20:50309222-50309244 AGTGATTTGGTGGCAGGCCGTGG - Intergenic
1175539293 20:59738202-59738224 TGTTAGTAAGTGGCAGGGCCAGG + Intronic
1175577586 20:60073669-60073691 GGGGAGTCTGTGTCAGGCCCTGG + Intergenic
1175713135 20:61236943-61236965 GGGGAGACAGTGGCAGCCCCGGG - Intergenic
1175860480 20:62147760-62147782 GGTGGGTTAGTGCCGTGCCCAGG + Intronic
1176411957 21:6453967-6453989 GGTGAGTGGGTGGCGGGCACGGG - Intergenic
1178393007 21:32214788-32214810 AGTGAGTGAGTGGCAGGGCAAGG - Intergenic
1178822298 21:35986536-35986558 GATGAGTGAGTGGCAGAACCAGG + Intronic
1179687451 21:43062289-43062311 GGTGAGTGGGTGGCGGGCACGGG - Exonic
1180043797 21:45293651-45293673 TGTGAGTCAGTGGCAGGGCAGGG + Intergenic
1181390892 22:22579957-22579979 GGTGAGTCAGTGCTGGGCCCAGG - Intergenic
1181769195 22:25113204-25113226 AGTGAGTGAGTGGCAGAGCCAGG + Intronic
1182357554 22:29729204-29729226 GGAGAGTGAGTGGCTGGCCCTGG + Exonic
1183711105 22:39503970-39503992 GGCAAGTAAGTGGCAGGGCCAGG + Intronic
1184088467 22:42280013-42280035 GGTGAGTTACTAGCAGGGACAGG + Intronic
1185333407 22:50261499-50261521 GGAGAGCTCATGGCAGGCCCGGG + Exonic
949594954 3:5533174-5533196 GGTGAATGAGTGGGAGCCCCCGG - Intergenic
950515923 3:13465286-13465308 GGGGAGTTAGTGGCAAATCCAGG + Intergenic
953019671 3:39105416-39105438 GGTGAGGTGGTGCCATGCCCTGG - Intronic
954314353 3:49793113-49793135 TGTGAGTGAGGGGCAGGCCAAGG - Intronic
954456198 3:50601066-50601088 GGTGAATGAGGGACAGGCCCTGG + Intergenic
954707471 3:52488739-52488761 GGTGATGTAGAGGGAGGCCCGGG - Intronic
955421663 3:58744275-58744297 GGTGAGTTAGAGGCAGAGCTGGG + Intronic
956153787 3:66272220-66272242 GGTAAGTTTGTGGTTGGCCCAGG + Intronic
957080288 3:75631089-75631111 GGTGAGTGACTGGCAGCCTCAGG + Intergenic
959001268 3:100966977-100966999 GGAGACTTATTGGCAGACCCAGG + Intronic
961299835 3:125915729-125915751 GGAGGGTTTGAGGCAGGCCCAGG - Intergenic
961509991 3:127395022-127395044 GGTGGGGTAGTGTCAGGCCCGGG - Intergenic
962756098 3:138466644-138466666 GGTGAGTTAGGGGCAAGCTGAGG + Intronic
963270344 3:143280109-143280131 GGGGAGTTCTAGGCAGGCCCTGG - Intronic
966761774 3:183425649-183425671 GGGGAGTGAGTGGCAGGCTCAGG - Intronic
966805294 3:183802942-183802964 TGTGAGTTAATGGCGGGTCCAGG + Intronic
966900562 3:184481073-184481095 GGTGACCAGGTGGCAGGCCCTGG + Intronic
968040503 3:195585063-195585085 GGTCAGCGAGAGGCAGGCCCTGG - Intergenic
969209792 4:5678004-5678026 GGCTAGTAAGTGGCAGGACCAGG - Intronic
969236148 4:5866306-5866328 GGTGAGTTAGGGTCAAGGCCCGG - Intronic
