ID: 1101878623

View in Genome Browser
Species Human (GRCh38)
Location 12:108611415-108611437
Sequence GCATCTGGTGGGTGGTGGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1367
Summary {0: 2, 1: 1, 2: 44, 3: 191, 4: 1129}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101878623_1101878631 14 Left 1101878623 12:108611415-108611437 CCTGACCACCACCCACCAGATGC 0: 2
1: 1
2: 44
3: 191
4: 1129
Right 1101878631 12:108611452-108611474 ACCAAACACGTCTCCAGACATGG No data
1101878623_1101878634 30 Left 1101878623 12:108611415-108611437 CCTGACCACCACCCACCAGATGC 0: 2
1: 1
2: 44
3: 191
4: 1129
Right 1101878634 12:108611468-108611490 GACATGGCCAAATGTCCCCTAGG 0: 7
1: 143
2: 493
3: 960
4: 1271

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101878623 Original CRISPR GCATCTGGTGGGTGGTGGTC AGG (reversed) Intergenic
900200259 1:1401587-1401609 ACATCAGGTGGGTGGTGGCCTGG - Intronic
900461838 1:2805429-2805451 GCAGCTGGCGGGTGGGGGCCGGG - Intergenic
900642997 1:3696182-3696204 GGAGGTGGTGGGTGGTGGTCAGG + Intronic
900731701 1:4266146-4266168 GCATCTGGTGGGTAGAGGCCAGG - Intergenic
901221199 1:7584827-7584849 GCATCTGGTGGGTGGAGGCCGGG + Intronic
901449751 1:9328868-9328890 GCGTCTGGTGGGTGGGGGCCAGG - Intronic
901536580 1:9886337-9886359 GCATCTAGTGGGTGGAGGCCAGG - Intronic
901637799 1:10678407-10678429 GCAGCAGGTGGGTGGGGGTGGGG + Intronic
901687399 1:10950621-10950643 GCATCTGGTGGGCGGAGGCCAGG - Intronic
902039102 1:13479997-13480019 GCATCTGGTAGGTGGAGGCCAGG - Intronic
902145173 1:14392651-14392673 GCATCTAGTGGGTAAAGGTCAGG - Intergenic
902175432 1:14646634-14646656 ACATCTGGTGGGTAGAGGCCAGG - Intronic
902176370 1:14653928-14653950 GCATCTGGTAGGCGGAGGCCAGG - Intronic
902191307 1:14765174-14765196 GCATCTGGTGGGTAGAGGCCAGG - Intronic
902234624 1:15049440-15049462 GCATCTGGTGGGTGGAGGCCAGG - Intronic
902288596 1:15422441-15422463 GCATCTGGTGGGTGGAGGCCAGG - Intronic
902554877 1:17240979-17241001 GCATCTGGTGGGTAGAAGCCAGG + Intronic
902565224 1:17307084-17307106 GCAACTGGGGGGTGGTGGATGGG - Intergenic
902605378 1:17566253-17566275 GCATCTGGTGGGTGGAAGCCAGG - Intronic
902634449 1:17726013-17726035 CCACCTGGTGGCTGGTGGTGTGG + Intergenic
902672796 1:17986532-17986554 GCATCCAGTGGGTAGTGTTCAGG + Intergenic
902733199 1:18383490-18383512 GCAGATGGTGGGTGGTGACCAGG - Intergenic
902841168 1:19074814-19074836 GCAGCTGCTGTGTGGTGGTCAGG + Exonic
902885597 1:19402625-19402647 ACAGCTGGTGGGTGGTGGGAAGG - Intronic
903032590 1:20474695-20474717 GCATCTGGTGGGCGGAGGCCAGG - Intergenic
903248450 1:22034374-22034396 GCATCTGGCAGGTGGAGGTTGGG - Intergenic
903449749 1:23444879-23444901 GCAGCTAGTGGGTGGAGGTCAGG - Intronic
903534394 1:24057070-24057092 GCATCTGATAGGTAGAGGTCAGG - Exonic
903560525 1:24223951-24223973 GCATCTGGTGGGCAGAGGTCAGG - Intergenic
903664723 1:24999261-24999283 GCACCTGGTGGGTAGTAGCCAGG + Intergenic
904718589 1:32488561-32488583 GCATCTAGTGGGTAGAGGCCAGG + Exonic
904843391 1:33389157-33389179 GCATGTGGTGGGTGTTTGGCAGG + Intronic
904950221 1:34231657-34231679 GCATGTGGTAGGTGGAGGTAAGG + Intergenic
906072290 1:43025818-43025840 GCATCTGCTGGGTGCTCATCAGG + Intergenic
906557944 1:46729101-46729123 GCATCTGGTGGGTGCCCTTCTGG + Intergenic
906586862 1:46985625-46985647 GCATCTGGTGGGTGCCCCTCTGG + Intergenic
906721012 1:48004597-48004619 GCATCTAGTGGGTGGAGGCCAGG + Intergenic
906947659 1:50309087-50309109 ACATCTGGTTGGTGGTGGAAAGG - Intergenic
907185426 1:52605384-52605406 GCATCTAGTGGGTAGAGGCCAGG + Intronic
907565721 1:55431324-55431346 GCATCTGGTGGGTGCCCCTCTGG + Intergenic
907817132 1:57929910-57929932 GCACCTGGTGGGATGTGGTTGGG - Intronic
907945671 1:59134302-59134324 GCTTCTGGTGGGTGAGGGTAGGG - Intergenic
908389184 1:63669845-63669867 GATTCAGGTGGGTGGAGGTCAGG + Intergenic
908433319 1:64080290-64080312 GCATCTGGTGGGTAGAAGGCAGG + Intronic
909672477 1:78204163-78204185 GCATCTGGTGGGTGCCCCTCTGG + Intergenic
909892858 1:81029547-81029569 GCATCTAGTGGGTAGAGGCCAGG + Intergenic
910070863 1:83212259-83212281 TCATATGGTGGTTGGTGCTCAGG - Intergenic
910948926 1:92623765-92623787 GCATCTAGTGGGTAGAGGCCAGG + Intronic
912076645 1:105884075-105884097 GCATCTGGCGGGTGGCCCTCTGG - Intergenic
912235427 1:107845065-107845087 GCATCTGGTGGGTGCCCCTCTGG + Intronic
912701999 1:111884954-111884976 GCATCTAGTGGGTAGAGGCCAGG - Intronic
912944731 1:114075504-114075526 GCTTGTTGTGGGTGGTGGTGGGG + Intergenic
914330998 1:146670894-146670916 GCATCTTGGGGGCGGTGGGCGGG + Intergenic
914458132 1:147855604-147855626 GCATCTGGTGGGTGCCCCTCTGG + Intergenic
914999786 1:152578912-152578934 GCATCTAGTGGGTAGAGGCCAGG - Intronic
915497950 1:156294562-156294584 GCAGCTGGAGGGTGGGGGTAGGG + Exonic
915688531 1:157662378-157662400 TCATCTGGTGGGTGCTCCTCTGG + Intergenic
916359634 1:163953304-163953326 GCATCTGGTGGGTGCCCCTCTGG + Intergenic
916561439 1:165937003-165937025 GCATCTAGTGGGTAGAGGCCAGG - Intergenic
916625523 1:166551824-166551846 GCATCTGGCAGGTGCTGCTCTGG - Intergenic
916723022 1:167499210-167499232 TCATCTAGTGGGTAGAGGTCAGG + Intronic
916788147 1:168101366-168101388 GCATCTGGTGGGTAGAGGCCAGG + Intronic
917023293 1:170613907-170613929 GCATCTGGTGGGTGACCCTCTGG - Intergenic
917037745 1:170767802-170767824 GCCTCTGGTGGGGAGAGGTCAGG + Intergenic
917163057 1:172080003-172080025 GCATCTGGTGGGTGCCCCTCTGG - Intronic
917466977 1:175288283-175288305 GTATCTAGTGGGTGGAGGCCAGG + Intergenic
917915311 1:179695110-179695132 GCATCTGGTGGGTGCCCCTCTGG + Intergenic
918310367 1:183281328-183281350 GCATCTAGTGGGTGGAGGCTAGG + Intronic
918612752 1:186511800-186511822 GCATCTGGTGGGTGCCCCTCTGG - Intergenic
919461573 1:197883906-197883928 GCATCTGGTGGGTGACCCTCTGG - Intergenic
919786457 1:201261432-201261454 GCTCCTGGTGGGTGGGGTTCTGG - Intergenic
920308405 1:205033266-205033288 GCATCTAGTGGGTAGAGGTGAGG - Intergenic
920393254 1:205624749-205624771 GCATCTAGTGGGTAGAGGCCGGG - Intronic
921401301 1:214727063-214727085 GCATCTGGTGGGTGCCCCTCTGG - Intergenic
922066293 1:222146535-222146557 GCATCTGGTGGGTGCCCCTCTGG + Intergenic
922531267 1:226347120-226347142 GCATCTAGTGGATGGGGGCCAGG + Intergenic
923680092 1:236112002-236112024 GCATCAGGTGGGTGGTGATCGGG + Intergenic
923748331 1:236724176-236724198 GCACGTGGTGGGTGGGGGTGGGG + Intronic
923834189 1:237591536-237591558 GCATCTAGTGGGTGGAGGTCAGG - Intronic
923883482 1:238129625-238129647 GGATCTGTTTGGTGGGGGTCTGG + Intergenic
924331154 1:242941712-242941734 GCATCTAGTGGGTGAGGGTCAGG + Intergenic
924430408 1:243991666-243991688 GCATCTGGTGGGTCGAGGCCAGG - Intergenic
924448893 1:244159890-244159912 GGATCTGCTTGGTGGTGGCCGGG + Intergenic
924631572 1:245745622-245745644 GCATCTGGTGGGTGCCCTTCTGG - Intergenic
924823026 1:247512892-247512914 GCATCTGGTGGGTGCTTCTCTGG - Intronic
1062791446 10:308913-308935 GCATCTGGTGGGGGGAGACCAGG - Intronic
1062977060 10:1691738-1691760 GGATGTGGTGGGAGGTGGTGCGG - Intronic
1063010110 10:2013307-2013329 GGTTGTTGTGGGTGGTGGTCAGG + Intergenic
1063010117 10:2013364-2013386 GGTTGTTGTGGGTGGTGGTCAGG + Intergenic
1063270703 10:4507585-4507607 GCATCTGGTTGGGGGAGGCCCGG + Intergenic
1063476415 10:6332509-6332531 GCATCTAGTGGGTAGAGGCCAGG + Intergenic
1064131797 10:12716288-12716310 GCATCTAGTGGGTGGAAGCCAGG - Intronic
1064429765 10:15260807-15260829 ACATCTAGTGGGTAGAGGTCAGG - Intronic
1065692120 10:28345235-28345257 GGGTCTGGTGGGGGGTGATCGGG + Intergenic
1065753737 10:28912119-28912141 GCAGCTGGTGGGTGGTTGAAGGG + Intergenic
1065783825 10:29194563-29194585 GTACCTGGTGGGTGGAGGCCAGG - Intergenic
1065789040 10:29242974-29242996 GCATCTGGTGGGTGGAAGCTAGG + Intergenic
1065943455 10:30586009-30586031 GCATCTAATGGGTAGAGGTCAGG + Intergenic
1066074758 10:31862662-31862684 TCATCTGGTGGTTAGAGGTCAGG - Intronic
1067188834 10:44053022-44053044 GCATCTAGTGGGTAGAGGCCTGG + Intergenic
1067346151 10:45440537-45440559 GCAGAAGGTGGGTGATGGTCTGG - Exonic
1067679207 10:48417054-48417076 GCATCTAGTGGGTAGAGGCCAGG - Intronic
1068015781 10:51514972-51514994 ACATCTGTTGGGTAGAGGTCAGG - Intronic
1068357028 10:55922888-55922910 GCATCTGGTGGGTGCCCCTCTGG - Intergenic
1069447569 10:68487622-68487644 GCATCTAGTGGGAAGAGGTCAGG - Intronic
1069883000 10:71605416-71605438 GCATCTAGTGGGTAGAGGCCAGG + Intronic
1070632576 10:78097132-78097154 GCATCTGGCGGGTGCTCCTCTGG + Intergenic
1070687925 10:78503446-78503468 GCACCTGGTGGGTAGAGGCCAGG + Intergenic
1070717611 10:78733998-78734020 GCATCTAGTGGGTAGAGGCCAGG + Intergenic
1070890800 10:79941266-79941288 GCAGCTGGTGGGTGGAACTCAGG - Intronic
1070916816 10:80160512-80160534 GCAACTGGTGGGCTGTGGCCAGG - Intronic
1071190144 10:83089940-83089962 GCATCTGGTGGGTGCCCCTCTGG + Intergenic
1071272492 10:84020667-84020689 GCATCTGGTGGGTGCCCCTCTGG + Intergenic
1071853314 10:89598114-89598136 GCATCTAGTGGGTAGAGGTCAGG - Intronic
1072663333 10:97376678-97376700 GCATCTAGTGGGTAGAGGCCAGG - Intronic
1073954257 10:108850014-108850036 GCACCTGCTGTTTGGTGGTCTGG + Intergenic
1074088170 10:110224443-110224465 GCATCTAGTGGGTAGAGGCCAGG + Intronic
1074214359 10:111369823-111369845 GCATCTAGTGGGTAGGGGCCAGG - Intergenic
1074463350 10:113659291-113659313 GCATCTGGTGGGTGGAGACCTGG - Intronic
1074514940 10:114158101-114158123 GCATCTAGTGGATGGAGGCCAGG + Intronic
1074668417 10:115758507-115758529 GCATCTGGTGGGTGCCCCTCTGG - Intronic
1074729859 10:116359542-116359564 GCATCTAGTGGGTAGAGGACAGG - Intronic
1074851069 10:117440102-117440124 GCATCTGCTGGGTGGAGGCCAGG - Intergenic
1074930373 10:118119066-118119088 GCATCTAGTGGGTAGAGGCCAGG - Intergenic
1075279552 10:121128074-121128096 GCATCTAGTGGGTTGAGGTCAGG - Intergenic
1075359338 10:121815896-121815918 GCATCTGGTGGGAAGAGGTCAGG - Intronic
1075556383 10:123435467-123435489 TCATCAGGTCAGTGGTGGTCTGG + Intergenic
1075562203 10:123476211-123476233 GGGTCTGGTGGGAGGTGGTCAGG + Intergenic
1075638932 10:124050515-124050537 GCATCCAGTGGGTGGGGGCCAGG - Intronic
1075916612 10:126173471-126173493 GCATCTTGGGGGTGGAGGCCAGG - Intronic
1076076901 10:127540502-127540524 GCATCTCGTGGGTAGAGCTCAGG + Intergenic
1076310782 10:129506135-129506157 GCATCCAGTGGGTGGAGGCCAGG + Intronic
1076839363 10:133038501-133038523 GCCTCTGGGAGGTGGTGGACCGG - Intergenic
1076965335 11:77908-77930 GCATCTGGTGGGTGCCCCTCTGG + Intergenic
1077140952 11:1024616-1024638 GCATCTGGTGGGTGGAGGCCGGG + Intronic
1077891497 11:6421260-6421282 GGGTCTGGTGGGAGGTGTTCAGG + Intergenic
1078131618 11:8618706-8618728 GCAGCAGGTGGGCGGTGATCAGG - Intronic
1080033522 11:27687788-27687810 GCATCTGGTGGGTGCCCCTCTGG - Intronic
1080042523 11:27774131-27774153 ACATCTGGAAGGTGGTGGTTGGG + Intergenic
1080334625 11:31181475-31181497 GCATCTGGTGGGTGCCCCTCTGG + Intronic
1080433029 11:32215931-32215953 GAATCTAGTGGGTGGAGGCCAGG + Intergenic
1080635169 11:34117390-34117412 GCATCCGGTGGGTAGAGGCCAGG + Intronic
1080965544 11:37210494-37210516 GCATCTGGTGGGTGCCCCTCTGG - Intergenic
1081102942 11:39027706-39027728 GCATCTGGTGGGTAGAAGACAGG + Intergenic
1081198883 11:40193213-40193235 GCATCTGGTGGGTGCCCCTCTGG + Intronic
1081221671 11:40470142-40470164 GCATCTGGTGGGTGCCCCTCTGG + Intronic
1081593004 11:44438079-44438101 GCATCTGGTGGGTGCCCCTCTGG + Intergenic
1081673885 11:44957200-44957222 GCCTCTGGTGGGTGGCGGAGAGG - Intergenic
1081797725 11:45832976-45832998 GAATCTGGTGGGTGGGGGCCAGG + Intergenic
1081880511 11:46446632-46446654 GCATCTAGTGGGTAGAGGCCAGG - Intronic
1082874916 11:57978194-57978216 GCATCTGGTTGGTAGATGTCAGG + Intergenic
1083385440 11:62306035-62306057 GCATCTGGTGGGTGCCCTTCTGG - Intergenic
1084709366 11:70834546-70834568 GGATCTGGTGGGGGATGGGCAGG - Intronic
1085139149 11:74124472-74124494 GCATCTGGTAAGTGGAGGCCAGG - Intronic
1085884542 11:80506338-80506360 GTATCTGGTGGGTGCTCCTCTGG + Intergenic
1086532281 11:87800565-87800587 GCATCTGGTGGGTGCCCCTCTGG - Intergenic
1086732743 11:90270442-90270464 GCATCTGGTGGGTGGCCCTCTGG - Intergenic
1087204634 11:95381147-95381169 GCATCTAGTGGGTGGAGGTCTGG - Intergenic
1087305182 11:96480894-96480916 GCATCTGGTGGGTAGAGGACAGG + Intronic
1087326287 11:96727505-96727527 GCATCTGGTGGGTGCTCCTCTGG - Intergenic
