ID: 1101878180

View in Genome Browser
Species Human (GRCh38)
Location 12:108609042-108609064
Sequence GTAATAACCCTCACTTCTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101878173_1101878180 16 Left 1101878173 12:108609003-108609025 CCACTCTGACCCTCGGTTTCCTC No data
Right 1101878180 12:108609042-108609064 GTAATAACCCTCACTTCTCTGGG No data
1101878174_1101878180 7 Left 1101878174 12:108609012-108609034 CCCTCGGTTTCCTCATCTGTTAA No data
Right 1101878180 12:108609042-108609064 GTAATAACCCTCACTTCTCTGGG No data
1101878175_1101878180 6 Left 1101878175 12:108609013-108609035 CCTCGGTTTCCTCATCTGTTAAA No data
Right 1101878180 12:108609042-108609064 GTAATAACCCTCACTTCTCTGGG No data
1101878178_1101878180 -3 Left 1101878178 12:108609022-108609044 CCTCATCTGTTAAAATGGAGGTA No data
Right 1101878180 12:108609042-108609064 GTAATAACCCTCACTTCTCTGGG No data
1101878171_1101878180 29 Left 1101878171 12:108608990-108609012 CCTTGAGGGTCAGCCACTCTGAC No data
Right 1101878180 12:108609042-108609064 GTAATAACCCTCACTTCTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101878180 Original CRISPR GTAATAACCCTCACTTCTCT GGG Intergenic
No off target data available for this crispr