ID: 1101878626

View in Genome Browser
Species Human (GRCh38)
Location 12:108611426-108611448
Sequence CACGATCGTGGGCATCTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101878626_1101878634 19 Left 1101878626 12:108611426-108611448 CCCACCAGATGCCCACGATCGTG No data
Right 1101878634 12:108611468-108611490 GACATGGCCAAATGTCCCCTAGG 0: 7
1: 143
2: 493
3: 960
4: 1271
1101878626_1101878631 3 Left 1101878626 12:108611426-108611448 CCCACCAGATGCCCACGATCGTG No data
Right 1101878631 12:108611452-108611474 ACCAAACACGTCTCCAGACATGG No data
1101878626_1101878635 20 Left 1101878626 12:108611426-108611448 CCCACCAGATGCCCACGATCGTG No data
Right 1101878635 12:108611469-108611491 ACATGGCCAAATGTCCCCTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101878626 Original CRISPR CACGATCGTGGGCATCTGGT GGG (reversed) Intergenic
No off target data available for this crispr