1087712300 11:101567625-101567647 GCATCTGGTGGGTGCCCCTCTGG + Intronic
1087930478 11:103972247-103972269 GCATCTGGTGGGCGGAGGACAGG - Intronic
1087969478 11:104461787-104461809 GCATATGCTGGGGGGTGGTGGGG + Intergenic
1088139464 11:106597962-106597984 GCATCTAGTGGGAGGTGTTTGGG - Intergenic
1089285388 11:117404533-117404555 GCATCTGGTGGGTGCCCCTCTGG - Intronic
1089359205 11:117875156-117875178 GTAGCTGGTGTGTGGTGGTGCGG + Intronic
1089410496 11:118237598-118237620 GCATCTAGTGGGTAGGGGCCGGG + Intronic
1089741669 11:120588765-120588787 GCATCTGGTGGGTAGAGGCCAGG - Intronic
1089743917 11:120603805-120603827 GCACGTGGTGGGTGGAGGTGGGG + Intronic
1090091723 11:123703937-123703959 GCTTCTGGTGGCTGCTGGTGTGG - Intergenic
1090274605 11:125410574-125410596 GCCTCTGGTGGGAGGTGCTTCGG - Intronic
1090324920 11:125877106-125877128 GCATCTAGTGGGTAGAGGCCAGG + Intergenic
1090914665 11:131152635-131152657 GGATCTGTTTGGTGGGGGTCTGG + Intergenic
1091170408 11:133515394-133515416 GCATCTGGTGGCTGGAGGCCAGG + Intronic
1091213443 11:133884640-133884662 GCATCTGGTGGGTGTCTCTCTGG - Intergenic
1091289670 11:134430951-134430973 GCATGTGCTGGGTGGTGTTTGGG - Intergenic
1091591576 12:1845858-1845880 GCACCTAGTGGGTGGAGGCCAGG - Intronic
1092028629 12:5264493-5264515 GCATGTTGTGTGTGGTGGGCAGG - Intergenic
1092768937 12:11878974-11878996 GCATCTAGTGGGTAGAGGCCAGG - Intronic
1092812346 12:12283647-12283669 GCATCTTGTGGGTAGAGGGCAGG + Intergenic
1093610613 12:21150453-21150475 GCATCTGGTGGGTGCCCCTCTGG + Intronic
1093714583 12:22366689-22366711 GCATCTGGTGGGTGACCCTCTGG + Intronic
1093870744 12:24288194-24288216 GCATCTAGTGGGTAGGGGCCAGG + Intergenic
1094070476 12:26407399-26407421 GCATCTAGTGGGTAGAGGACAGG - Intronic
1094680139 12:32660438-32660460 GCATCTTGTGGGTAGAGGCCAGG + Intergenic
1095487875 12:42703336-42703358 GAATCAGGTGGGTGGTGGGTGGG - Intergenic
1095560250 12:43555691-43555713 GCATCGAGTGGGTGGAGGCCAGG - Intergenic
1095657710 12:44689780-44689802 GCATCTAGTGGGTAGAGATCAGG + Intronic
1095674321 12:44898364-44898386 GCATCTGGTGAGTGACTGTCTGG + Intronic
1096453553 12:51766470-51766492 GCATCTAGTGGGTAGAGGCCAGG - Intronic
1096599160 12:52717330-52717352 GCATCTAGTGGGTAGAGGCCAGG - Intergenic
1096754160 12:53784903-53784925 GCATCTAGTGGGTGCTGTGCAGG - Intergenic
1096867525 12:54573713-54573735 GCATCTGGTGGGGTGTGGCTGGG + Intronic
1097056993 12:56256466-56256488 GAATGAGGTGGGTGGTGGTTAGG - Intronic
1097419596 12:59358073-59358095 TCATCTCGTGTGTGGTGGCCTGG + Intergenic
1097488518 12:60235416-60235438 GCATCTGGTGGGTGCCCCTCTGG + Intergenic
1097526704 12:60746197-60746219 GCATCTGGTGGGTGCCCCTCTGG + Intergenic
1097635116 12:62113365-62113387 GCATCTGGTGGGTGGCTCTCTGG - Intronic
1097920583 12:65068246-65068268 GCATCTGGGGTGTGGTGGGGAGG + Intronic
1098088101 12:66870022-66870044 GCATCTAATGGGTAGAGGTCAGG - Intergenic
1098494062 12:71114574-71114596 GTATCTAGTGGGTGGAGGCCAGG - Intronic
1098780248 12:74677144-74677166 GCATCTGGCGGGTGGCCCTCTGG + Intergenic
1098867136 12:75775847-75775869 GCGTCTAGTGGGTGGAGGCCAGG - Intergenic
1098872807 12:75835652-75835674 GCATCTAGTGGGTCATGGCCAGG + Intergenic
1099265312 12:80438919-80438941 GCATCTGGTGAGTAGAGGCCAGG - Intronic
1099522595 12:83682301-83682323 GCATCTGGTGGGTGCCCCTCTGG + Intergenic
1099778616 12:87165804-87165826 GGATCTGGAGGATGGTGGCCTGG + Intergenic
1099975072 12:89538003-89538025 GCATCTGGTGGATGGAGATCAGG + Intergenic
1100081937 12:90863036-90863058 GCATCTGGTGGATAGAGGCCAGG + Intergenic
1100111133 12:91243312-91243334 GCATCTGGTGGGTGCCCCTCTGG + Intergenic
1100157085 12:91812721-91812743 GCATCTAGTGGGTAGAGGCCAGG + Intergenic
1100584096 12:95963333-95963355 GCATCTAGTGGGTAGAGGCCAGG + Intronic
1100691836 12:97046665-97046687 GCATCTAGTGGGTGGAGGCCAGG + Intergenic
1101092775 12:101304662-101304684 GCATCTAGTGGGTGGAGGCCAGG + Intronic
1101283028 12:103279233-103279255 CCATTTGGTGTGTGGTGGTGGGG - Intronic
1101304608 12:103515014-103515036 GCATCTAATGGGTGGAGGCCAGG + Intergenic
1101356098 12:103978823-103978845 GCATCTAGTGGGTAGAGATCAGG + Intronic
1101415571 12:104505284-104505306 GCATCTGGTGGGTAGAAGCCAGG + Intronic
1101444460 12:104727574-104727596 CCATGTGCTGGGTGGTGGACTGG - Intronic
1101487915 12:105184635-105184657 GCATCTGGTGGGTGCCCTTCTGG - Intronic
1101633402 12:106517208-106517230 GCATCTAGTGGGTGGCAGCCAGG - Intronic
1101702098 12:107183602-107183624 GCATCTGGTGGGTAGAGGTCAGG + Intergenic
1101878623 12:108611415-108611437 GCATCTGGTGGGTGGTGGTCAGG - Intergenic
1101948966 12:109159696-109159718 GCATCTAGTGGGTGGAGACCAGG - Intronic
1102034847 12:109765274-109765296 GCATCGGGTGGGTCATGGCCTGG - Intronic
1102039110 12:109789248-109789270 GCATCAGGTGGGTGGAGGCCAGG + Intronic
1102040548 12:109798119-109798141 GCATCTGGTGGGTAGAGGCCCGG + Intronic
1102183958 12:110933455-110933477 GCATCTGGTGGGTAGAGGCCAGG - Intergenic
1102511126 12:113416148-113416170 GCATCTGGTGGGTGGAGGCCAGG + Intronic
1102545290 12:113649932-113649954 GCATCTGGTGGGTAGAGGTCAGG + Intergenic
1102956907 12:117064836-117064858 GCATCTAGTGGGTGGAGGCCAGG + Intronic
1102978784 12:117225485-117225507 GCATCTAGTGGGTGGAAGCCGGG - Intronic
1103009026 12:117443573-117443595 GCATCTAGTGGGTAGAGGCCAGG - Intronic
1103084901 12:118055267-118055289 CCATCTAGTGGGTGGAGGCCAGG + Intronic
1103298856 12:119911793-119911815 GCATCTAGTGGGTGGAGGCCAGG - Intergenic
1103299382 12:119916449-119916471 GCATCTAGTGGGCTGAGGTCAGG - Intergenic
1103323584 12:120105559-120105581 GCATTTAGTGGGTGGAGGCCAGG + Intronic
1103380521 12:120490724-120490746 GCATCTAGTGGGTAGAGGCCAGG + Intronic
1103441307 12:120965086-120965108 ACATCTATTGGGTGGTGGTCTGG + Intergenic
1103838088 12:123840105-123840127 GCATCTAGTAGGTTGTGGTCAGG - Intronic
1103887874 12:124216417-124216439 GCATCTGGTGGTTAGAGGCCAGG - Intronic
1104131370 12:125897548-125897570 GCATCTGGTGGGTAGTGAGAGGG + Intergenic
1104654117 12:130560429-130560451 GCATCCAGTGGGTGGAGGCCAGG - Intronic
1104670552 12:130677148-130677170 GCATCTGGTGGGTAGAGGCCAGG + Intronic
1104671083 12:130680703-130680725 CCATCTGGTGGGTAGGGGCCAGG + Intronic
1104884900 12:132100988-132101010 GCATTTGGTGGGTAGAGGCCTGG - Intronic
1104926544 12:132316855-132316877 GCATCTAGTGGTTGGAGGCCAGG + Intronic
1105443276 13:20432645-20432667 GATTCTGGGGGGTGGTGGGCTGG - Intronic
1105645721 13:22315828-22315850 GCATCTGGTGGGTGCCCCTCTGG - Intergenic
1105807625 13:23965531-23965553 GCATCTGGTAGGTGGAGTCCAGG + Intergenic
1106275084 13:28197028-28197050 GGAGGTGGTGGGTGGTGGTAAGG + Intronic
1106383284 13:29260874-29260896 GCATCTAGTGGGTAGAGGCCGGG + Intronic
1106510155 13:30406260-30406282 GCATCTAGTGGGTAGGGGCCAGG - Intergenic
1106657659 13:31763433-31763455 GCATCTAGTGGGTAGAGGCCAGG + Intronic
1107035717 13:35900705-35900727 GCATCTGGTGGATAGAGGCCAGG - Intronic
1107641873 13:42452549-42452571 GCATCTGGTGGGTGCCTCTCTGG - Intergenic
1108029997 13:46219984-46220006 GCATCTGGTGGGTGCCCCTCTGG - Intronic
1108153862 13:47564679-47564701 GCATCTGGTGGGTGCCCCTCTGG + Intergenic
1108200471 13:48038132-48038154 GCCCCTGCTGGGTGGTGGTTGGG + Intronic
1108304688 13:49119114-49119136 GCATCTGGTGGGTGCCCTTCTGG + Intronic
1109163352 13:59003631-59003653 GCATCTGGTGGGTGCCCCTCTGG - Intergenic
1109196008 13:59377884-59377906 GCATCTGGTGGGTGACCCTCTGG + Intergenic
1109328733 13:60901097-60901119 GCATCAGGCGGGTGGTTCTCTGG + Intergenic
1109457415 13:62611132-62611154 GCATCTGGTGGGTGCCCCTCTGG - Intergenic
1109635456 13:65109273-65109295 GCATCTGGTGGGTGCCCCTCTGG - Intergenic
1110020033 13:70458065-70458087 GCAACTGGTGGGTGGCCCTCTGG + Intergenic
1110034841 13:70670237-70670259 GCATCTGGTGGGTAGAGGCCAGG - Intergenic
1110121357 13:71885762-71885784 GCATCTAGTGGGTAGAGGGCAGG + Intergenic
1110464405 13:75784112-75784134 GTATCTAGTGGGTAGAGGTCAGG + Intronic
1110713871 13:78679589-78679611 GCGTCTGGTGAGTAGAGGTCAGG + Intergenic
1111585421 13:90277692-90277714 GCAAATGGTGGGTGCTGGTAAGG - Intergenic
1112019427 13:95358893-95358915 GCTTCTGATGGGAGGTGGGCAGG - Intergenic
1112065923 13:95793018-95793040 GCAGCAGGTGGGAGGTGGCCAGG - Exonic
1112241761 13:97688607-97688629 GCATCTAGTGGGTAGAGGCCAGG + Intergenic
1113083689 13:106545146-106545168 GCATCTAGTGGGTGGAAGACTGG + Intronic
1113315922 13:109178768-109178790 GCATCTAGTGGGTGGAGGTCAGG + Intronic
1113334237 13:109362924-109362946 GCATGGGGTGGGGGGTGGTTAGG + Intergenic
1113335693 13:109373849-109373871 GCATCTGGTGGGTAGAGAGCAGG - Intergenic
1113600330 13:111563750-111563772 GCATCTGGTTGGTGGAGTCCAGG + Intergenic
1114741836 14:25105320-25105342 GCATCTGGTGGGTGCCCCTCTGG + Intergenic
1114821365 14:26023552-26023574 GCATCTAGTAGGTAATGGTCAGG - Intergenic
1115359721 14:32487921-32487943 GCATCTGGTGGGTGCCCCTCTGG - Intronic
1115762812 14:36592185-36592207 GAATGTGGTGGGTGGGGGACAGG + Intergenic
1116074210 14:40089269-40089291 GCATCTGGTGGGTGCCCCTCTGG + Intergenic
1116549615 14:46219859-46219881 GCAGCTAGTTGGTGGAGGTCAGG - Intergenic
1116765240 14:49062516-49062538 GCATCTGGTGGGTGCCCCTCTGG + Intergenic
1116775806 14:49179237-49179259 GCATCTGGTGGGTGTCCCTCTGG + Intergenic
1117121152 14:52569057-52569079 GCATCTGATGGGTGCCCGTCTGG + Intronic
1117247084 14:53897130-53897152 CCAGCTGGTGGGTTGTGGTGGGG + Intergenic
1117777736 14:59199822-59199844 GCATCTAGTGGGTAGAGGCCAGG - Intronic
1117821937 14:59658494-59658516 GCATCTGGTGGGTGCCCCTCTGG + Intronic
1118286508 14:64479318-64479340 GCATCTAGTAGGTGGAGGCCAGG - Exonic
1118475699 14:66114983-66115005 GCATCTAGTGGGTGGAGGTCAGG - Intergenic
1118498536 14:66333498-66333520 GCATCTGGCGGGTGGCCCTCTGG + Intergenic
1118728990 14:68653561-68653583 GCATCTTGTGGGTGGAGGCCAGG - Intronic
1119024294 14:71140299-71140321 GCATCTGGAGGGTAGAGGCCAGG - Intergenic
1119068305 14:71552978-71553000 GCATCTCGTGGGTAGAGGCCGGG - Intronic
1119125498 14:72121961-72121983 GCATCTGGTGGATAGGGGCCAGG + Intronic
1119442969 14:74641156-74641178 GCCTTTGGCGGGTGGTGGGCGGG - Intergenic
1119457347 14:74767553-74767575 GCATCTAATGGGTAGAGGTCAGG - Intronic
1119758143 14:77133105-77133127 GAACCTGGTGGGGGGTGGTGAGG + Exonic
1119798964 14:77425726-77425748 GCATCCAGTGGGTAGAGGTCAGG - Intergenic
1120015699 14:79470782-79470804 GCTACTTGTGAGTGGTGGTCAGG + Intronic
1120048183 14:79832568-79832590 GCATCTAGTGGGTAGAGGTCAGG + Intronic
1120279890 14:82425857-82425879 GCATCTAGTGGGTATTGGCCAGG - Intergenic
1120554032 14:85907300-85907322 GCATCTGGTGGGTGCCCCTCTGG - Intergenic
1120843080 14:89104202-89104224 GCATCTGGTGGGTGCCCCTCTGG - Intergenic
1121558236 14:94854655-94854677 GCATCTGGTGGGTAGAGGCCAGG + Intergenic
1121660906 14:95634303-95634325 GGCTGTGCTGGGTGGTGGTCAGG + Intergenic
1121951097 14:98171790-98171812 GCATCTAGTGGGTAGAGGCCAGG - Intergenic
1121979676 14:98443839-98443861 GCACCTAATGGGTGGAGGTCGGG - Intergenic
1121986806 14:98514842-98514864 GCATTTAGTGGGTGGAGTTCAGG - Intergenic
1122172589 14:99889288-99889310 GTGCCTGGTGGGTGGTGGTGGGG - Intronic
1122549825 14:102543954-102543976 GCATTTGTTGGGTGGTGGTGGGG - Intergenic
1122851161 14:104532097-104532119 CTATCTGGGTGGTGGTGGTCCGG - Intronic
1122862224 14:104587794-104587816 GCCTCTGGGCGGTGGTGCTCCGG - Exonic
1202852356 14_GL000225v1_random:29807-29829 GCTGCCGGTGGGTGGTGGTGTGG - Intergenic
1123429168 15:20200214-20200236 GCATCTGGTGGGTGCCCCTCTGG - Intergenic
1124158651 15:27250087-27250109 GCACCTGGTGGGGGCTGGTGAGG - Intronic
1124339044 15:28878061-28878083 GCATCTGGTGGGTAGAGTTCAGG - Intergenic
1124624513 15:31300338-31300360 GCAGAGGGTGGGTGGTGGGCTGG - Intergenic
1124783916 15:32661273-32661295 GCATCTAGTGGGTAGAGGCCAGG - Intronic
1124922626 15:34041162-34041184 GCATCTAGTGGGTAGAGGCCAGG - Intronic
1125001249 15:34772548-34772570 GCATCTGGTGGGTAGAGGCCAGG + Intergenic
1125354468 15:38802851-38802873 GCATCTGGTGGGTGCCCCTCTGG - Intergenic
1125379939 15:39077083-39077105 GCATCTAGTGGGTAGAGGCCAGG - Intergenic
1125680979 15:41530039-41530061 GCAGCTGCTGGGTGATGGTGGGG - Intronic
1125775524 15:42209061-42209083 GCATTTGGTGGGTGGAAGTTAGG - Intergenic
1126176779 15:45743238-45743260 GCATCTAGTGGGTAGAGGTGAGG + Intergenic
1126264810 15:46741775-46741797 GCATCTGGTGGGTGCCCCTCTGG + Intergenic