969605232 4:8199175-8199197 GGTGACGGAGAGGCAGGCCCAGG - Intronic
969689770 4:8698072-8698094 AGCAAGTTAGTGACAGGCCCGGG + Intergenic
969737347 4:9000611-9000633 GGTGAGCGAGGCGCAGGCCCCGG + Intergenic
969816505 4:9691569-9691591 GGAGGGTTTGAGGCAGGCCCAGG - Intergenic
970222291 4:13823674-13823696 GCTGAGTTAGGGACAAGCCCAGG - Intergenic
971256338 4:25017069-25017091 TGAAAGTTTGTGGCAGGCCCTGG + Intronic
975897460 4:79110420-79110442 GGTGAGTTAGTGTCCGACTCTGG - Intergenic
977167757 4:93722625-93722647 GGTGAGAAAGTGGGAGGCCAAGG - Intronic
979780415 4:124644768-124644790 GATGATTTAGAGGCAGGCACAGG - Intergenic
980410174 4:132406988-132407010 GGTCACTTACTAGCAGGCCCAGG - Intergenic
980859783 4:138485483-138485505 GCTTAGTTAGTGGCAAACCCTGG + Intergenic
981266630 4:142791791-142791813 GGTGAGTAAGTAGCAGAGCCTGG - Intronic
985450629 4:190060126-190060148 GGTGAGTGACTGGCAGCCTCAGG - Intergenic
985669314 5:1198302-1198324 AGAGAGTCAGTGGCTGGCCCAGG - Intergenic
985687247 5:1289160-1289182 GGTGAGTGAGTTGCGGCCCCCGG - Intronic
986630461 5:9767413-9767435 AGTGAGTAAGTGGCAGAGCCAGG - Intergenic
986741034 5:10705356-10705378 AGTGATCTAGTGGGAGGCCCAGG + Intronic
987370224 5:17186403-17186425 GGTCAGTTGGTCGCCGGCCCTGG - Intronic
990488799 5:56284186-56284208 GGTTAGTTAGTGACAGAGCCAGG - Intergenic
991524621 5:67542639-67542661 GGTGACGTTGTGGCAGGTCCCGG - Intergenic
995253275 5:110018509-110018531 GGTGAGTGAGTGAGAGTCCCCGG + Intergenic
997766110 5:136505338-136505360 AGTGAATAAGTGGCAGGGCCAGG - Intergenic
998135462 5:139671907-139671929 GGTCAGTAAGTGGCAGAGCCAGG - Intronic
998215715 5:140237436-140237458 AGTGAATTAGAGGCAGGTCCTGG - Intronic
998566857 5:143223548-143223570 GGTGGGTTAGAGGCAGGCAAGGG - Exonic
999141158 5:149363016-149363038 AGTGAGTTAGTTGCAGAGCCGGG + Intronic
999381029 5:151121631-151121653 TGTGAGTGAGTGGCAGGTCTAGG + Intronic
999746441 5:154595916-154595938 GGTGATTTACAGGGAGGCCCTGG + Intergenic
1002426524 5:179180026-179180048 TGTGACTTAGTGACATGCCCAGG - Intronic
1002589287 5:180278217-180278239 GGGGTGTTAGTGGTAGGCCTGGG - Intronic
1003238710 6:4322601-4322623 AGTGAGTTAGTGGCAGACCTGGG - Intergenic
1004029074 6:11848181-11848203 GGTGAGTTAGGGACAGAGCCAGG - Intergenic
1004190996 6:13463295-13463317 AGCGAGTTAGGGGCAGGCACAGG + Intronic
1005371169 6:25135223-25135245 GGTCACTTACTGACAGGCCCAGG + Intergenic
1006503581 6:34473633-34473655 AGTGAGTCAGTGTCAGGGCCAGG - Intronic
1006717865 6:36131442-36131464 GGGGAGTCAGGGGCAGGCGCAGG + Intronic
