ID: 1101878631

View in Genome Browser
Species Human (GRCh38)
Location 12:108611452-108611474
Sequence ACCAAACACGTCTCCAGACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101878625_1101878631 6 Left 1101878625 12:108611423-108611445 CCACCCACCAGATGCCCACGATC No data
Right 1101878631 12:108611452-108611474 ACCAAACACGTCTCCAGACATGG No data
1101878624_1101878631 9 Left 1101878624 12:108611420-108611442 CCACCACCCACCAGATGCCCACG No data
Right 1101878631 12:108611452-108611474 ACCAAACACGTCTCCAGACATGG No data
1101878627_1101878631 2 Left 1101878627 12:108611427-108611449 CCACCAGATGCCCACGATCGTGA No data
Right 1101878631 12:108611452-108611474 ACCAAACACGTCTCCAGACATGG No data
1101878623_1101878631 14 Left 1101878623 12:108611415-108611437 CCTGACCACCACCCACCAGATGC 0: 2
1: 1
2: 44
3: 191
4: 1129
Right 1101878631 12:108611452-108611474 ACCAAACACGTCTCCAGACATGG No data
1101878626_1101878631 3 Left 1101878626 12:108611426-108611448 CCCACCAGATGCCCACGATCGTG No data
Right 1101878631 12:108611452-108611474 ACCAAACACGTCTCCAGACATGG No data
1101878629_1101878631 -8 Left 1101878629 12:108611437-108611459 CCCACGATCGTGACAACCAAACA No data
Right 1101878631 12:108611452-108611474 ACCAAACACGTCTCCAGACATGG No data
1101878622_1101878631 15 Left 1101878622 12:108611414-108611436 CCCTGACCACCACCCACCAGATG 0: 2
1: 2
2: 41
3: 220
4: 858
Right 1101878631 12:108611452-108611474 ACCAAACACGTCTCCAGACATGG No data
1101878630_1101878631 -9 Left 1101878630 12:108611438-108611460 CCACGATCGTGACAACCAAACAC No data
Right 1101878631 12:108611452-108611474 ACCAAACACGTCTCCAGACATGG No data
1101878628_1101878631 -1 Left 1101878628 12:108611430-108611452 CCAGATGCCCACGATCGTGACAA No data
Right 1101878631 12:108611452-108611474 ACCAAACACGTCTCCAGACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101878631 Original CRISPR ACCAAACACGTCTCCAGACA TGG Intergenic
No off target data available for this crispr