1126862800 15:52903147-52903169 GCATCTGGTGGGTGCCCCTCTGG + Intergenic
1127070417 15:55283189-55283211 GCATTTAGTGGGTGGGGGCCAGG - Intronic
1127135060 15:55911232-55911254 GCATTTAGTGGGTGGAGGCCAGG + Intronic
1127381459 15:58434116-58434138 GCATCTAGTGGGTAGAGGCCAGG + Intronic
1128220009 15:65962418-65962440 GCATCTAGTGGGTAGAGGCCAGG + Intronic
1128224351 15:65991528-65991550 GCATCTCGTGGGTAGAGGCCAGG - Intronic
1128368192 15:67019651-67019673 GCATCTAGTGGGTAGAGGCCAGG + Intergenic
1128766713 15:70255580-70255602 GGATCTGGTGGGAGGTGTTTGGG - Intergenic
1129342557 15:74895760-74895782 GCATCTTGTGGGTGGAGGCCAGG + Intronic
1129393228 15:75230992-75231014 GCAGCTGGTGGGTGATGGGTGGG + Intergenic
1129438974 15:75565510-75565532 GCATCTAGTGGATAGAGGTCAGG - Intronic
1129911288 15:79228846-79228868 GCATCTGGTGGATAGAGGACAGG + Intergenic
1129929830 15:79401518-79401540 GCATCTGGTGGGTAGAGGGCAGG + Intronic
1129945816 15:79538649-79538671 GCATCTGGTGGGTAGAGGCCAGG + Intergenic
1130094292 15:80844526-80844548 TCATCTGGGGGGTGGTTTTCAGG - Intronic
1130192939 15:81753612-81753634 GCATCTAGTGGGTGGAGGCCAGG + Intergenic
1130439513 15:83938373-83938395 TCATCTGATGGGTCATGGTCAGG + Intronic
1130705294 15:86227495-86227517 GCGTCTGGTGGGTAGAGGCCAGG - Intronic
1130728590 15:86466876-86466898 GCATCTGGTGGGTGCCCCTCTGG - Intronic
1131045105 15:89308258-89308280 GCATCTGGTAGGTGGAGGCCAGG - Intronic
1131212102 15:90506701-90506723 GCATCTAGTGGGTAGAGGTGAGG + Intergenic
1131280675 15:91018671-91018693 GCATCTTGTGGGTAGAGGCCAGG + Intronic
1131729435 15:95263874-95263896 GCATCTGGTGGGTAGAGGTCAGG - Intergenic
1131788407 15:95937764-95937786 GCATCCAGTGGGTGGAGGACAGG - Intergenic
1131825636 15:96321232-96321254 GCAATTGGGGGGTGGTGGTGGGG + Intergenic
1132442791 15:101885613-101885635 GCATCTGGTGGGTGCCCCTCTGG - Intergenic
1132513356 16:354547-354569 GCATCTGGTTGGGGGTAGGCTGG - Intergenic
1132600303 16:770086-770108 GCACTTGGTGGGTGGTGCTGGGG + Exonic
1132658438 16:1051115-1051137 GGATCTGGTGCGGGGTGGGCGGG + Intergenic
1132907121 16:2288379-2288401 GCCGCAGGTGGGTGGGGGTCAGG - Intronic
1133299281 16:4772339-4772361 GTGTCTGGTGGGTGGAGGCCAGG + Intergenic
1133404339 16:5510820-5510842 GCATCTAATGGGTGGAGGGCTGG - Intergenic
1133443062 16:5836717-5836739 GCATCTAGTGGGTAGAGGCCAGG - Intergenic
1133537180 16:6713505-6713527 GCATCTAGTGGGTAGAGGCCAGG - Intronic
1133619583 16:7513578-7513600 CCATCTAGTGGGTGGAGGCCAGG - Intronic
1133746609 16:8691814-8691836 GCATCTGGTGGGCAGAGGCCAGG + Intronic
1133761603 16:8803028-8803050 GCATCTAGTGGGTAGAGGCCTGG - Intronic
1133808888 16:9146191-9146213 GCATCTAGTGAGTGGAGGCCAGG - Intergenic
1133907887 16:10038483-10038505 GCATCTAGTAGGTGGAGGACAGG - Intronic
1133978567 16:10617477-10617499 GCCTCTTGTGGGTGCTGGCCTGG + Intergenic
1133987004 16:10676325-10676347 GCATCTAGTGGGTAGAGGCCAGG - Intronic
1134029688 16:10981910-10981932 ACATCTAGTGGGTGGAGGTCAGG + Intronic
1134112168 16:11522459-11522481 GCATCTTGTGGGTAAAGGTCAGG - Intronic
1134127791 16:11628385-11628407 GCATCTACTGGGTGTTGATCTGG - Intronic
1134141955 16:11727956-11727978 ACATCTAGTGGGTGGAGGCCAGG + Intronic
1134263303 16:12671478-12671500 GCTTCTGGTGAGTGGGGTTCTGG + Intronic
1134295735 16:12944037-12944059 GCATCTAGTGGGTAGAGGCCAGG - Intronic
1134372803 16:13641171-13641193 GCATCTAGTGGGTAGAGGCCAGG + Intergenic
1134423530 16:14116723-14116745 GCATCTAGTGGGTGGAGACCAGG - Intronic
1134618456 16:15669820-15669842 GCATCTAGAGGGTGGAGGCCAGG - Intronic
1134629995 16:15749680-15749702 GCATCTAGTGGGTAGGGGCCAGG - Intronic
1134635144 16:15786238-15786260 GCATCTGGCGGGTCGAGGCCAGG + Intronic
1134654770 16:15939812-15939834 GCATTTGGTGGGTAGGGGCCAGG + Intergenic
1134834764 16:17351795-17351817 GCATCTAGTGGGTAGAGATCAGG - Intronic
1135028093 16:19014250-19014272 GCATCTAGTGGGTAGAGGCCAGG - Intronic
1135057842 16:19245284-19245306 GCATCTAGTGGGTAGTGGCCAGG + Intronic
1135079665 16:19423280-19423302 GTATCTAGTGGGTGGAGGCCAGG - Intronic
1135164693 16:20128735-20128757 GCATCTGGTGGGTAGAGACCAGG + Intergenic
1135173725 16:20209686-20209708 GCATCTGGTGGTGGGAGGTGGGG + Intergenic
1135597835 16:23756756-23756778 GCATCTAGTGGGTAGAGGTCAGG + Intronic
1135874656 16:26186963-26186985 GGACCTGGTGGGTGGTGTTTGGG + Intergenic
1136123978 16:28163021-28163043 GCATCTAGTGAGTGGAGGCCAGG - Intronic
1136568797 16:31084821-31084843 CCATCAGGCAGGTGGTGGTCAGG + Exonic
1136855152 16:33649518-33649540 GCATCTGGTGGGTGCCCCTCTGG + Intergenic
1137296406 16:47097783-47097805 GCATCTGGTGGGTGCCCTTCTGG + Intronic
1137432441 16:48429091-48429113 GCATCTGTCAGGTGATGGTCAGG - Intronic
1137643656 16:50055944-50055966 GCATCTGGTGGGTAGAGGCCAGG + Intergenic
1137729351 16:50678606-50678628 GGAGCTGGTGAGTGGTGGGCAGG + Intronic
1137924565 16:52527927-52527949 GCATCTAGTGGGTAGAGGCCAGG + Intronic
1137927542 16:52555020-52555042 GCAGCTGATGGGTGGTGGACTGG - Intergenic
1137959869 16:52871748-52871770 GCATCTGGTGGGTGGAAGCCAGG - Intergenic
1138000135 16:53269841-53269863 GCATCTAGTGGGTAGAGGCCAGG + Intronic
1138104207 16:54278749-54278771 GCATCTCATAGGTAGTGGTCAGG - Intergenic
1138146362 16:54615743-54615765 GAATCTGTGGGGTGGTGGTGGGG - Intergenic
1138151632 16:54662421-54662443 GCATCTGGTGGGTGCCCCTCTGG + Intergenic
1139008199 16:62599578-62599600 GAATCTGGTGGCTGGTGTGCTGG - Intergenic
1139133441 16:64173781-64173803 GCATCTACAGGGTGGAGGTCAGG - Intergenic
1139283981 16:65794325-65794347 GCATCTAGTGGGTAGAGGCCAGG + Intergenic
1139546809 16:67653404-67653426 GCCTGGGGTGGGGGGTGGTCAGG - Intronic
1139641408 16:68294407-68294429 GCATCTGTTGGATGTTGGTGAGG + Intronic
1140002555 16:71040010-71040032 GCATCTTGGGGGCGGTGGGCGGG - Intronic
1140251866 16:73301470-73301492 GCATCTGGAGGGTAGAGGCCAGG - Intergenic
1140693829 16:77511938-77511960 GCATCTAGTGGGTAGAGGTGAGG + Intergenic
1140696542 16:77539867-77539889 GCATATGGTGTGTGTTGGTTGGG + Intergenic
1140865402 16:79056602-79056624 GCATCTAGTGGGTAGAGGCCAGG - Intronic
1140954126 16:79846798-79846820 GCATCTAGTGGGTCGAGGCCAGG + Intergenic
1141148510 16:81548490-81548512 GCATCTAGTGAGTGGAGGCCAGG - Intronic
1141246036 16:82308792-82308814 GCATCTGGTGGGTGCCCCTCTGG - Intergenic
1141257484 16:82416083-82416105 GCATCTAGTGGGTGGAGGCCAGG - Intergenic
1141314151 16:82944571-82944593 GCATCTAGTGGGTGAAGGCCAGG + Intronic
1141664953 16:85461255-85461277 GCACCTGGTGGGTAGAGGCCAGG - Intergenic
1141737135 16:85861221-85861243 GCATCTGGTGGGTCGAGGCCAGG + Intergenic
1141756120 16:85992147-85992169 GCATCTAGTGGGTGGAGGCCAGG - Intergenic
1141789358 16:86223939-86223961 GCACCTGGTGAGTGGAGGCCAGG - Intergenic
1141875604 16:86822268-86822290 GAATCTGGTGGGTAGAGGCCAGG - Intergenic
1203116734 16_KI270728v1_random:1498002-1498024 GCATCTGGTGGGTGCCCCTCTGG + Intergenic
1142590009 17:999852-999874 GCATCTCGTGGGTAGAGGCCAGG - Intronic
1142899658 17:3004153-3004175 GTGCCTGGTGGGTGGTGGTAGGG + Intronic
1142990965 17:3730646-3730668 ACATCTGGTGGGTAGAGGCCAGG - Intronic
1143598639 17:7930128-7930150 GCATCTAGTGGGTGGTGGCCAGG + Intronic
1143774885 17:9192540-9192562 GCATCTAGTGGGTAGAGGCCAGG + Intronic
1143857959 17:9866383-9866405 GCATCTAGTGGGTGGAGGTCAGG + Intronic
1143965944 17:10756591-10756613 GCATCTGGTGGGTAGAGGCCAGG - Intergenic
1144197204 17:12906025-12906047 GCATCTGATGGGTAGAGGCCAGG - Intronic
1144228542 17:13175505-13175527 CCAGCTTGTGTGTGGTGGTCTGG + Intergenic
1144392315 17:14805527-14805549 GCATCTAGTGGGTAGAGTTCAGG + Intergenic
1144434047 17:15223489-15223511 GCATCTGGTGGGTGCCCCTCTGG - Intergenic
1144558812 17:16304937-16304959 ACATCTAGTGGGTAGTGGCCAGG - Intronic
1144589301 17:16510677-16510699 GCATCAGGTGGGTAGAGGCCAGG + Intergenic
1144626902 17:16848584-16848606 GAGCATGGTGGGTGGTGGTCGGG - Intergenic
1144662556 17:17080606-17080628 GCATCTAGTGGGTGGAGGCCAGG + Intronic
1144879537 17:18424128-18424150 GAGCATGGTGGGTGGTGGTCGGG + Intergenic
1145152703 17:20520259-20520281 GAGCATGGTGGGTGGTGGTCGGG - Intergenic
1145772449 17:27503297-27503319 GCATCTCGTGGGTAGAGGCCAGG + Intronic
1145784105 17:27582935-27582957 GCAGCTGGGGTGTGGTGGGCGGG - Exonic
1146004761 17:29154330-29154352 GCATTTGGGGTGAGGTGGTCAGG + Intronic
1146231536 17:31115206-31115228 GCATCTAGTGGGTAGAGTTCAGG + Intronic
1146573192 17:33970162-33970184 GCATCTAGTGGGTAGAGGCCAGG - Intronic
1146623724 17:34420147-34420169 GCATCTGGTGGGTAGAGGCCAGG - Intergenic
1146766262 17:35524483-35524505 GCATCTGGTGGGTGCCCCTCTGG + Intronic
1146791871 17:35755549-35755571 GCTTTTGGTGGGTAGTGGCCAGG - Intronic
1147233920 17:39042835-39042857 GCATCTGGTGGGCAGAGGCCAGG + Intergenic
1147646378 17:42036787-42036809 GCATTTGGGGGGTGGTCCTCTGG - Intronic
1148042160 17:44716592-44716614 GCATCTAGCGGGTGGAGGCCAGG - Intronic
1148113543 17:45161432-45161454 GCACCCCGTGGGGGGTGGTCCGG - Intronic
1148221892 17:45868850-45868872 GCATCTAGTGGGTAGAGGCCAGG + Intergenic
1148640125 17:49181144-49181166 ACATCTGGTGGGCAGTGGGCAGG + Intergenic
1148700344 17:49583059-49583081 GCACCTGGTGGGTGGGTGGCAGG + Intronic
1148860299 17:50601069-50601091 ACATCTTGTGGGTGATGATCCGG - Exonic
1149517089 17:57288893-57288915 GCATCTAGTGGGTAGAGGCCGGG - Intronic
1150218932 17:63485014-63485036 TCGCCTGGTGGGTGGTTGTCTGG - Exonic
1150623041 17:66822757-66822779 GCATCTAGTGGGTAGAGGCCAGG - Intergenic
1150638182 17:66931197-66931219 GCATCTGATTGGTGGTGTCCAGG + Intergenic
1151180646 17:72325189-72325211 CCCTCTGGTGTGTGGTAGTCTGG - Intergenic
1151327574 17:73388579-73388601 GCATCAAGTGGGTGGAGGCCAGG - Intronic
1151360965 17:73588627-73588649 GCATCTAGTGGGTAGAGGCCAGG + Intronic
1151420370 17:73993172-73993194 GCATCTGGTGGGTACAGGCCAGG + Intergenic
1151449171 17:74187246-74187268 GCATCTAGTGGGTAGAGGGCAGG - Intergenic
1151474010 17:74335197-74335219 GCATCTAGTGGGTAGCGGCCAGG + Intronic
1151511939 17:74566110-74566132 GCATCTGGTGGGTAGAGGCCAGG + Intergenic
1151991110 17:77574907-77574929 GCATCTAGTGGGTAGGGATCAGG - Intergenic
1152283414 17:79398576-79398598 GCATCTGGTGGGTGGAGGCCAGG + Intronic
1152320109 17:79603953-79603975 GCACCTGCTGGCTGGTGGGCGGG - Intergenic
1152342667 17:79733821-79733843 GCAGGTGGTGGGTGCTGGTGAGG + Intronic
1153126985 18:1805341-1805363 GTATGTGGTGGGAGGTGGTAGGG - Intergenic
1153236621 18:2994708-2994730 GCATCTGGTGGTTGGAGGCCAGG - Intronic
1153423355 18:4934021-4934043 GCATTTAGTGGGTGGAGGCCAGG - Intergenic
1153475832 18:5497428-5497450 GCTTCTGATGGGTGCTGGACAGG - Intronic
1153661470 18:7329854-7329876 GCACCTGGTGGGTGGAGGCCAGG + Intergenic
1153831976 18:8931752-8931774 GCATCTAGTGGGTAGAGGCCAGG + Intergenic
1154374359 18:13796771-13796793 GCAGCTGAAGGGTGGTGGCCAGG - Intergenic
1154990512 18:21594057-21594079 GCATCTAGTGGATGGAGGTCGGG - Intronic
1155382194 18:25236137-25236159 GCAGCTGCTGGGTGGTTGGCTGG - Intronic
1155385021 18:25267537-25267559 GCATCTGGTGGGTGACCCTCTGG + Intronic
1155665104 18:28298901-28298923 GCATCTGGTGGGTGCCTCTCCGG - Intergenic
1155857254 18:30849652-30849674 GCATCTGGTGGGTGCCTCTCTGG - Intergenic
1155988753 18:32257552-32257574 GCAGCTGGTGTGTGGTTGTATGG - Intronic
1155992171 18:32289746-32289768 GCATCTAGTGGGTAGAGGCCAGG + Intronic
1156093455 18:33499796-33499818 GCATCTAGTGGGTAGAGGCCAGG - Intergenic
1156388710 18:36629932-36629954 GCATCTAGTGGGTGGAGTCCAGG + Intronic
1156437635 18:37150323-37150345 GCATCTAGTGGGTAGAGGCCAGG - Intronic
1156486505 18:37469333-37469355 GCATCTGCTGGGAGGGGGCCGGG + Intronic
1157449071 18:47772133-47772155 GCTTCTGGTGGGTGGAGTCCAGG - Intergenic
1157592228 18:48842873-48842895 GCCTCAGGTGGGTGGAGGTAGGG + Intronic
1157864421 18:51168534-51168556 ACATCTAGTGGGTGGAGGCCAGG + Intergenic
1158283549 18:55853450-55853472 GCATCTAGTGGGTGGAGGCCAGG - Intergenic
1158305519 18:56101200-56101222 GCATCTAGTGGGTAGAGGCCAGG + Intergenic
1158392110 18:57052366-57052388 GCATCTAGTGGGTAGAGGTTGGG - Intergenic
1158572923 18:58612048-58612070 GCATCTGGTGGGTAGAGGCCAGG - Intronic
1158921007 18:62190795-62190817 GCATCTGGTGGGTAGAGGTCAGG - Intronic
1160059308 18:75515026-75515048 GCATCTGTTGGGTAGAGGCCAGG + Intergenic
1160260990 18:77294070-77294092 GGGTCTGGTGGGTGGTGTTTGGG + Intergenic