1008069433 6:47084700-47084722 GGGAAGTTAGGGGCAGGCCTAGG + Intergenic
1008622540 6:53285340-53285362 AGTGAGTTAGTGGCTTGCTCTGG - Intronic
1012169614 6:96002241-96002263 GTGGAGTTAGTGCCAAGCCCTGG - Intergenic
1016641321 6:146352721-146352743 GGTGAGTTAGGGGATGGCACTGG - Intronic
1018888395 6:167961881-167961903 GGAGAGAGAGTGGCAGGCCTTGG + Intronic
1019627791 7:2029739-2029761 TGGGAGTTGGTGGCAGGCGCAGG + Intronic
1020766156 7:12323909-12323931 GGTGAGTTAGAGCCAGGATCTGG + Intergenic
1022203233 7:28137979-28138001 GGTAAGTAAGTGGCAGAGCCAGG + Intronic
1022821032 7:33961221-33961243 GGTGAGTTGAGGCCAGGCCCGGG + Intronic
1023255136 7:38305558-38305580 AGTGAGTTTGTGGCAGGCTGTGG + Intergenic
1023929641 7:44697520-44697542 GGTGGGTGGGTGACAGGCCCTGG - Intronic
1026265305 7:68791189-68791211 GGTGAGCCAGTGTCAGGGCCAGG - Intergenic
1027596881 7:80184929-80184951 GGTGACTAAGTGGCCGGCACAGG - Intronic
1028811208 7:95088743-95088765 TGTGAGTAAGTGGGAGGACCTGG + Intronic
1031900142 7:127399954-127399976 TGTGAGGTTGTGGCAGGACCAGG - Intronic
1032079353 7:128850943-128850965 GGTGAGTTAGGGGCTGGGCTGGG + Exonic
1034267922 7:149790137-149790159 GGTGGGTTAGGGCCAGGCCCAGG + Intergenic
1034622030 7:152463901-152463923 GGTGAGTTAGGGGCAGGGGCGGG + Intergenic
1035018067 7:155783590-155783612 AGTGTATTTGTGGCAGGCCCAGG + Intergenic
1035068676 7:156125447-156125469 GGAGAGCTAGTGACAAGCCCAGG - Intergenic
1036162373 8:6401720-6401742 GGTTACTTACTCGCAGGCCCAGG + Intergenic
1036680224 8:10866776-10866798 GGTGTGTTAGTGGCAAATCCAGG + Intergenic
1036850137 8:12194904-12194926 GGAGGGTTTGAGGCAGGCCCAGG + Intergenic
1037785220 8:21898930-21898952 GGCCAGTTAGTGGCAGACCTGGG + Intergenic
1037890770 8:22622742-22622764 AGTGAGGAAGAGGCAGGCCCAGG + Intronic
1037943706 8:22973615-22973637 AGTGAGGAAGTGCCAGGCCCGGG - Intronic
1038570707 8:28659705-28659727 GCTGAGTTTGGGGCAGGCACTGG - Intronic
1038959249 8:32500357-32500379 GGTAACTTTCTGGCAGGCCCGGG - Intronic
1039018898 8:33183778-33183800 AGTGAGTTAGTGGCTGGCCTGGG + Intergenic
1039070876 8:33648392-33648414 GGTAAGTTAGTGGAAGGACTTGG + Intergenic
1040111458 8:43568775-43568797 GGGGAGATTGAGGCAGGCCCAGG - Intergenic
1040111587 8:43569212-43569234 GGGGAGGTTGAGGCAGGCCCAGG - Intergenic
1042225927 8:66514294-66514316 GGTGGGTTGGTGGCAGTTCCAGG - Intronic
1043240913 8:77934802-77934824 GGTCAGTAAGTGGCAGCCCTAGG + Intergenic
1045017460 8:98011472-98011494 GGGGAGTCAGTGGCAGAGCCAGG + Intronic
