ID: 1101878630

View in Genome Browser
Species Human (GRCh38)
Location 12:108611438-108611460
Sequence GTGTTTGGTTGTCACGATCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101878630_1101878641 26 Left 1101878630 12:108611438-108611460 CCACGATCGTGACAACCAAACAC No data
Right 1101878641 12:108611487-108611509 TAGGGAGCAAAATCATCCCCGGG No data
1101878630_1101878631 -9 Left 1101878630 12:108611438-108611460 CCACGATCGTGACAACCAAACAC No data
Right 1101878631 12:108611452-108611474 ACCAAACACGTCTCCAGACATGG No data
1101878630_1101878642 27 Left 1101878630 12:108611438-108611460 CCACGATCGTGACAACCAAACAC No data
Right 1101878642 12:108611488-108611510 AGGGAGCAAAATCATCCCCGGGG No data
1101878630_1101878640 25 Left 1101878630 12:108611438-108611460 CCACGATCGTGACAACCAAACAC No data
Right 1101878640 12:108611486-108611508 CTAGGGAGCAAAATCATCCCCGG No data
1101878630_1101878635 8 Left 1101878630 12:108611438-108611460 CCACGATCGTGACAACCAAACAC No data
Right 1101878635 12:108611469-108611491 ACATGGCCAAATGTCCCCTAGGG No data
1101878630_1101878634 7 Left 1101878630 12:108611438-108611460 CCACGATCGTGACAACCAAACAC No data
Right 1101878634 12:108611468-108611490 GACATGGCCAAATGTCCCCTAGG 0: 7
1: 143
2: 493
3: 960
4: 1271

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101878630 Original CRISPR GTGTTTGGTTGTCACGATCG TGG (reversed) Intergenic
No off target data available for this crispr