1160599997 18:80005241-80005263 GCATCTGGTGGGTGGAGGCCAGG - Intronic
1160642139 19:147538-147560 GCATCTGGTGGGTGCCCCTCTGG + Intergenic
1160833379 19:1113498-1113520 GCAGCTGGAGTGTGGTGGGCGGG - Intronic
1161135487 19:2617177-2617199 GCATGGAGTGGGTGGGGGTCAGG - Intronic
1161141999 19:2653661-2653683 GCATGGGGTGGGTGGAGGCCAGG - Intronic
1161162610 19:2769423-2769445 GCATGAGGTGGGTGGGGGCCAGG + Intronic
1161281148 19:3446401-3446423 GCATGAAGTGGGTGGTGGCCAGG + Intronic
1161342550 19:3751162-3751184 GCGGGTGGTGGGTGGTGGCCAGG - Intronic
1161561036 19:4972549-4972571 GCATCTGGTGGGTGGTGGTCAGG - Intronic
1161744035 19:6043906-6043928 GCACCTGCTGGGTGGAGCTCAGG - Intronic
1161884248 19:6981500-6981522 GCATCTGGTGGATGGAGACCAGG - Intergenic
1161942448 19:7414143-7414165 GCATCTGGTGGGTGGAGGCCAGG - Intronic
1161956930 19:7501323-7501345 GCGCCTGGTGCGTGGTGGGCGGG - Exonic
1161999360 19:7733328-7733350 GCATCTAGTGGGTAGAGGCCAGG + Intronic
1162046562 19:8004507-8004529 GCATCTAGTGGGTAGAGGCCAGG + Intronic
1162339703 19:10085278-10085300 GCATCTAGTGGGTGGAGGCCAGG + Intergenic
1162515270 19:11143511-11143533 GCATTTGGTGGGTGGAGGCCAGG + Intronic
1162679648 19:12331361-12331383 GTATCTGGTGGTTGGGGGTAGGG - Intronic
1162787592 19:13045405-13045427 GCATCTCGTGGGTGGAGGCTGGG + Intronic
1162793024 19:13072731-13072753 TCATCTAGTGGGTGGAGGCCAGG + Intronic
1162793730 19:13076089-13076111 GCATCTTGTAGGTGGAGGCCAGG - Intronic
1162822490 19:13231453-13231475 GCATCTGGTGGGGGGAGGACAGG + Intronic
1162830474 19:13281568-13281590 GCATCTGGTGGGTGGAGGCCAGG - Intronic
1162834209 19:13305612-13305634 GCATCTGGTGGGTGGAGACTAGG - Intronic
1162921048 19:13903326-13903348 ACATCTAGTGGGTGGAGGCCAGG - Intronic
1163044199 19:14627151-14627173 GCATCTAGTTGGTGGAGGTCAGG - Intronic
1163096574 19:15062310-15062332 GGATCTGGTGGGAGGTGATTGGG - Intergenic
1163275194 19:16279194-16279216 GCATCTGGTGGGTGGAGGCCAGG + Intergenic
1163278937 19:16303303-16303325 GTATCTGGTGGGTGCAGGCCAGG + Intergenic
1163297405 19:16421237-16421259 GACTGTGGAGGGTGGTGGTCAGG - Intronic
1163298763 19:16429943-16429965 GCATCTGGTGGGTCAAGGCCAGG - Intronic
1163310355 19:16510625-16510647 GCATCTGCTGGGTGGAGGCCAGG + Intronic
1163337211 19:16680925-16680947 GCATCTCGTGGGTGGAGGCCAGG - Intronic
1163347969 19:16756656-16756678 GCATCTAGTGGGTGGAGGCTTGG + Intronic
1163349107 19:16764158-16764180 GAATCTGGTGGGTGGAGGCCAGG + Intronic
1163349214 19:16764828-16764850 GTATCTGGTGGGTGGAGGCCAGG + Intronic
1163351505 19:16778969-16778991 CCATCTGGTGGGTGCAGGCCAGG - Intronic
1163359365 19:16836186-16836208 GCATCTGGTGGGTGGAGGCCAGG - Intronic
1163364733 19:16869606-16869628 GCAGCTGGTGGATGGTGCCCTGG - Exonic
1163381106 19:16969356-16969378 ACATCTAGTGGGTGGAGGTCAGG + Intronic
1163386787 19:17004820-17004842 GCATCTGTTGGGTGGAGGCCAGG - Intronic
1163386876 19:17005266-17005288 GCATCTGGTGAGTGGAGGCCAGG - Intronic
1163395974 19:17061687-17061709 GCGTCTGGTGGGTGGAGGCCAGG - Intronic
1163399479 19:17083445-17083467 GCATCTGAAGGGTGGAGGCCGGG - Intronic
1163403479 19:17108456-17108478 GCATCTGGTGGGTGGAGGCCAGG - Intronic
1163408192 19:17136600-17136622 GCATCGGGTAGGTGGAGGCCAGG + Intronic
1163414699 19:17179135-17179157 GCATCTGGTGGGTGGAGGCCAGG - Intronic
1163417875 19:17197585-17197607 GCCTCTGGTGAGTGGAGGGCAGG - Intronic
1163418568 19:17201655-17201677 GCATCTGGTGGGTGGAGGCCAGG + Intronic
1163435637 19:17293542-17293564 GCATCTAGTGGGTGGAGGCCAGG - Intronic
1163644337 19:18479914-18479936 GCTTCTGGAGGGTGGTGGGAAGG - Intronic
1163681788 19:18686896-18686918 GCATCTGGTGGGTGGAGGCTGGG + Intronic
1164020920 19:21304371-21304393 GGACCTGGTGGGTGGTGTTTGGG - Intronic
1165707578 19:37987517-37987539 GCATCTAGTGGGTAGAGGCCAGG - Intronic
1165863634 19:38922650-38922672 GGACCTGGTGGGAGGTGATCGGG + Intronic
1166996343 19:46721392-46721414 GCCTCTGGTGGGTGAGGGGCTGG - Intronic
1167473444 19:49687587-49687609 GCATCTGGTAGGTAGGGGCCAGG + Intronic
1167709507 19:51101485-51101507 GCATCTAGTGGGTAGAGGCCAGG + Intronic
1167715973 19:51143115-51143137 GCATCTGGTGGGGAGAGGCCTGG - Intronic
1167768771 19:51500972-51500994 GCATCTGGTGGGGAGAGGCCTGG + Intronic
1168153033 19:54459218-54459240 GCATCTAGTGAGTGGAGGCCAGG + Intronic
1168243748 19:55099621-55099643 GCATCGGCTGGGTGGAGGCCAGG + Intronic
1168275175 19:55274035-55274057 GCATCTGGTGGGTGGCCTCCAGG - Intronic
1168314713 19:55479652-55479674 GCATCTAGTGGGTGGAGGCCAGG - Intronic
1168350407 19:55672493-55672515 GCATCCGGTGGGTGGAGGCTGGG - Intronic
1168416889 19:56174974-56174996 GCATCTCGTGGGTGGAAGCCAGG - Intergenic
1168423851 19:56223141-56223163 GCATCTAGAGGGTGGAGGTGGGG - Intronic
1168451965 19:56473630-56473652 GCATCTAGTGAGTGGAGGCCAGG + Intronic
1168457780 19:56527092-56527114 GCATCTGGTGGGTGCCCCTCTGG + Exonic
1168517687 19:57022088-57022110 GCATCTAATGGGTGGAGGCCAGG + Intergenic
925038962 2:715398-715420 AGATCTGGTGGGTGGAGGTGAGG - Intergenic
925186390 2:1849575-1849597 GCATCTGGTGGGTGAGGCCCAGG + Intronic
925402980 2:3588906-3588928 GCAGCTGCTGGGTGGTAGTGTGG + Intergenic
925543553 2:4992391-4992413 GCATCTAGTGGGTAGAGGCCAGG - Intergenic
925573179 2:5333021-5333043 GCGTGGGGTGGGTGGTGGTGGGG - Intergenic
925575200 2:5352918-5352940 GCATCTAGTGGGTAGAGGTCAGG - Intergenic
925988673 2:9235979-9236001 GCATCTGGTGGGTGGAGGCCAGG + Intronic
926159407 2:10477109-10477131 GCGTCTGGTGGGTGGAGGCCAGG + Intergenic
926652012 2:15357063-15357085 ACATCTGGGGGTTGGTGGTGGGG - Intronic
926764929 2:16316008-16316030 GCATCTAGTGGGTAGAGGCCAGG - Intergenic
926970567 2:18463596-18463618 GCATCTGGTGGGTGCCCCTCTGG - Intergenic
927029981 2:19110903-19110925 GCATCTGGTGGGGAGAGGCCAGG - Intergenic
927089624 2:19700650-19700672 CCTTCTGCTGGGTGGTGGCCTGG - Intergenic
927515342 2:23668849-23668871 GCCTCTGGAGGGTGGAGGTGAGG - Intronic
929064666 2:37962072-37962094 GCATCTGGTGGGTGGCCCTCTGG - Intronic
929476260 2:42252642-42252664 GCATTGAGTGGGTGGTGGTGGGG - Intronic
929587578 2:43126110-43126132 GCATCTAGTGGATGGAGGTCAGG - Intergenic
929644426 2:43612632-43612654 CCATCTAGTGGGGAGTGGTCGGG - Intergenic
930264646 2:49185877-49185899 GCATCTGGTGGGTGCCACTCTGG - Intergenic
930345928 2:50180676-50180698 GCATCTGGTGTCTGATGGTAAGG - Intronic
930379589 2:50611430-50611452 GCATCTGGTGAGTTCTTGTCTGG - Intronic
931480475 2:62634038-62634060 GCATCTGGTGGGTGTCCCTCTGG + Intergenic
931772007 2:65505463-65505485 GCATCTGGTGGGTAGAGGCCGGG + Intergenic
932051493 2:68403108-68403130 GCATCTGGTGGGTGCCCCTCTGG - Intergenic
932746834 2:74340809-74340831 GCCCGTGGTGGATGGTGGTCTGG - Intronic
932887206 2:75559215-75559237 TCATCTGGTGGGTAGAGGCCAGG - Intronic
932938875 2:76139092-76139114 GCATCTGGTGGGTGCCCTTCTGG - Intergenic
933167606 2:79093352-79093374 GCAGCTTTTGGGTGGGGGTCAGG + Intergenic
933203895 2:79482892-79482914 GCATCCAGTGGCTAGTGGTCAGG + Intronic
933252715 2:80046984-80047006 GCATCTAGAGGGTAGAGGTCAGG - Intronic
934503154 2:94874386-94874408 CCCTCTAGTGGGCGGTGGTCAGG - Intronic
935010862 2:99134974-99134996 GCATCTGGTGGGTGCCCCTCTGG - Intronic
935057515 2:99580505-99580527 GCATCTACTGGGTGGAGGCCAGG + Intronic
935130540 2:100257929-100257951 GCATCTGGAAGGTGGAGGGCAGG - Intergenic
935325916 2:101936421-101936443 GCATCTGGTGAGTGCCCGTCTGG + Intergenic
935438172 2:103059520-103059542 GCATCTGGTGGGTGTCCATCTGG - Intergenic
935567871 2:104629080-104629102 GCATCTGGTGGGTGTCTCTCTGG - Intergenic
935961576 2:108430204-108430226 GCATCTGGTGGGTGCCCCTCTGG + Intergenic
935978032 2:108598563-108598585 CCATCTGGGGGGTGGTGGGTGGG + Intronic
935982908 2:108644268-108644290 GCATCTGGTGGGTGCCCCTCTGG + Intronic
936135650 2:109891157-109891179 CCATCTGGGGGGTGGTGGGTGGG + Intergenic
936209047 2:110480328-110480350 CCATCTGGGGGGTGGTGGGTGGG - Intergenic
936690186 2:114877852-114877874 GCATCTAGTGGGTAGAGGCCAGG - Intronic
936989503 2:118347730-118347752 GCATCTAGTGGGTAGAAGTCAGG - Intergenic
937143216 2:119619346-119619368 GCATCTGGTGGGTGCCCCTCTGG + Intronic
937578387 2:123453604-123453626 GCAGCCTGTGGGTGGTGGTTTGG - Intergenic
937721235 2:125099518-125099540 CATTCTGGTGGGTGGTGGTGGGG - Intergenic
938144821 2:128824449-128824471 GCATCTGGCGGGTGTTCCTCTGG + Intergenic
938168062 2:129050029-129050051 GCATCTGGTGGGTGTCCCTCTGG - Intergenic
938221240 2:129569592-129569614 GCATCTGATGGGTGCTCCTCTGG + Intergenic
938254522 2:129845806-129845828 GCCTCTACTGGGTGGTGTTCTGG - Intergenic
938600878 2:132837915-132837937 ACATCTGGGTGGTGGTGTTCTGG + Intronic
939033349 2:137102150-137102172 GCATCTGGTGGGTGCCCCTCTGG + Intronic
939658331 2:144855125-144855147 GCATCTAGTGGGTGGAGGTCAGG + Intergenic
939687068 2:145213206-145213228 GCATCTGGTGGGTGCCCCTCTGG - Intergenic
939840674 2:147183155-147183177 GCATCTGGTGGGTGCCCCTCTGG + Intergenic
939942080 2:148362746-148362768 GCATCTAGTGGGTGCTACTCTGG + Intronic
940084189 2:149839495-149839517 GCATCTGGTGGGTGCCCCTCTGG - Intergenic
940557605 2:155251008-155251030 GCATCTAGTGGGTAGAGGCCAGG + Intergenic
940748134 2:157594213-157594235 GTCTCAGGTGGCTGGTGGTCAGG - Intronic
940758019 2:157705222-157705244 GCATCTGGTGGGTGCCCCTCTGG + Intergenic
941174319 2:162178440-162178462 GCATCTAGTGGGTAGAGGCCAGG - Intronic
941213214 2:162669683-162669705 GCATCTAGTGAGTAGAGGTCAGG + Intronic
941239309 2:163017002-163017024 GCATCTGGTGGGTGCCCCTCTGG - Intergenic
942019854 2:171856333-171856355 GCATCTAGTGGGTAGAGGCCAGG - Intronic
942146494 2:173032233-173032255 GCATCTGGTGGGGAGAGGCCAGG - Intronic
942199988 2:173560676-173560698 GCATCTGGTGGGTGCCCCTCTGG + Intergenic
942206881 2:173628223-173628245 GCATCCAGTGGGTGGAGGCCAGG + Intergenic
942658285 2:178237695-178237717 GTATCTGGTGGGTAGAGGCCAGG - Intronic
943001409 2:182332725-182332747 GCATCTGGTGGGTGCCCCTCTGG - Intronic
943175786 2:184472204-184472226 GCATCTGCTGTGTGCTGGTTGGG - Intergenic
943352561 2:186812621-186812643 GCATCTGGTGGGTGCCCCTCTGG + Intergenic
943702262 2:190999384-190999406 GCATCTGGTGGGTAAAAGTCGGG + Intronic
943836907 2:192525233-192525255 GCATCTGGTGGGTGCCCCTCTGG + Intergenic
944267985 2:197748995-197749017 GCATCTGGTGGGTGTCCCTCTGG + Intronic
944405228 2:199376512-199376534 GCATCTAGTGGGTAATGGACGGG + Intronic
944452884 2:199860836-199860858 GCATCTAGTGGGTAGAGGCCAGG - Intergenic
944521899 2:200579002-200579024 ACATCTAGTGGATGGAGGTCAGG - Intronic
945409268 2:209489048-209489070 GCATCTGGTGGGTGTCCATCTGG + Intronic
945409879 2:209495445-209495467 GCATCTGGTGGGTGTCCCTCTGG + Intronic
945927491 2:215820085-215820107 GCATCTGGTGGGTGCCCCTCTGG + Intergenic
946783766 2:223220818-223220840 GCATCTAGTGGGTAGAGGCCAGG + Intergenic
946790145 2:223293013-223293035 GCATCTGGTGGGCGCTCCTCTGG - Intergenic
946862697 2:224015034-224015056 GCATCTGGTAGGTGGGGGCCAGG + Intronic
947086124 2:226454679-226454701 GCATCTGGTGGGTGCCCCTCTGG + Intergenic
947105049 2:226660583-226660605 GCATCTAGTGGGTAGAGGCCAGG + Intergenic
947225769 2:227839067-227839089 GCATCTGGTGGGTGCCATTCTGG - Intergenic
947239624 2:227979663-227979685 GCATCTAGTGGGTAGAGGCCAGG + Intergenic
947339944 2:229127659-229127681 GCATCTAGTGGGTGGAGGCCGGG - Intronic
947990753 2:234485659-234485681 GCATCAGGTGGGTAGAGGCCAGG - Intergenic
948269403 2:236662757-236662779 GTATCTGGTGGGTAGAGGCCAGG + Intergenic
948538466 2:238666507-238666529 GCATCCAGTGGGTGGAGGACAGG + Intergenic
948730851 2:239962948-239962970 GGGTCTGGTGGGTGGTGTTTAGG - Intronic
1169605956 20:7319394-7319416 GCATCTGGTGGGTGCCCCTCTGG + Intergenic
1169646313 20:7813887-7813909 GCATCTGGTGGGTGCCCCTCTGG - Intergenic
1169749837 20:8980722-8980744 GCATCTAGTGGGTGGAGGTCAGG + Intergenic
1169769947 20:9189558-9189580 GCATCTAGTGGGTGGAGTCCGGG - Intronic
1170133997 20:13053153-13053175 GCATCTGGTGGGTGGCCCTCTGG + Intronic
1170314205 20:15025756-15025778 GCATCTGATGGGTAGAGGCCAGG - Intronic
1170430815 20:16274755-16274777 GCACCTGGTGGATGCTGGCCAGG + Intronic
1170989318 20:21287526-21287548 GCATGAGGTTGGTGGTGGTGTGG + Intergenic
1171433322 20:25100883-25100905 GCATCTAGTGGGTAGAGGCCAGG + Intergenic
1172186307 20:33033098-33033120 GGAGCTGGAGGGTGGTGGTTAGG + Intronic
