ID: 1101879511

View in Genome Browser
Species Human (GRCh38)
Location 12:108616854-108616876
Sequence CTGTGGAAGGCCAAGGTGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 265827
Summary {0: 8, 1: 1133, 2: 25627, 3: 79568, 4: 159491}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101879511_1101879522 19 Left 1101879511 12:108616854-108616876 CCGCCCACCTTGGCCTTCCACAG 0: 8
1: 1133
2: 25627
3: 79568
4: 159491
Right 1101879522 12:108616896-108616918 TCCTACTCACATGGCATCCCAGG No data
1101879511_1101879518 -8 Left 1101879511 12:108616854-108616876 CCGCCCACCTTGGCCTTCCACAG 0: 8
1: 1133
2: 25627
3: 79568
4: 159491
Right 1101879518 12:108616869-108616891 TTCCACAGTTCTGGGATTACAGG No data
1101879511_1101879520 10 Left 1101879511 12:108616854-108616876 CCGCCCACCTTGGCCTTCCACAG 0: 8
1: 1133
2: 25627
3: 79568
4: 159491
Right 1101879520 12:108616887-108616909 ACAGGCCTGTCCTACTCACATGG No data
1101879511_1101879524 20 Left 1101879511 12:108616854-108616876 CCGCCCACCTTGGCCTTCCACAG 0: 8
1: 1133
2: 25627
3: 79568
4: 159491
Right 1101879524 12:108616897-108616919 CCTACTCACATGGCATCCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101879511 Original CRISPR CTGTGGAAGGCCAAGGTGGG CGG (reversed) Intergenic
Too many off-targets to display for this crispr