1049128155 8:140810882-140810904 GTTGGGTTGCTGGCAGGCCCAGG - Intronic
1049441461 8:142611659-142611681 GCGGGCTTAGTGGCAGGCCCTGG + Exonic
1049768479 8:144367172-144367194 GGTGATTTCCTGGCAGGCCCAGG + Intergenic
1049770080 8:144375862-144375884 GGTGTGTTGGGGGAAGGCCCTGG + Intronic
1052363822 9:27589371-27589393 GGTGAGTGAGTGAGAGCCCCTGG + Intergenic
1053421655 9:37983666-37983688 TGAGAGGTAGTGGCAGGGCCTGG - Intronic
1055935217 9:81598367-81598389 GGGGAGTTCGTGGCAGGCAGAGG - Intronic
1057874913 9:98746618-98746640 GGCCAGTAAGTGGCAGGGCCTGG + Intronic
1057896797 9:98915674-98915696 GGTGAGACAGTGGAAGGCTCAGG - Intergenic
1059849257 9:118318914-118318936 AGTGATTTAGTGGCAGAGCCGGG + Intergenic
1059941748 9:119366810-119366832 AGTGGGTTAGTGGCATGCCCAGG - Intronic
1060401658 9:123353224-123353246 GGTGAGCCAGTGGGAGGCACAGG - Intergenic
1060861307 9:126956991-126957013 TGTGAGTTAGTGGCAGGACTGGG - Intronic
1061188544 9:129069129-129069151 GGTGAGTGACTGGCAGGCCCGGG + Exonic
1061543588 9:131290976-131290998 TGTGAGTGGGTGGCAGTCCCAGG - Intronic
1061869426 9:133512997-133513019 GGTGAGGAAGGGGCAGGCCAGGG + Intergenic
1062456445 9:136641501-136641523 GGTGGGTGAGTGACAGCCCCAGG - Intergenic
1203759623 EBV:5362-5384 GGTTAGTAAATTGCAGGCCCAGG - Intergenic
1203698506 Un_GL000214v1:117417-117439 GGGGAGTAACTGTCAGGCCCTGG + Intergenic
1185950071 X:4422768-4422790 GGTGAGTGGGTGCCAGGGCCCGG + Intergenic
1188043790 X:25402293-25402315 AGGGTGTTAGTGGCAGGCACTGG + Intergenic
1188442792 X:30229791-30229813 GGTGAGTAAGTGACAGGGCTGGG + Intergenic
1190179101 X:48176574-48176596 GGTCACTTTCTGGCAGGCCCAGG - Intergenic
1191254466 X:58273829-58273851 GGGGAGGTAGAGGCAGGCCTGGG - Intergenic
1192145851 X:68681956-68681978 GGTGGGTGAGTGGAAAGCCCAGG - Intronic
1192338164 X:70239134-70239156 AGTGAGTGAGTGGCAGGATCTGG - Intronic
1192760133 X:74088062-74088084 GGTGAGTGAGTGAAAGTCCCTGG + Intergenic
1194407373 X:93513514-93513536 AGTTAGTTAGTGGCAGAGCCAGG + Intergenic
1196900590 X:120379046-120379068 GCTAAGTTAGTGGCAGGGTCAGG + Intronic
1196903995 X:120413878-120413900 GCTCAGTGAGTGGCAAGCCCTGG - Intergenic
1197297673 X:124738860-124738882 GGCAAGTTAGTGGCATGGCCAGG + Intronic
1197875315 X:131097554-131097576 GGTGAGGAAATGGCAGGCCTGGG + Intergenic
1198485738 X:137085786-137085808 GGTGAATTAGTGGCAGATCATGG + Intergenic
1199399261 X:147377279-147377301 GGTGAGTGAGTGACAGTCCCTGG - Intergenic
1200060383 X:153481260-153481282 GCTGAGTCACTGGCAGGCCCTGG + Intronic