1172415736 20:34765686-34765708 GCATCTGGTGGGTAGAAGCCAGG + Intronic
1172466962 20:35162323-35162345 GCATCTGGTGGGTGCCTCTCTGG + Intergenic
1173533177 20:43786483-43786505 GCATCTGTTGGGTAGAGGCCAGG + Intergenic
1173566925 20:44047225-44047247 GCATCTGCTGGGTAGTGGCCAGG - Intronic
1173691845 20:44966743-44966765 ACGTCTGGTGGGTGAGGGTCCGG + Intronic
1173818582 20:46006258-46006280 GCATCCAGTGGGTAGGGGTCAGG + Intergenic
1173861313 20:46285472-46285494 GCATCTAGTGGGTGGAGGGCAGG + Intronic
1173862042 20:46290364-46290386 GCATCTAGTGGGTAGAGGCCAGG + Intronic
1173948244 20:46968675-46968697 GCATCCGGTGGGTAGAAGTCAGG - Intronic
1174073514 20:47915791-47915813 GCATCTGGTGAGTAGAGGTCAGG - Intergenic
1174103241 20:48143290-48143312 GCATCTAGTGGGTAGAGGCCAGG - Intergenic
1174272511 20:49380096-49380118 ACATCTTGGGGGTGGAGGTCTGG + Intronic
1174279843 20:49431385-49431407 GCATCTTGTGGGTAGAGGCCAGG + Intronic
1174287160 20:49481882-49481904 GGATCTGGGGGCTGCTGGTCTGG - Intronic
1174288474 20:49489447-49489469 GCATCTAGTGGGTAGAGGCCAGG + Intergenic
1174288587 20:49490328-49490350 GTATCTAGTGGGTGGGGGCCGGG + Intergenic
1174324970 20:49771798-49771820 GCATCTGGTGGGTGGAGGTCAGG - Intergenic
1174423730 20:50417336-50417358 GCATCTGATGGGTGGAGGCCAGG + Intergenic
1174509859 20:51042857-51042879 CCTTGTGGTGAGTGGTGGTCAGG + Intergenic
1174588955 20:51630082-51630104 GCATCTGACGGGTGGAGGCCAGG + Intronic
1174592504 20:51657561-51657583 GCATCTGGTGGCTGGAGGACAGG - Intronic
1174646681 20:52092289-52092311 GCATCTGGTGGGTGGAGGCCAGG - Intronic
1174647784 20:52101082-52101104 GCATCTAGTGGGTGAAGGCCAGG + Intronic
1174684168 20:52437727-52437749 GCATCTGGTAGGTGGAGGTCAGG - Intergenic
1174688790 20:52481988-52482010 GCATCTAGTGGGTAGAGGCCAGG + Intergenic
1174699872 20:52597467-52597489 GCATCCAGTGGGTGGAGGCCAGG + Intergenic
1174735301 20:52960364-52960386 GCATCTAGTGGGTGGAGACCAGG - Intergenic
1174828067 20:53787061-53787083 GCATCTAGTGGGTAGAGGCCAGG - Intergenic
1174840733 20:53899211-53899233 GCACATGGTGGGTGGTGTTTTGG + Intergenic
1174912619 20:54623201-54623223 GCATCTGGTGGATAGAGGCCAGG + Intronic
1175041036 20:56050652-56050674 GCATCTGGTGGGTGCCCCTCTGG + Intergenic
1175050643 20:56152293-56152315 GCATCTGGCAGGTGGAGGCCAGG - Intergenic
1175052433 20:56167715-56167737 GCATCTAGTGGGCAGTGGCCAGG + Intergenic
1175057146 20:56208796-56208818 GCATCTAGTGGGTGGAGGCCAGG + Intergenic
1175091883 20:56511677-56511699 GCATCTTGTGGGTAGAGGCCAGG - Intronic
1175147862 20:56910370-56910392 CCATCTGCTTTGTGGTGGTCAGG + Intergenic
1175158410 20:56990023-56990045 GCATCTTGTGGGTAGAGGCCAGG - Intergenic
1175228749 20:57460534-57460556 GCATCGGGTGGGTGGTTGCCTGG + Intergenic
1175229941 20:57467364-57467386 GCATCTAGTGGGTAGAGGCCAGG + Intergenic
1175306155 20:57977051-57977073 GCATCTAGTGGGTAGAGGCCAGG - Intergenic
1175340150 20:58223756-58223778 GCATCTAGTGGGTAGAGGCCGGG - Intronic
1175736264 20:61389709-61389731 GCACCTGGTGGGTGGGGGCTGGG + Intronic
1176127086 20:63480461-63480483 GCATCCAGTGGGTGGAGGCCAGG + Intergenic
1176237245 20:64059324-64059346 GGAGCTGGTGGGGGGCGGTCGGG - Intronic
1176294857 21:5065980-5066002 GCACCTGGAGGGTGGAGGCCAGG - Intergenic
1177129746 21:17241231-17241253 GCATCTGGTGGGTGCCCCTCTGG + Intergenic
1177817549 21:25993835-25993857 GCATTTAGTGGGTAGGGGTCAGG + Intronic
1178766965 21:35463458-35463480 GCATCTGGTGGGTGGAGGCCAGG + Intronic
1178864357 21:36316053-36316075 GCATCTGGTGGGTGCCCCTCTGG - Intergenic
1178882581 21:36461049-36461071 GCAGCTGGTGGCTGGTAGGCAGG + Exonic
1179036840 21:37765458-37765480 GCATCTAGAGGGTGGAGGCCAGG + Intronic
1179117965 21:38511835-38511857 GCATCTAGTGGGTAGAGGCCAGG - Intronic
1179167261 21:38944686-38944708 ACATCTGGTGAGTGGAGGCCAGG + Intergenic
1179191610 21:39126771-39126793 GCAGCTGGTGGGTAGAGGCCAGG + Intergenic
1179282799 21:39949503-39949525 GCATCTAGCGGGTGGAGGCCAGG + Intergenic
1179342042 21:40521197-40521219 ACATCTAGTGGGTGGAGGCCAGG + Intronic
1179822694 21:43945911-43945933 GCACCTGGTGGGGGCTGGACAGG + Intronic
1179862193 21:44196146-44196168 GCACCTGGAGGGTGGAGGCCGGG + Intergenic
1180041742 21:45283720-45283742 GCAGCTGGCGGGGGGTGGTGTGG + Intronic
1180293429 22:10863415-10863437 GTACCTGGTGGGGGGGGGTCGGG - Intergenic
1180596320 22:16975769-16975791 GCATCTGGCAGGTGCTGCTCTGG + Intronic
1180709083 22:17827589-17827611 GCAGCAGGCGGGTGGTGCTCGGG + Intronic
1180963830 22:19775588-19775610 GCATCTGGTGGGTGGAGGTGGGG + Intronic
1181166915 22:20988866-20988888 ACGCCAGGTGGGTGGTGGTCCGG + Exonic
1181358624 22:22318233-22318255 GCACCTGGTGGGAGGTGGTTGGG - Intergenic
1182009745 22:26990421-26990443 GGCTCTGGTGGGTGGTGGTGGGG + Intergenic
1182114529 22:27747978-27748000 GCATCTAGTGGGTGGAGGCCAGG + Intergenic
1182168314 22:28199747-28199769 GCATCTAGTGGGTAGAGGTCAGG - Intronic
1182227323 22:28809108-28809130 GCATCTGGTGGGCAGAGGCCAGG - Intergenic
1182886168 22:33775894-33775916 GCATCGGGTGGGTCAAGGTCAGG + Intronic
1182972215 22:34589429-34589451 GCATCAGTTGGGTGGTGATTGGG - Intergenic
1183080807 22:35454862-35454884 GCATCTAGTGGGTGGAGACCAGG - Intergenic
1183096340 22:35554397-35554419 TCATCTGGTGGGTGGAGGCCAGG + Intergenic
1183196519 22:36357475-36357497 GCATCTAGTGGGTAGAGGCCAGG - Intronic
1183386110 22:37515700-37515722 GCATCTGGTGTGTAGAGGCCAGG - Intronic
1183876094 22:40783317-40783339 GCATCTAGTGGGTAGAGGCCAGG - Intronic
1184032815 22:41904907-41904929 GCAGCTGGTGGGTGCGGGTGGGG - Exonic
1184168656 22:42745534-42745556 TCCCCTGGTGGGTGGTGGACAGG - Intergenic
1184240295 22:43208298-43208320 GCAGGTGCTGGGTGGTGGACTGG - Intronic
1184727942 22:46357206-46357228 GCATCTGCTGGCTGGTGGGGTGG + Exonic
1184751908 22:46491118-46491140 GCATCTGGTAGGTGGAGGTGGGG - Intronic
1185039942 22:48498706-48498728 GCATCAAGTGGGGGGTGGCCGGG - Intronic
1185200574 22:49501620-49501642 GCATCTAGTGGGTGGAGGCCAGG - Intronic
949355565 3:3177043-3177065 GCATCTAGTGGGTAGAGGCCAGG + Intronic
949434438 3:4013258-4013280 GCATGAGGTGAGTGGTGGGCAGG - Intronic
949594508 3:5530356-5530378 GCATCTGGTGGGTGCCGCTCTGG - Intergenic
949640358 3:6029685-6029707 GCATCTGGTGGGTGCCCCTCTGG - Intergenic
949952127 3:9238042-9238064 GCATCTAGTGGGTACAGGTCAGG + Intronic
950321567 3:12059561-12059583 GGATCTGCTTGGTGGAGGTCTGG + Intronic
950500516 3:13360578-13360600 GCTTGTGGGGGCTGGTGGTCAGG + Intronic
950786191 3:15437903-15437925 GCATCTAGTGGGTAGACGTCAGG - Intronic
950854282 3:16091075-16091097 TCATCTGAAGGGTGGTGGTCTGG - Intergenic
951011487 3:17686821-17686843 ACATCTAGTGGGTAGAGGTCAGG + Intronic
951011730 3:17689805-17689827 GCATCTGGTGAGTAGTGGCCAGG + Intronic
951061064 3:18207959-18207981 GCATCTAGTGGGTAGAGGCCAGG + Intronic
951198099 3:19846766-19846788 GCATCTGGTGGGTGCCCCTCTGG - Intergenic
951237633 3:20254064-20254086 GCATCTGGTGGGTGCCCCTCTGG - Intergenic
951551257 3:23877504-23877526 GCATCTGGTGGATAGAGGCCAGG - Intronic
951645262 3:24882958-24882980 TCTTCTGATGGGTGGTGGTGAGG + Intergenic
951741768 3:25932245-25932267 GCATCTGGTGGGTGCCCCTCTGG + Intergenic
952098537 3:29984792-29984814 GCATCTGGTGGGTGCCCCTCTGG - Intronic
952161167 3:30694862-30694884 GCATCTAGTGGGTGGAGGCGAGG - Intergenic
952291690 3:32022969-32022991 GGATCTGTTTGGTGGAGGTCTGG + Intronic
952322656 3:32292734-32292756 GCATCTAGTAGGTAGAGGTCAGG - Intronic
952399765 3:32952593-32952615 GCATTGGGTGTGTGGTGGTGGGG + Intronic
952560295 3:34584840-34584862 GCATCTAGTGGGTAAAGGTCTGG - Intergenic
952674827 3:36015355-36015377 GCATCTAATGGGTAGAGGTCAGG - Intergenic
952766029 3:36955183-36955205 GCATCTGTTAGGTGGTGGCCAGG + Intergenic
952877081 3:37955151-37955173 GCATCTGGTGAGTAGAGGCCAGG + Intronic
953437015 3:42885735-42885757 TCAGCTGGTGTGTGGTGGCCTGG - Intronic
953555154 3:43939824-43939846 GCATCTGGTGGGTGCCCCTCTGG - Intergenic
953620155 3:44526028-44526050 GAATCTTGTAGGTGGTGCTCAGG + Intergenic
953841589 3:46394169-46394191 GCATCTAGTGGGTGAAGGTCAGG + Intergenic
953895001 3:46790704-46790726 GCATCTGGTGGGTGCCCCTCTGG + Intronic
954212996 3:49108833-49108855 GCATCTGGTGGGAGAGGGTGGGG - Exonic
954265430 3:49467597-49467619 GGTTCTGGTGGGAGGTGGTTAGG + Intergenic
954392765 3:50276078-50276100 GAACTTGGTGGGGGGTGGTCAGG - Intronic
954490538 3:50900855-50900877 GCATCTGGTGGGTGCCCCTCTGG - Intronic
954508111 3:51096987-51097009 GCATCTGGTGGGTGCCCCTCTGG - Intronic
954525035 3:51262174-51262196 GCATCTGGTGGGTGCCCCTCTGG + Intronic
954531169 3:51321086-51321108 GCATCTGGTGGGTGCCCTTCTGG + Intronic
954543862 3:51416186-51416208 GCATCTTGTAGGTGGTAGTTAGG - Intronic
954950620 3:54469186-54469208 GCATCTGGTGGGTGCCCCTCTGG + Intronic
954998636 3:54905698-54905720 GCATCTAGTGGGTAGAGGTCAGG + Intronic
955057173 3:55465171-55465193 GCATCTAGTGGGTAGAGGCCAGG + Intergenic
955138605 3:56246317-56246339 GCAGCTTGTGGGTGGAGGCCAGG - Intronic
955224486 3:57049808-57049830 GCACCTAGTGGGTGCTGGGCAGG - Intronic
955329167 3:58032702-58032724 CCATCTAGTGGGATGTGGTCTGG + Intronic
955404713 3:58618775-58618797 GCACCTGGAGGGTGGTGTTGGGG + Intronic
955582395 3:60438340-60438362 GCATGTTCTGGGTGGTCGTCTGG - Intronic
955675879 3:61448599-61448621 GCATCTAGTGGGTGGAGGCCAGG + Intergenic
955735837 3:62037422-62037444 GCATCTGTTGGCTAGAGGTCCGG - Intronic
955882116 3:63558158-63558180 ACATCTGGTGGCTTGTGGTGAGG - Intronic
955986946 3:64583571-64583593 GCATCTAGTGGGTAGAGGCCAGG - Intronic
956033276 3:65062486-65062508 GCATCTAGAGGGTGGAGGCCAGG - Intergenic
956164537 3:66386428-66386450 GCATCTGGTTGGTGGGGCTGAGG - Intronic
956224975 3:66947343-66947365 GCATCTGGTGGGCAGAGGCCAGG - Intergenic
956243491 3:67155030-67155052 GCATCTGGTGGGTGCCCCTCTGG + Intergenic
956338744 3:68195575-68195597 GCATCTGGTGGGTGGAGACCAGG + Intronic
956375870 3:68613190-68613212 GCATCTAGTGGGTAGAGGCCAGG - Intergenic
956381983 3:68674088-68674110 GCATCTGGTGGGTGGAAATCAGG + Intergenic
956387513 3:68735908-68735930 GCATCTTGTGGGTAGAGGCCAGG - Intronic
956445792 3:69324536-69324558 ACATCTAGTGGGTAGAGGTCAGG - Intronic
956530850 3:70216859-70216881 GCATTTTGTGGGTGGAGGCCAGG + Intergenic
956588595 3:70889479-70889501 GCATCTGGTGGGTAGGGACCAGG - Intergenic
956661092 3:71598578-71598600 GCATCTGGTGGGTAGTGGCCAGG + Intergenic
956726602 3:72161795-72161817 GCCTCTGGTGGGTAGAGGTCAGG - Intergenic
956876594 3:73469976-73469998 GCATCTAGTGGGTAGAGGCCAGG - Intronic
956985469 3:74694154-74694176 GCATCTAGTGGGTAGAGGCCAGG + Intergenic
957953989 3:87160439-87160461 GCATCTAGTGGGTAGAGGCCAGG + Intergenic
958261182 3:91383135-91383157 GCATCTGGTGGGTGCCCCTCTGG - Intergenic
958450573 3:94267808-94267830 GCATTTGGTGGGTAGAGGTCAGG + Intergenic
958694487 3:97510568-97510590 GCATCTGGTGGGTGCCCCTCTGG - Intronic
958970979 3:100609939-100609961 GCATCTGGAGGATTGTGATCAGG + Exonic
959025736 3:101237476-101237498 GCATCTGGTGGGTGCCCCTCTGG + Intronic
959638291 3:108601298-108601320 GCATCTGGTGGATGGAGGCTAGG + Intronic
959842952 3:110999363-110999385 GCATCTGGTGGGTGCCCCTCTGG + Intergenic
960177369 3:114532748-114532770 GCATCTGGTGGGTGCCCCTCTGG + Intronic
960768724 3:121167941-121167963 GCATCTGGTGGGTGCCCCTCTGG + Intronic
961238866 3:125392545-125392567 GCATCTAGTGGGTGGAGGCCAGG + Intergenic
961608574 3:128117400-128117422 GCATCTAGTGGGTGGAGGCCAGG - Intronic
961628396 3:128279357-128279379 GCATCTAGTGGGTAGAGGCCAGG - Intronic
961661560 3:128471284-128471306 GCATCTCCTGGGTGGAGGCCAGG + Intergenic
961998160 3:131268651-131268673 GCATCTGGTGGGTGCCCTTCTGG - Intronic
962156942 3:132957471-132957493 GCATCTGGTGGGTGTCCCTCTGG + Intergenic
962181024 3:133206682-133206704 GCATCTGGTGGGTGCCCCTCTGG - Intronic
962392759 3:134986562-134986584 GCATCTGGAGGATGGAGGCCTGG + Intronic
962446750 3:135472689-135472711 GCATTTGGTGGGGGGTGGAGTGG + Intergenic
963536025 3:146529377-146529399 GCATCTGGTGGGTAGAGGCCAGG + Intronic
963982275 3:151552040-151552062 GGATCTGGTGGGAGGTGATTGGG + Intergenic
964264234 3:154875729-154875751 GCATCTGGTGGGTGTCCCTCTGG + Intergenic
964609490 3:158596100-158596122 GCATCTAGTGGGTGGAGGTCAGG - Intronic
965751287 3:171977310-171977332 GCATTTAGTGGGTGAAGGTCAGG + Intergenic
966291276 3:178361868-178361890 GCATCTGGTGGGTGCCCCTCTGG + Intergenic
966309509 3:178577125-178577147 GCATCTGGTGGGTGCCTCTCTGG + Intronic
966460962 3:180175864-180175886 GCATCTCGTGGGTAGAGGCCAGG - Intergenic
966637828 3:182156087-182156109 GCATCTGGTGGGTGCCCCTCTGG - Intergenic
966742916 3:183250693-183250715 GCGTGTGGTGGGAGGTGGCCGGG + Intronic
966906326 3:184528468-184528490 GCATGGGGTGGGTGATGGTGAGG + Intronic
967008650 3:185409918-185409940 GGATGTGGTGGGTGGTGGGTGGG + Intronic
967809329 3:193743761-193743783 GCATGTAGTGGGTGGAGGCCAGG + Intergenic
968890465 4:3366087-3366109 TCATCTGGGGGGTGCTGGCCTGG + Intronic
969004507 4:4008440-4008462 GCATCTAGTGGGTAGAGGCCAGG + Intergenic
969249708 4:5958988-5959010 GCATCTGGTGGGTAGAGGCCAGG - Exonic
969532571 4:7737998-7738020 GCATGTGGAGGGAGGTGGCCAGG + Intronic
969594614 4:8142033-8142055 GCAGCTGGAGGGAGGTGGGCTGG - Intronic
969605020 4:8198047-8198069 GCATCCAGTGGGTGGAGGCCAGG + Intronic
969648050 4:8444985-8445007 GCATCTAGTGGGTAGGGGCCAGG + Intronic
970062606 4:12051522-12051544 GCATCTGGTGGGATGTGTTTTGG + Intergenic
970569152 4:17362666-17362688 GCATCTAGTGGGTGGAGGCCAGG - Intergenic
970685320 4:18560178-18560200 GCATCTGGTGGGTGCCACTCTGG + Intergenic
970716986 4:18937890-18937912 GCATCTGGCGGGTGGAGGCCAGG - Intergenic
971363125 4:25954944-25954966 GCATCCAGTGGGTGGAGGCCAGG - Intergenic
971679120 4:29673903-29673925 GCATCTGGTGGGTGTCCATCTGG + Intergenic
971753113 4:30676552-30676574 ACATCTGGTGAGTAGTGGCCAGG - Intergenic
972144010 4:35998758-35998780 GGATCTGGTGGGAGGTGTTTGGG - Intronic
972587447 4:40450786-40450808 GCATCTAGTGGGTAGAGGACAGG - Intronic
973266933 4:48220363-48220385 GGACCTGGTGGGAGGTGGTTTGG + Intronic
973273090 4:48280674-48280696 GCATCTGGTGGGTGTCCCTCTGG + Intergenic
973660997 4:53105954-53105976 GCATCTGGTGGGTGCCCCTCTGG + Intronic
973741376 4:53922510-53922532 GCATCTAGTGGGTAGAGGCCAGG + Intronic
973837561 4:54825460-54825482 GCATCTGGTGGGTGCCCCTCTGG + Intergenic
974942129 4:68482262-68482284 GGACCTGGTGGGAGGTGTTCAGG - Intronic
974943907 4:68503698-68503720 ACATCTGGTGGGTGCTCCTCTGG + Intergenic
975235386 4:71989558-71989580 GCATCTAGTGGGTAGAGGCCAGG + Intergenic
975448211 4:74492834-74492856 GGATCTGGTGGGAGGTGTTTGGG + Intergenic
975513780 4:75222073-75222095 GCATCTGGTGGGTGCCCTTCTGG + Intergenic
975518143 4:75269360-75269382 GCATCTGGCGGGTGCTCCTCTGG + Intergenic
976215448 4:82711356-82711378 GCATCTAGTGGGTGGAAGCCAGG + Intronic
976264284 4:83175402-83175424 GCATCTAGTGGGTAGAGGCCAGG + Intergenic
976363138 4:84203375-84203397 GCATCTGGTGGGTGCCCCTCTGG + Intergenic
976568332 4:86578208-86578230 GCATCTAGTGGGTAGAGGCCAGG + Intronic
976669584 4:87636930-87636952 GCATCTGGTGGGTGCCCCTCTGG + Intergenic
976809860 4:89089458-89089480 GCATCTGGTGGGTGCCTGTCTGG - Intronic
976852806 4:89567967-89567989 GCATCTGGTGGGTGCCCCTCTGG - Intergenic
977564084 4:98563861-98563883 GCATCTAGTGGGTAGAGGTTGGG + Intronic
977631394 4:99247588-99247610 GCATCTGGTGGGTGTCCTTCTGG - Intergenic
977671476 4:99699830-99699852 GCATCTGGTGGGTGCCCCTCTGG + Intergenic
977675293 4:99740585-99740607 ACATCTGGTGGGAGGTAGGCTGG + Intergenic
977761188 4:100738984-100739006 GCATCTAGTGGGTAGAGGCCAGG + Intronic
977793016 4:101129506-101129528 GCATCTGGTGGGTGCCCCTCTGG + Intronic
978552415 4:109941576-109941598 GCATCTAGTGGGTAGAGGCCTGG + Intronic
978906548 4:114012542-114012564 GCATCTGGTGGGTGCCCCTCTGG - Intergenic
979417539 4:120461418-120461440 GCATCTGGTGGGTGCTCCTGTGG + Intergenic
979649944 4:123116467-123116489 GCATCCAGTGGGTAGAGGTCAGG + Intronic
980171213 4:129292322-129292344 GCATCTGGTGGGTGCCCCTCTGG - Intergenic
981273257 4:142868473-142868495 GCATCTGGTGGGTGACCCTCTGG + Intergenic
981411336 4:144435689-144435711 GCATCTGGTGGGTGCCCCTCTGG + Intergenic
981779514 4:148411130-148411152 GCCAGTGGTGGGTGGTGGGCGGG - Intronic
981781698 4:148438226-148438248 GCATCTAGTGGGTAGGGGTTAGG - Intronic
981854964 4:149278553-149278575 GCTTCTTGTGGGTGGTGATTTGG + Intergenic
982216974 4:153091040-153091062 GCTTCCGGTGGGTTCTGGTCTGG - Intergenic
982304855 4:153920153-153920175 GCATCTGGTGGATCGAGGACAGG + Intergenic
983047396 4:163004100-163004122 GCATCTGGTGGGTGCCTCTCTGG - Intergenic
983179534 4:164631202-164631224 GCATCTGGTGGGTGTCCCTCTGG + Intergenic
983543380 4:168936040-168936062 GCATCTGGTGGGTGCCCCTCTGG + Intronic
983949366 4:173621949-173621971 GCATCTGGTGGGTGCTCCTCTGG - Intergenic
984525968 4:180860116-180860138 GCATCTGGTGGGTGTCCCTCTGG - Intergenic
984706620 4:182851773-182851795 GGATCTGTTTGGTGGGGGTCTGG + Intergenic
985196501 4:187435921-187435943 TCATTTGGTGGGTGGGGGTGGGG + Intergenic
986110445 5:4710406-4710428 GCATCTGGTGGGTGCCCCTCTGG + Intergenic
986188365 5:5467346-5467368 GCAGTTGGTGGGTGGTGGGACGG + Intronic
986567452 5:9128892-9128914 GCATCCAGTGGGTGGAGGCCAGG - Intronic
986617259 5:9631051-9631073 GTATCTGGTGGGTAGAGGACAGG - Intronic
986738111 5:10682464-10682486 GAAGCTGGTGGGTGCTGGCCTGG - Intronic
987149221 5:15021873-15021895 GCATTTAGTGGGTAGAGGTCAGG + Intergenic
987204947 5:15615338-15615360 GCATCTAGTGGGTGGAGGACAGG - Intronic
987484295 5:18504158-18504180 GCATGTTCTGGGTGGTGTTCTGG - Intergenic
988371649 5:30377095-30377117 GCATATGTAGGGTGGTGGTGTGG + Intergenic
988618299 5:32795768-32795790 GCATCTGGTGGGTGCCCCTCAGG + Intergenic
988816774 5:34841941-34841963 GCATCTAGTGGATGGTGGCCAGG - Intronic
988958997 5:36350320-36350342 GCATCTAGTGGGTAGAGGACAGG - Intergenic
988963671 5:36393810-36393832 GCATCTAGTGGGTAGAGGCCAGG - Intergenic
989194244 5:38700396-38700418 GCATCTGGTGGGTGCCCCTCTGG + Intergenic
989320634 5:40130431-40130453 GCATCTGGTGGGTGCCCCTCTGG - Intergenic
989545558 5:42668412-42668434 GCATCTAGTGGGTTGAGGCCAGG - Intronic
989683583 5:44058749-44058771 GCATGTGTTGTGTGGTGGTAAGG + Intergenic
989687531 5:44107915-44107937 GCATCTGGTGGGTGCCCCTCTGG - Intergenic
989761430 5:45021092-45021114 GCATCCAGTGGGTAGAGGTCAGG - Intergenic
989958963 5:50387785-50387807 GCATCTGGTGGGTGCCCCTCTGG + Intergenic
990166867 5:53004076-53004098 ACATCTAGTGGGTGGAGGACAGG - Intronic
990183687 5:53190712-53190734 GCATCTGGTGGGTGACCCTCTGG - Intergenic
990205522 5:53424899-53424921 GCATCTAGTGGGTAGAGGTCAGG + Intergenic
990249951 5:53903424-53903446 GCATCTAGTGGGTAGAGGCCAGG + Intronic
990373180 5:55141860-55141882 GCATCTTGTGGGTGAAGGCCTGG - Intronic
990837887 5:60042555-60042577 GCATCTGGTGGGTGCCCCTCTGG + Intronic
991046701 5:62230656-62230678 GCATCTGGTGGGTGCCCCTCTGG - Intergenic
991161462 5:63508027-63508049 GCATCTGGTGGGTGCCCCTCTGG + Intergenic
991223653 5:64243849-64243871 GCATCTGGTGGGTGCCCCTCTGG + Intronic
991242413 5:64474815-64474837 GCATCTGGTGGGTGCCCCTCTGG + Intergenic
992280417 5:75169855-75169877 TCATCTGGTGGGTTGAGGCCAGG - Intronic
992350230 5:75921022-75921044 GCATCAGGTGGGTGGTGATTAGG - Intergenic
992481096 5:77153081-77153103 GCATCTGGTGAGTGGAGGCCAGG + Intergenic
992735280 5:79713221-79713243 GCATCTGGTGGATGGGGGCCAGG + Intronic
993165976 5:84355666-84355688 GCATCTGGTGGGTGGCCCTCTGG - Intronic
993519092 5:88876899-88876921 GCATCATGAGCGTGGTGGTCTGG - Intronic
994313787 5:98308421-98308443 GCATCTGGTAGGTAGAGGCCAGG - Intergenic
995111924 5:108437958-108437980 GCATCTGGCAGGTGCTCGTCTGG + Intergenic
995326138 5:110892434-110892456 GCATCTGGTGGGTGCCCCTCTGG - Intergenic
995612444 5:113924365-113924387 GCATCTGGTGGGTGCCCCTCTGG + Intergenic
997352608 5:133241728-133241750 GCAGCAGGTGTGAGGTGGTCTGG - Intronic
997680007 5:135743410-135743432 GCATCTGATGGGTAGAGGCCAGG + Intergenic
997800174 5:136853133-136853155 GCATCTGGTGGGTGCCCCTCTGG - Intergenic
997816036 5:137018126-137018148 GCATCTTGTGGGTAGAGGCCAGG + Intronic
998194477 5:140055685-140055707 GAATCTGATGGGTGGGAGTCTGG + Intergenic
998237274 5:140408997-140409019 GCATCTAGTGGGTAGAGGCCAGG - Intronic
998509762 5:142701835-142701857 GCATCTAGTGAGTAGAGGTCAGG + Intergenic
998768295 5:145512744-145512766 GCATCTGGTGGGTGCCCCTCTGG + Intronic
999011139 5:148042099-148042121 GGATCTGGTGGATAGTGGCCAGG - Intronic
999051903 5:148531950-148531972 GCATCCAGTGGGTAGAGGTCAGG + Intronic
999289813 5:150416990-150417012 GGATCTGTTTGGTGGGGGTCTGG - Intergenic
999488639 5:152026387-152026409 GCATCTGGTGGGTGCCCCTCTGG - Intergenic
999688394 5:154122915-154122937 GCATCTGGTGGGTGCCCCTCTGG + Intronic
999917492 5:156279008-156279030 GCATCTAGTGGGTAGAGGCCAGG + Intronic
999988334 5:157025548-157025570 GCATCTAGTGGGTGGAGGCCAGG + Intergenic
1000121816 5:158204751-158204773 GCATCTAGTGGGTAGAGGTTAGG + Intergenic
1000304227 5:159981280-159981302 GCATCTAGTAGGTAGAGGTCAGG - Intergenic
1000376049 5:160583451-160583473 GCATCTGGTGGGTGCCCCTCTGG - Intronic
1000599878 5:163259714-163259736 GCATCTAGTGGGTAGAGGCCAGG + Intergenic
1000798294 5:165692793-165692815 GCATCTGGTGGGTGTCCCTCTGG - Intergenic
1000862961 5:166478532-166478554 GCATCTAGTGGGTAGAGGCCAGG - Intergenic
1000996014 5:167960074-167960096 GCATCTGGTGGGTAGCCCTCTGG - Intronic
1001017966 5:168158604-168158626 GCATCTTGTGGGTAGAGGCCAGG - Intronic
1001221929 5:169907843-169907865 GCATCTAGTGGGTAGAGGGCAGG + Intronic
1001288305 5:170439269-170439291 GCATCTGGTGGCATGGGGTCAGG - Intronic
1001435963 5:171699642-171699664 GCATCTAGAGGGTAGAGGTCAGG - Intergenic
1001540568 5:172534796-172534818 GCATCTGGTGGGTGGCCAGCTGG + Intergenic
1002197858 5:177510911-177510933 GCATCTGGTGAGAGGTAGGCAGG - Intronic
1002445411 5:179287368-179287390 ACAGCCGGTGGGTGGTGGACGGG + Intronic
1002455274 5:179342721-179342743 GGATTGGGTGTGTGGTGGTCAGG - Intronic
1002629857 5:180565039-180565061 GCGTCTGGTGGATGGAGGCCAGG + Intronic
1002749804 6:97176-97198 GCATCTGGTGGGTGCCCCTCTGG + Intergenic
1003079177 6:3007200-3007222 GCATCTGGTGGGCAGAGGCCAGG - Intronic
1003228724 6:4229765-4229787 GCATCTGGTGGGTGCCCCTCTGG + Intergenic
1003236740 6:4301696-4301718 GGATCTGGAGGCTGGTGGGCGGG - Intergenic
1003318393 6:5031534-5031556 GCATCTAGTGGGTGGAGGCCAGG + Intergenic
1003464736 6:6368077-6368099 GCATCTGGCAGGTGGAGGCCAGG - Intergenic
1003491025 6:6621599-6621621 GCATCTGGTGGGTAGAGACCAGG + Intronic
1003513638 6:6801670-6801692 GCTGCTGGTGAGGGGTGGTCAGG - Intergenic
1004142385 6:13030962-13030984 GCATCTAGTGAGTGGAGGCCAGG - Intronic
1004162048 6:13222766-13222788 GCATCTGGTGGGCAGAGGCCAGG + Intronic
1004581731 6:16961009-16961031 GCATCTGGCGAGTGGAGGCCAGG - Intergenic
1004777649 6:18866020-18866042 GCATCTCGTGGGTAGAGGCCAGG - Intergenic
1005273857 6:24195647-24195669 GCATCTAGAAGGTGGTGGCCAGG - Intronic
1005343533 6:24866410-24866432 GCATCTAGTGGGTAGAGGCCAGG + Intronic
1005992674 6:30913323-30913345 GGATCTGGTCGGTGATGGTGGGG - Exonic
1006276575 6:33009168-33009190 GCATCTGTTGGGTGGAGGTTTGG + Intronic
1006331471 6:33394087-33394109 GCATCTAGTGGGTAGAGGGCAGG + Intronic
1006638453 6:35476202-35476224 GGATCTGGGGGTTGGGGGTCTGG - Intronic
1006715832 6:36119711-36119733 GCATCTAGTGGGTAGAGGCCAGG + Intergenic
1007082847 6:39120893-39120915 GCAACTAGTGGGTGGTGGCCAGG - Intergenic
1007172099 6:39871162-39871184 GCATCTAGTGGGTGGAGGCTGGG + Intronic
1007195519 6:40056665-40056687 GCATCTGGTGGGTGCCCCTCTGG - Intergenic
1007237057 6:40398194-40398216 GCATCTGGTGGGTGGAGCCCAGG - Intronic
1007325717 6:41058120-41058142 GGTGGTGGTGGGTGGTGGTCAGG - Intronic
1007512281 6:42382822-42382844 GCATGTAGTGGGTGGAGGCCAGG - Intronic
1007819925 6:44553664-44553686 GCATCTGGTGGGTAGAGGCCAGG + Intergenic
1007832699 6:44650938-44650960 GCATCTGGTAGGTGGAGGTCAGG + Intergenic
1008034266 6:46729748-46729770 GCATCTAGTGGGTAGAGGCCAGG - Intronic
1008113589 6:47520595-47520617 GCCTCTGGTGGGTGGTGGTTGGG + Intronic
1008114109 6:47527635-47527657 GCATCTGGTATGTGGTGATTTGG + Intronic
1008145228 6:47883746-47883768 GCATCTAGTGGGTAGTGGAATGG - Intronic
1008158634 6:48049206-48049228 GCATCTAGAGGGTGGAGGCCAGG + Intronic
1008348764 6:50462682-50462704 GCATCGGGTGGGTAGAGGCCAGG + Intergenic
1008487847 6:52054723-52054745 GCATCTGGTGGGTGGAGGCCAGG - Intronic
1008537003 6:52514027-52514049 GTATCTAGTGGGTGGAGGCCAGG - Intronic
1008719227 6:54328228-54328250 GCATCCGGTGGGTGCTGCTCTGG + Intronic
1008993982 6:57637015-57637037 GCATCTGGTGGGTGCCCCTCTGG + Intronic
1009182586 6:60536105-60536127 GCATCTGGTGGGTGCCCCTCCGG + Intergenic
1009236734 6:61133342-61133364 GCATCTGGTGGGTGCCCTTCTGG - Intergenic
1009314686 6:62203540-62203562 GCATCTTGTGGGTGGGGGAAAGG + Intronic
1009336144 6:62492782-62492804 GCATCTGGTGGGTGCCCCTCAGG + Intergenic
1009570261 6:65375143-65375165 GCATCTGGTGGGTGCCCCTCTGG + Intronic
1010039062 6:71360700-71360722 GCATCTGGCGGGTGGCCCTCTGG - Intergenic
1010276425 6:73972860-73972882 GCATCTGGTGGGTGCCCCTCTGG + Intergenic
1010402153 6:75458230-75458252 GCATCAGGTGGGTAGAGGCCAGG + Intronic
1010823394 6:80443308-80443330 GAATTTGCTGGGTGGTGGGCGGG + Intergenic
1010827456 6:80490454-80490476 GCATCTAGTGGGTAGAGGCCAGG + Intergenic
1011028073 6:82891286-82891308 GAATCTAGTGGGTAGAGGTCAGG + Intergenic
1011086569 6:83547229-83547251 GCATCTGGTGGGTGCCCCTCTGG + Intergenic
1011097306 6:83680755-83680777 GCATCTTGTGGGTGGTGGTTAGG - Intronic
1011766337 6:90623865-90623887 GCATCTGGTGGGTGCCCCTCTGG + Intergenic
1012127853 6:95453660-95453682 GCATCTGGTGGGTGCCCCTCTGG - Intergenic
1012149551 6:95730080-95730102 ACATTTGGTGGGTGGGGGGCAGG + Intergenic
1012358075 6:98340891-98340913 GCATCTAGTGGGTAGAGGCCAGG + Intergenic
1012703485 6:102493545-102493567 GCATGTTGTGGGTGGTCTTCTGG - Intergenic
1012882963 6:104813544-104813566 GCAGCTAGTGGGTAGAGGTCAGG + Intronic
1013158547 6:107519264-107519286 GCATCTAGTGGGTAGAGGCCAGG + Intronic
1013158735 6:107521026-107521048 GCATCTAGTGGGTAGAGGCCAGG - Intronic
1013292168 6:108728995-108729017 GCATCTGGTGGGTGGAAGCCAGG + Intergenic
1013625573 6:111934348-111934370 GCATCTGGTGGGTGCCCCTCTGG - Intergenic
1014413327 6:121153374-121153396 GCATCTGGTGGGTGCCCCTCTGG - Intronic
1014836473 6:126166515-126166537 GCATCTGGTGGGTGCCCCTCTGG - Intergenic
1014872547 6:126614436-126614458 GCATCTGGTGGGTGCCCCTCTGG - Intergenic
1015108995 6:129569724-129569746 GCATCTGGTGGGTGCCCCTCTGG + Intergenic
1015433144 6:133154447-133154469 GCATCTGGTGGGTGCCCCTCTGG - Intergenic
1015491127 6:133826898-133826920 GCATCTAGTGGGTAGAGGCCAGG - Intergenic
1015623313 6:135155725-135155747 GCATCTGGTGGGTGCCCCTCTGG - Intergenic
1015826343 6:137316705-137316727 GCATCTGGTGGGTAGTGACCAGG - Intergenic
1016338473 6:143034762-143034784 GCATCTGGTGGGTGCCCCTCTGG - Intergenic
1016542250 6:145178707-145178729 GCATCTGGTGGGTGCCCCTCTGG + Intergenic
1016855937 6:148670969-148670991 GCATCTGGTGGGTGCCACTCTGG - Intergenic
1016900644 6:149097398-149097420 GCATCTGTGGGGTGGAGGACTGG + Intergenic
1017197332 6:151716211-151716233 GCATCTGGTGGGTGCCCCTCTGG - Intronic
1017322718 6:153111701-153111723 GCATCTGGTGGGTGCCCCTCTGG + Intronic
1017391473 6:153944383-153944405 ACATCTGGTGAGTGGAGCTCAGG + Intergenic
1017571496 6:155749347-155749369 GCATCTGGTGGGTGCCCCTCTGG + Intergenic
1017761334 6:157572223-157572245 GGACCTAGTGGGTGGTGGCCAGG - Intronic
1017942589 6:159066160-159066182 CCTTCTGGTGGTTGGTGGTGGGG + Intergenic
1018392481 6:163350979-163351001 GTATCTGGTGGGTGGAGGCAGGG + Intergenic
1018404148 6:163459372-163459394 GCATCTAGTGGGTGGAGTCCAGG + Intronic
1018513138 6:164548705-164548727 GCATGTTCTGGGTGGTGCTCTGG - Intergenic
1018572220 6:165223770-165223792 GCATCTGGTGTGTAGAGGCCAGG - Intergenic
1018666230 6:166140971-166140993 GCATTAGGTGTGTGGTGGTGAGG - Intergenic
1018729616 6:166638774-166638796 GCATCTCGTGGGTTGAGGCCGGG + Intronic
1019157949 6:170051606-170051628 GCATCTGGTGGGCAGAGGCCAGG - Intergenic
1019238982 6:170649264-170649286 GCATCTGGTGGGTGCCCCTCTGG - Intergenic
1019682541 7:2359479-2359501 GCTTCTGCAGGGTGGTGGCCTGG + Intronic
1020367153 7:7393341-7393363 GCATCTGGTGGGTACCCGTCTGG - Intronic
1020391324 7:7661687-7661709 GCATCTGGTGGGTGCCCCTCTGG - Intronic
1020516564 7:9128431-9128453 GCATCTGGTGGGAGGGGTTTGGG + Intergenic
1020798167 7:12700988-12701010 GCTCCTGGAGGCTGGTGGTCAGG - Intergenic
1020834538 7:13132400-13132422 GGATCTGGTGGGAGGTGCTTGGG + Intergenic
1020890632 7:13873700-13873722 GCATGTTGTGGGTGGGGGGCAGG - Intergenic
1021071743 7:16249488-16249510 GCATCTGGTGGGTGCCCCTCTGG + Intronic
1021484030 7:21147281-21147303 GCATCTGGTGGGTGGCCCTCTGG + Intergenic
1021658955 7:22899105-22899127 GCATCTGGTGGTTGGTGGGGAGG + Intergenic
1021721733 7:23511032-23511054 GCATCTGGTGGGTAGAAGCCAGG - Intronic
1021793432 7:24228844-24228866 GCATCTGCTGGGTAGAGGCCAGG - Intergenic
1021910360 7:25379776-25379798 GCATATTGTGGGTGGTCCTCTGG - Intergenic
1021917970 7:25454830-25454852 GCATCTAGTGGGTGGAGGTAAGG - Intergenic
1021975365 7:26006936-26006958 GCATCTGGTGGGTAGGGGGCAGG - Intergenic
1022218648 7:28290414-28290436 GCATCTAGTGGGTAGAGGCCAGG + Intergenic
1022288378 7:28977030-28977052 ACATCTGGTAGGTGGAGGCCAGG - Intergenic
1022302130 7:29111641-29111663 GCCTGTGGTGGGATGTGGTCAGG - Intronic
1022410039 7:30132383-30132405 GCATCCAGTGGGTGGAGGCCAGG + Intergenic
1022524925 7:31030713-31030735 GCAGCTGGTGGGTAGAGGCCAGG + Intergenic
1022643882 7:32212953-32212975 TGATATGGTGGGTGCTGGTCTGG + Intronic
1022771280 7:33475548-33475570 GCATCTAGTGGGTAGAGGCCAGG - Intronic
1023091174 7:36618840-36618862 GCATCTAGTGGATAGAGGTCAGG + Intronic
1023511546 7:40959047-40959069 GCATCTGGTGGGTGCCCCTCTGG - Intergenic
1023728640 7:43169359-43169381 GCATCTGGTGGGCAGAGGCCAGG - Intronic
1023993429 7:45144463-45144485 GTATCTGGAGGGTGGGGTTCAGG + Intergenic
1024346652 7:48321186-48321208 GCATCTGGAGGCTGGAGGCCAGG + Intronic
1024929071 7:54650771-54650793 GCATCTTGTGGGTGGAGGTCAGG - Intergenic
1024968097 7:55043312-55043334 GCATCTAGTGAGTAGAGGTCAGG + Intronic
1024998436 7:55294293-55294315 GCATCTGGTGGGTGCCCCTCTGG - Intergenic
1025247397 7:57327748-57327770 GCATCTGATGGGTGGAGGCCAGG - Intergenic
1026348422 7:69494922-69494944 GCATCTGGTGGGTAGAGAACAGG - Intergenic
1026479112 7:70763388-70763410 GGATCAGGTGGGTGGGAGTCGGG + Intronic
1027263594 7:76481666-76481688 GCATCTGGTGGGTGGAGGCCAGG + Intronic
1027288585 7:76677124-76677146 TCATATGGTGGTTGGTGCTCAGG - Intergenic
1027314966 7:76979778-76979800 GCATCTGGTGGGTGGAGGCCAGG + Intergenic
1027433040 7:78134062-78134084 GCATCTAGGGGGTGGAGGCCAGG - Intronic
1028080388 7:86567937-86567959 GCATCTGGTGGGTGCCCCTCTGG + Intergenic
1028429864 7:90735191-90735213 GCATCTGGTGGGTGACCCTCTGG - Intronic
1028523719 7:91759839-91759861 GCATCTGGTGGGTGCCCCTCTGG + Intronic
1028871877 7:95779075-95779097 GCATCTAGTGGGTAGAGGTTGGG + Intronic
1028960874 7:96748924-96748946 GCGTCTAGTGGGTGGAGGCCAGG - Intergenic
1029308411 7:99639066-99639088 GCATCTGGTAGGTTGAGGCCAGG - Intergenic
1029441781 7:100590750-100590772 CCATCTGGTGGGTGGAGGCCAGG - Intronic
1029846314 7:103415513-103415535 GCATCTAGTGGGTGAAGGCCAGG + Intronic
1029854917 7:103505327-103505349 GCATCTGGTGGGTGCCCCTCTGG + Intronic
1030198515 7:106877324-106877346 GCATCTAGTGGGTAGAGGCCAGG + Intronic
1030534112 7:110744507-110744529 GCATCTGGTGGGTGCCCCTCCGG + Intronic
1030711289 7:112752916-112752938 GTATCTAGTGGGTAGAGGTCAGG + Intergenic
1030885098 7:114927028-114927050 GCATCTAGTGAGTGGAGATCAGG + Intronic
1031159844 7:118153202-118153224 GCATCTAGTAGGGGGAGGTCTGG - Intergenic
1031173249 7:118317700-118317722 GCATCTGGTGGGTGCCCTTCTGG - Intergenic
1031549816 7:123095075-123095097 GCATCTAGTGGGTAGAGGCCAGG + Intergenic
1031902627 7:127428141-127428163 GCATCTGGTGGGTGCTTCTCTGG - Intronic
1031984847 7:128157450-128157472 GCACCTGGTGGGTAGAGGCCAGG - Intergenic
1032022356 7:128415633-128415655 GCATCTAGTGGGTAGAGGCCAGG + Intergenic
1032096246 7:128939652-128939674 GCAGCTCCTGGGTGGTGGTGGGG + Intronic
1032203496 7:129840990-129841012 GCATCCGGTGGGTGAAGGCCAGG + Intronic
1032572987 7:133021026-133021048 GCATCTAGTGGATGGAGGCCAGG - Intronic
1033029997 7:137816942-137816964 GCATCTAGTGGTTAGAGGTCAGG - Intronic
1033042303 7:137929423-137929445 GCATCTAGTGGGTGGAGGCCGGG - Intronic
1033366886 7:140678673-140678695 GGGTCTGGTGAGTGGTGGTTGGG + Intronic
1033903476 7:146172305-146172327 ACATCTAGTGGGTGGAGGCCAGG + Intronic
1034314570 7:150117843-150117865 GCATCTGGTGGGTGCCCCTCTGG + Intergenic
1034689064 7:152999608-152999630 GCATCTGGTGGGTGCCCCTCTGG - Intergenic
1034792325 7:153982926-153982948 GCATCTGGTGGGTGCCCCTCTGG - Intronic
1035137374 7:156717394-156717416 GCTTAGGGTGGGTGGTGGTTTGG + Intronic
1035508788 8:157345-157367 GCATCTGGTGGGTGCCCCTCTGG + Intergenic
1035592529 8:827109-827131 GCATCTGATGGGTCATGGTGGGG + Intergenic
1035710839 8:1712640-1712662 GCATCTGGTGGGTGCTCCTCTGG + Intergenic
1036558090 8:9877349-9877371 GCATCTGGTGGGTGCACCTCTGG + Intergenic
1036680501 8:10869291-10869313 GCCTGTGGTGCATGGTGGTCAGG + Intergenic
1037147624 8:15592407-15592429 GCACCTGGTGGGAGGTGTTTGGG + Intronic
1037354717 8:18005773-18005795 GCATCTAGTGGGTAGAGGCCAGG + Intronic
1037404544 8:18527765-18527787 GAATCTGGTAGGTGGTGATGAGG + Exonic
1038562119 8:28589687-28589709 GCATCTGGGGGCTGGGGGGCAGG - Intergenic
1039315655 8:36368831-36368853 GGATTTGGTGGGGGGTGGTGTGG - Intergenic
1039344891 8:36692836-36692858 GGATCTGTTTGGTGGTGGTCTGG - Intergenic
1039621739 8:39003319-39003341 GCATCTAGTGGGTGGAGGCCAGG + Intronic
1040473778 8:47759505-47759527 GCATCTGGTGGGTGCCCCTCTGG - Intergenic
1040942960 8:52852052-52852074 GCATCTGGTGGGTGCCTCTCTGG - Intergenic
1040968730 8:53111863-53111885 GCATCTGGTGGGTGCCCCTCTGG - Intergenic
1041155143 8:54977647-54977669 GCATCTGGTGGGTGCCCCTCTGG + Intergenic
1041630488 8:60082315-60082337 GCATCTGGTGGGTGCCCCTCTGG - Intergenic
1042627089 8:70770323-70770345 GCATCTGGCGGGTGCTCCTCTGG - Intronic
1042769363 8:72362713-72362735 GCATCTGGTGGCTAGTAGTCAGG + Intergenic
1043134353 8:76502563-76502585 GCTTCTGCTGGGTGGTCGTTAGG - Intergenic
1043368197 8:79560032-79560054 GCATCTGGTGGGTGAACCTCTGG - Intergenic
1043526322 8:81100490-81100512 GCATCTGGTGGGTAGAGGCCAGG - Intronic
1044509382 8:93057879-93057901 GCATCTGGTGGGTGCCCCTCTGG - Intergenic
1045149724 8:99390640-99390662 GAATCTGGTGGCGGTTGGTCAGG - Intronic
1045151702 8:99415795-99415817 GCATCTGGTGGGTGCCCCTCTGG - Intronic
1045185092 8:99829979-99830001 GCATCTGGTGGGTGCCCCTCTGG - Intronic
1045492927 8:102684030-102684052 GCATCTAGTGGGTGGAGGCCAGG + Intergenic
1045618990 8:103952369-103952391 GCATCTGGTGGGTGCCCCTCTGG + Intronic
1046047890 8:108985942-108985964 GCATCTGGTGGGTGCCCCTCTGG - Intergenic
1046067900 8:109218393-109218415 GCATCTGGTGGGTGTCCCTCTGG - Intergenic
1046265666 8:111825949-111825971 GCATATAGTGGGTAGAGGTCAGG + Intergenic
1046343086 8:112884518-112884540 GCATCTGGTGGGTAGAAGACAGG - Intronic
1046731371 8:117729926-117729948 GCATCTAGTGGGTAGAGGCCAGG + Intergenic
1046764390 8:118054024-118054046 GCATCCAGTGGGTGGAGGCCAGG + Intronic
1046785311 8:118259412-118259434 GCATCTTGTGGGTGGAGGCTAGG + Intronic
1047191790 8:122685032-122685054 GTATCTAGTGGGTGGAGGCCGGG + Intergenic
1047298541 8:123592378-123592400 GCGTCTGGTGGGTAGAGGCCAGG + Intergenic
1047308973 8:123676459-123676481 GCCTGTGGTGGGTGGTGATGGGG - Intergenic
1047369496 8:124244924-124244946 GCATCTGGTGGGTGCCCCTCTGG - Intergenic
1047407598 8:124598364-124598386 GCATCTAGTGGGTAGAGGCCAGG - Intronic
1047569818 8:126085493-126085515 GTATCTGGTGGGTAGAGGCCAGG - Intergenic
1047602391 8:126438707-126438729 GCATCTGGTGGGTAGAAGACAGG - Intergenic
1048282573 8:133115992-133116014 GCATCTAGTGTGTGGGGGTCAGG - Intronic
1048297165 8:133222981-133223003 GCATCTAGTGGGTAGAGGCCAGG - Intronic
1048506628 8:135027492-135027514 GCATCTAGTGGGTAGAGGTCAGG + Intergenic
1048979310 8:139694627-139694649 GCATCTGGAGAGTGGGGGGCAGG - Intronic
1049038384 8:140094448-140094470 GCCTCTGGGTGGTGGTGGGCAGG - Intronic
1049209556 8:141379209-141379231 GCTTCTGGTGGGAGGCGGTGGGG - Intergenic
1049269869 8:141689192-141689214 GCATCTAGTGGGCAGAGGTCAGG - Intergenic
1049388087 8:142354352-142354374 GCTGCTGGTGGGTGGTGCTCGGG - Intronic
1050028061 9:1356409-1356431 GCATCTGATGGGTAGAGGCCTGG + Intergenic
1050623216 9:7476404-7476426 GCATCTAGTAGATGGAGGTCAGG - Intergenic
1050973830 9:11911790-11911812 GCATCTGGTGGGTGCCCCTCTGG - Intergenic
1051202907 9:14649066-14649088 GCATCTAGTGGGTGGAGGCCAGG - Intronic
1051571406 9:18563392-18563414 GCATCTGGTGGGTGCCCCTCTGG - Intronic
1051670386 9:19504452-19504474 GCATCTGGTGGGTGACCCTCTGG - Intergenic
1051786891 9:20754728-20754750 GTATCTAGTGGGTGGAGGCCAGG + Intronic
1052407530 9:28081163-28081185 GCATCTAGTGGGTAGAGGCCAGG - Intronic
1052667924 9:31518764-31518786 GCATCTGGTGGGTGCCCCTCTGG - Intergenic
1053191888 9:36078512-36078534 GCATCTGGTGAGTAGAGGCCAGG - Intronic
1053272451 9:36759713-36759735 TCAATTGGTGGGTGGGGGTCAGG - Intergenic
1053422530 9:37988524-37988546 GCATTTGCTGGAAGGTGGTCAGG - Intronic
1053608084 9:39680768-39680790 GCATCTGGTGGGTGCCCCTCTGG - Intergenic
1053865927 9:42437128-42437150 GCATCTGGTGGGTGCCCCTCTGG - Intergenic
1054245448 9:62661641-62661663 GCATCTGGTGGGTGCCCCTCTGG + Intergenic
1054559576 9:66696172-66696194 GCATCTGGTGGGTGCCCCTCTGG + Intergenic
1055113897 9:72587028-72587050 GCATCTAGTGGATAGAGGTCAGG + Intronic
1055114471 9:72591991-72592013 GCATCTAGTGGGTAGTGGTCAGG + Intronic
1055416614 9:76091084-76091106 GCAGGAGGTGGGTGGTGGGCAGG - Intronic
1055577997 9:77679111-77679133 TCATCTGGTGGGTGGATTTCTGG - Intergenic
1056176698 9:84043461-84043483 GCATCTGGTGGGTGCCCCTCTGG - Intergenic
1056379463 9:86044121-86044143 GCATCTAGTGGGTAGAGGTCAGG - Intronic
1056570248 9:87808412-87808434 TCATCTCGTGTGTGGTGGCCTGG + Intergenic
1056642901 9:88386561-88386583 GCATCTAGTGGGTGGAGGCCAGG + Intergenic
1056955193 9:91075662-91075684 GCAGCTTGTGGGTGGTGGTGGGG - Intergenic
1057177032 9:93007841-93007863 GCATCTGGTGGGTGGGGTCTGGG + Intronic
1057237960 9:93380843-93380865 GCATCTAGTGGGTAGAGGCCAGG - Intergenic
1057307332 9:93920005-93920027 GCATCTGGAGAGTGGAGGCCAGG + Intergenic
1057520149 9:95753504-95753526 GCATCTTGTAGGTGATGGCCGGG + Intergenic
1057698852 9:97348571-97348593 GGATCAGATGGGAGGTGGTCGGG + Intronic
1057734216 9:97638773-97638795 GCATCTAGTGGGTAGGGGCCAGG - Intronic
1058558963 9:106203611-106203633 GCATCTGGTGGGTGCCCCTCTGG - Intergenic
1058717916 9:107738912-107738934 GTATCTGGTGGGTTGGGGCCAGG + Intergenic
1059482579 9:114603038-114603060 GCATCTAGTGGGTAGAGGCCAGG - Intergenic
1059550561 9:115224928-115224950 GCATCTAGTGGGTGGAGGCCAGG + Intronic
1059593649 9:115692563-115692585 GCATCTGGTAGGCGGAGGCCAGG + Intergenic
1059919080 9:119137639-119137661 GCATCTAGTGGGTGGAGGCCAGG - Intergenic
1059936702 9:119319019-119319041 GCATCTGATGGGTGGAGGCCAGG + Intronic
1060032836 9:120230622-120230644 GCAATTGGTGGGTGGGGGCCAGG - Intergenic
1060112485 9:120916683-120916705 GCAGTTGGTGGGTGGGGGTGGGG - Intronic
1060315001 9:122501375-122501397 GCCTGTGGTGGGTGGTGATTGGG - Intergenic
1060654038 9:125356380-125356402 GCATCTTGTGTGTAGAGGTCAGG - Intronic
1060948852 9:127587812-127587834 GCATCTAGTGGGTGGAGGCCAGG + Intergenic
1061736216 9:132661492-132661514 GCATCTAGTGGGTAGAGGCCTGG + Intronic
1062028386 9:134350939-134350961 GCCTCTTGTGGGTGCTGGACAGG - Intronic
1062183374 9:135203082-135203104 GCATGTGGTGGGTGGGGGTGGGG - Intergenic
1062436183 9:136547551-136547573 GCTCCTGGTGGGTGGGGGTGGGG + Intergenic
1062759187 9:138329554-138329576 GCATCTGGTGGGTGCCCCTCTGG - Intergenic
1203599637 Un_KI270748v1:327-349 GCATCTGGTGGGTGCCCCTCTGG - Intergenic
1185479094 X:432971-432993 GCATCTGCTGGGTGGAGCCCAGG - Intergenic
1185512335 X:672975-672997 GCATGTGGTGGGTGGGGGGTTGG + Intergenic
1185622269 X:1457456-1457478 CCATCTGGTGGGTGGAGCCCAGG + Intergenic
1185625279 X:1476766-1476788 GGATCTGGTGGGTGGAGCCCAGG + Intronic
1185629931 X:1508356-1508378 GCATCTGGTGGGTGCAGCCCAGG + Intronic
1185633050 X:1529927-1529949 GCATCTGGTGGGTGGATCCCGGG + Intronic
1185694318 X:2183888-2183910 GCATCTAGTGGGTGGAGACCAGG + Intergenic
1185694533 X:2185511-2185533 GTATCTGGTGGGTGGAGCCCAGG + Intergenic
1185711258 X:2305196-2305218 GCGTGTTGTGGGTGGGGGTCAGG + Intronic
1185770019 X:2758687-2758709 GCATCTAGTGGGTGGAGCCCAGG + Intronic
1185781138 X:2847906-2847928 GCATCTGGTGGGCGGAGCCCAGG - Intronic
1185825965 X:3249929-3249951 GCATCTGGTGGGTGGAGCCCAGG + Intergenic
1185831450 X:3306667-3306689 GCATCTGGTGGGTGGAGCCCAGG + Intergenic
1185832351 X:3314330-3314352 GCACCTGGTGGGTGGAGTCCGGG - Intronic
1185832495 X:3315535-3315557 GTATCTGGTGGGTGGAGGCCAGG - Intronic
1185847515 X:3452230-3452252 GCATCTAGTGGGTGGAGGCCCGG + Intergenic
1185857510 X:3549820-3549842 GCATCTGGTGGGTGGAACCCAGG + Intergenic
1185859483 X:3564397-3564419 GCATTTGGTGGGTGGAGCCCAGG - Intergenic
1185859892 X:3567704-3567726 GCATCTGGTGGGTGGAGCCCAGG + Intergenic
1185861326 X:3582221-3582243 GCATCTGGTGGGTAGAGCCCAGG + Intergenic
1185871619 X:3669484-3669506 GCATCTGCTGGGTGGAGTCCAGG + Intronic
1185925066 X:4136749-4136771 GCTTCTTGTGGGTGGAGGCCAGG + Intergenic
1186109872 X:6244463-6244485 GCATCTAGTGGATGGAGGCCAGG - Intergenic
1186201866 X:7163196-7163218 GCATCTGCTGGGTGGAGCCCAGG - Intergenic
1186205212 X:7192844-7192866 GCATGTAGTGGGTGGAGGCCAGG + Intergenic
1186272194 X:7901075-7901097 GCATCTGGTGGGTAGAGGCCAGG - Intronic
1186283022 X:8014556-8014578 GCATCAAGTGGGTGGAGGCCAGG - Intergenic
1186439997 X:9577569-9577591 GCATCTGGTGAGTAGAGGCCAGG + Intronic
1186442259 X:9596492-9596514 GCATCTGGTGGGTGGAGACCAGG + Intronic
1186447402 X:9643233-9643255 GCATCTAGTGGGTAGAGGCCCGG + Intronic
1186451670 X:9679289-9679311 GCATCTAGTGGGTAGAGGCCGGG + Intronic
1186452806 X:9687570-9687592 GCATCTGGTGGGTGGAGCCCAGG - Intronic
1186486547 X:9938056-9938078 GCATCTGGTGGGTGGAGCCCAGG + Intronic
1186499950 X:10043293-10043315 GCATCGGGTGGGTGGTGGCCAGG - Intronic
1186512107 X:10137663-10137685 GCATCTGGTGGGTGGAGCCCAGG - Intronic
1186515510 X:10163854-10163876 GCATCTAGTGGATGGTGGCCAGG - Intronic
1186523057 X:10222587-10222609 GCATCTAGTGAGTAGAGGTCAGG + Intronic
1186536673 X:10357074-10357096 GCATCTAGCGGGTGGAGATCAGG + Intergenic
1186543887 X:10428771-10428793 GCATCTAGTGGGTAGAGGGCAGG - Intergenic
1186544288 X:10433049-10433071 GCATCTAGTGCGTAGTGCTCAGG + Intergenic
1186569341 X:10697839-10697861 GCATCTGGTGGGTAGAGGCTAGG - Intronic
1186584227 X:10854799-10854821 GCATCTAGTGGATAGAGGTCAGG - Intergenic
1186591639 X:10936226-10936248 GCATCTAGTGGGTAGAGGCCAGG + Intergenic
1186599718 X:11024179-11024201 GCATCTGGTGGGTGCCCTTCTGG - Intergenic
1186617572 X:11205322-11205344 GCATCTGGTAGGTGGAGACCAGG - Intronic
1186642588 X:11472195-11472217 GCATCTAGTGGGTGGAGACCAGG - Intronic
1186717665 X:12269677-12269699 GCATCTAGTGGGTGGAGATGAGG + Intronic
1186801042 X:13092609-13092631 GCATCTAGTGGGTAGAGGCCAGG + Intergenic
1186804510 X:13126646-13126668 GCATCTAGTGGGTGAAGGCCAGG - Intergenic
1186842129 X:13494829-13494851 TCATCTAGTGGGTGGAGGCCAGG + Intergenic
1186873202 X:13792492-13792514 GCATCTAGTGGGTAGAGGCCAGG + Intronic
1186884358 X:13898236-13898258 ACATCTAGTGGGTGGAGGCCAGG - Intronic
1186886824 X:13922261-13922283 GCATCTAGTGGGTGGAGGCCAGG - Intronic
1186989580 X:15052940-15052962 GCATCTTGTGGGTAGAGGTCAGG - Intergenic
1187007153 X:15243727-15243749 GCATGTAGTGGGTAGAGGTCTGG - Intronic
1187048252 X:15670738-15670760 GCATCTAGTGGGTAGAGGCCAGG + Intergenic
1187079681 X:15973555-15973577 GCATCTAGTGGGTAGAGGCCAGG + Intergenic
1187109518 X:16282423-16282445 GCATCTAGTGGGTAGAGGCCAGG + Intergenic
1187124866 X:16445560-16445582 GCATCTAGTGGGTAGAGGCCGGG + Intergenic
1187174135 X:16880736-16880758 GCATCTAGTGGGTAGAGGCCAGG + Intergenic
1187247304 X:17564314-17564336 GCATCTAGTGGGTAGAGGCCAGG - Intronic
1187273460 X:17799319-17799341 GCATCTAGTGGGTAGAGGTTAGG - Intergenic
1187280310 X:17853509-17853531 GTATCTAGTGGGTGGAGGCCAGG + Intronic
1187392823 X:18896953-18896975 GCATCTGGCGGGTAGAGGCCAGG + Intronic
1187506134 X:19879981-19880003 GCATCTACTAGGTGGAGGTCAGG - Intronic
1187529517 X:20083842-20083864 GCATCTAGTGGGTACAGGTCAGG + Intronic
1187737750 X:22322031-22322053 GCATCTAGTGGGTAGAGGCCAGG + Intergenic
1187950806 X:24468345-24468367 GCATCTAGTGGGTAGAGGCCAGG - Intronic
1188193302 X:27197746-27197768 GCATCTGGTGGGTGCCCCTCTGG + Intergenic
1188288268 X:28356036-28356058 GTATCTAGTGGGTGGAGGCCAGG + Intergenic
1188396907 X:29696152-29696174 GCATCTAGTGGGTAGAGGCCAGG - Intronic
1188715898 X:33458552-33458574 GGGTCTGGTGGGAGGTGGTTGGG - Intergenic
1189285078 X:39846385-39846407 GCATCTGGTGGGTAGAGGCCAGG - Intergenic
1189322559 X:40095740-40095762 GCGTCTGGAGGGTGGGGGTGGGG - Intronic
1189849060 X:45161094-45161116 GGATGTGATGGGTGGTGCTCAGG + Intronic
1189957211 X:46288073-46288095 ACATCTGCTGGGAGGTGGACAGG + Intergenic
1190039141 X:47055093-47055115 GCATCTAGTGGGTAGAGGCCAGG - Intronic
1190304093 X:49072700-49072722 GCCCAGGGTGGGTGGTGGTCCGG - Intronic
1190505968 X:51125985-51126007 GCATCTGGTGGGTGCCCCTCTGG + Intergenic
1191931283 X:66376023-66376045 GCATCTGGTGGGTGCCCATCTGG - Intergenic
1191974583 X:66858199-66858221 GCATCTGGTGGGTGCCCCTCTGG + Intergenic
1192064196 X:67864118-67864140 GCATCTGGTGGGTGATCCTCTGG - Intergenic
1192182651 X:68926043-68926065 GCATCTGGTGGGTAGAGGCCAGG + Intergenic
1192204701 X:69088287-69088309 GCATGAGGTGGGTGGGGGGCGGG - Intergenic
1192524627 X:71830706-71830728 GCATCTGGTGGGTGCCCTTCTGG + Intergenic
1192632391 X:72787551-72787573 GCCTCTGGTGGGTGGTGAACAGG + Intronic
1192649318 X:72933250-72933272 GCCTCTGGTGGGTGGTGAACAGG - Intronic
1193068670 X:77283588-77283610 GCATCTGGTGGGTGCCCCTCTGG + Intergenic
1193115525 X:77771863-77771885 GTATCTAGTGGGTAGAGGTCAGG + Intronic
1193458117 X:81755552-81755574 GCATCAGGTGGGTGCTCCTCTGG + Intergenic
1193793628 X:85846789-85846811 GCATCTGGTGGGTGCCTTTCTGG - Intergenic
1193839587 X:86392964-86392986 GCATCTAGTGGGTAGCAGTCAGG + Intronic
1194203048 X:90978511-90978533 GCATCTGGTGGGTGCCCCTCTGG - Intergenic
1194774185 X:97943072-97943094 GCATGTAGTGGGGGGTGGGCAGG + Intergenic
1194902514 X:99530604-99530626 GCATCAAGTGGGTAGTGTTCAGG - Intergenic
1195071263 X:101282635-101282657 GCTGCTGGTGGCTGGTGGTGGGG - Intronic
1195457214 X:105082559-105082581 GCATCTGGTGGGTGCCCCTCTGG + Intronic
1195630105 X:107046711-107046733 GCATCTAGTGGGTAGGGGCCAGG + Intergenic
1195716711 X:107825817-107825839 GCAGCCGGTGGGTGGGGCTCGGG - Intronic
1195765962 X:108297463-108297485 GCATCTAGTGGGTAGAGGACAGG - Intronic
1195810547 X:108824593-108824615 GCATCTGGTGGGTGCCCTTCTGG - Intergenic
1197142278 X:123130406-123130428 GCATCTGGTAGGTGGCCCTCTGG + Intergenic
1197350043 X:125372132-125372154 GCATCTGGTGGGTGCCCCTCTGG - Intergenic
1197847131 X:130814504-130814526 GCATCTGGTGGGTGACCCTCTGG + Intronic
1197970774 X:132112715-132112737 GGATATAGGGGGTGGTGGTCAGG - Intronic
1197992191 X:132330206-132330228 GCATCTAGTGGATAGAGGTCAGG - Intergenic
1198002184 X:132451049-132451071 GCATCTGGTGGGTGTCACTCCGG - Intronic
1198770806 X:140127823-140127845 GCAACTGTACGGTGGTGGTCTGG + Intergenic
1198913528 X:141639626-141639648 GAATCTGGTGGGGGATGATCTGG - Intronic
1198953657 X:142102248-142102270 GCATCTGGTGGATAGAGGCCAGG + Intergenic
1200017853 X:153179759-153179781 GGGGCTGGAGGGTGGTGGTCAGG - Intronic
1200254523 X:154572881-154572903 GCACCTAGCGGGCGGTGGTCAGG + Intergenic
1200263246 X:154631527-154631549 GCACCTAGCGGGCGGTGGTCAGG - Intergenic
1200548882 Y:4553937-4553959 GCATCTGGTGGGTGCCCCTCTGG - Intergenic
1200747696 Y:6916955-6916977 GCATCTGGTGGGTGGAGCCCTGG + Intronic
1200803394 Y:7407445-7407467 GCATCTGGTGGGTGCCCCTCTGG + Intergenic
1200803672 Y:7410475-7410497 GCATCTGGTGGGTAGAGCCCAGG - Intergenic
1200805263 Y:7427369-7427391 GCTTCTGGTGGGTGGAGCCCAGG - Intergenic
1201228495 Y:11840848-11840870 GCATCTAGTGGGTGAGGGTCAGG + Intergenic
1201241664 Y:11962731-11962753 GCATCTAATGGGTGAAGGTCAGG - Intergenic
1201243556 Y:11981418-11981440 GTATCTGGTGGGTGGAGCCCAGG + Intergenic
1201243693 Y:11982727-11982749 GCATCTGGTGGATGGAGTCCAGG + Intergenic
1201245139 Y:11996163-11996185 GCATCTTGTGGGTGGAGCCCAGG - Intergenic
1201288984 Y:12404066-12404088 GCATCTGGTGGGTGGAGCTCAGG - Intergenic
1201300502 Y:12500945-12500967 GCATCTAGTGGGTGGAGCCCAGG - Intergenic
1201371610 Y:13270414-13270436 GCATGTTGTGGGTGGTCCTCTGG - Intronic
1201577933 Y:15479887-15479909 GCATGTAGTGGGTGGAGGCCAGG + Intergenic
1201961857 Y:19689881-19689903 GCATCTGGTGGGTGCCCCTCTGG - Intergenic
1202044717 Y:20726801-20726823 GCATCTGGTGAGTGGAGCCCGGG - Intergenic