ID: 1101879809

View in Genome Browser
Species Human (GRCh38)
Location 12:108618521-108618543
Sequence GGAGCTGAAGGCTCCACAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 274
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 248}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101879809_1101879817 14 Left 1101879809 12:108618521-108618543 CCTGCTGTGGAGCCTTCAGCTCC 0: 1
1: 0
2: 2
3: 23
4: 248
Right 1101879817 12:108618558-108618580 TCTGATCCCTCCCAAAGGGGAGG 0: 1
1: 0
2: 1
3: 10
4: 146
1101879809_1101879816 11 Left 1101879809 12:108618521-108618543 CCTGCTGTGGAGCCTTCAGCTCC 0: 1
1: 0
2: 2
3: 23
4: 248
Right 1101879816 12:108618555-108618577 TTTTCTGATCCCTCCCAAAGGGG 0: 1
1: 0
2: 0
3: 17
4: 173
1101879809_1101879814 9 Left 1101879809 12:108618521-108618543 CCTGCTGTGGAGCCTTCAGCTCC 0: 1
1: 0
2: 2
3: 23
4: 248
Right 1101879814 12:108618553-108618575 ATTTTTCTGATCCCTCCCAAAGG 0: 1
1: 0
2: 4
3: 28
4: 250
1101879809_1101879815 10 Left 1101879809 12:108618521-108618543 CCTGCTGTGGAGCCTTCAGCTCC 0: 1
1: 0
2: 2
3: 23
4: 248
Right 1101879815 12:108618554-108618576 TTTTTCTGATCCCTCCCAAAGGG 0: 1
1: 0
2: 1
3: 25
4: 188

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101879809 Original CRISPR GGAGCTGAAGGCTCCACAGC AGG (reversed) Intergenic
900168535 1:1254796-1254818 GGAGCTCCCGGCTCCTCAGCGGG - Intronic
900390450 1:2431700-2431722 GCAGCAGAAGGGTACACAGCAGG - Intronic
900525821 1:3128086-3128108 GGAGTTGATCCCTCCACAGCGGG - Intronic
900804719 1:4759907-4759929 GCAGCAGAAGGCCCCTCAGCTGG + Intronic
900810366 1:4797213-4797235 GGAGCTGCAAGCACCAGAGCAGG - Intergenic
900874427 1:5331335-5331357 GGAGCTGAAGGAGCCACACAGGG - Intergenic
901535211 1:9878193-9878215 GGTGCTGAAGGCAGCTCAGCTGG + Intronic
903224871 1:21888763-21888785 GGAGCTGAGGGCTGCAGGGCTGG + Intronic
903332191 1:22601866-22601888 GGAGCTGAAGGCTTCGCCACAGG + Exonic
903534813 1:24059943-24059965 GGAGGGGAAGGCCCCACAGATGG + Intronic
904216071 1:28920773-28920795 GGAGCTACAGGCTCCACACCTGG + Intronic
904311621 1:29632879-29632901 GGAGCTGAAGGCTTCACAGGAGG - Intergenic
904447511 1:30587082-30587104 GGAGCTGCAGGCATCAGAGCAGG - Intergenic
904600560 1:31670509-31670531 GGAGGTGAAGGCACGACAGGAGG + Intronic
905881074 1:41464091-41464113 GCAGCTGAAGGCACTGCAGCAGG - Intergenic
906652896 1:47525673-47525695 GGACCTGAAAGGTCCTCAGCAGG - Intergenic
907783168 1:57585915-57585937 CTTGCTCAAGGCTCCACAGCTGG - Intronic
909684077 1:78326140-78326162 GGATCTGAAGGATGCACAGGTGG - Intronic
912018116 1:105068044-105068066 GGACCTGATGGCTTCACAGCTGG - Intergenic
912990634 1:114482864-114482886 GAAGCAGAAGCCTGCACAGCAGG + Intronic
913043691 1:115055035-115055057 GGAGCTGAAAGACCCAAAGCAGG - Intronic
913424551 1:118713001-118713023 GGAGCTGCAGGCTGGACAGGAGG + Intergenic
914790852 1:150876431-150876453 GGAGCTGAAGGCGCCGGGGCGGG - Intronic
915265352 1:154712760-154712782 GGAGCCGAAGGCCACACTGCTGG - Intronic
915844989 1:159253231-159253253 GGAGCTGAAGGATGAATAGCTGG + Intergenic
917220790 1:172726970-172726992 GGAGCTCAGAGGTCCACAGCAGG - Intergenic
918702649 1:187624871-187624893 GGTTCTGAAGGCTACTCAGCTGG - Intergenic
918918257 1:190672063-190672085 ACAGCAGAAGGCTCCACAACAGG - Intergenic
919636329 1:200006915-200006937 AGAGCTGCAGGCTCCACTCCTGG + Intergenic
920548182 1:206836122-206836144 GAAGGTGAAATCTCCACAGCTGG + Intronic
921279323 1:213549993-213550015 GGGGCTGAGGGGTGCACAGCAGG + Intergenic
922758526 1:228109753-228109775 GGAGCTGAAGGGGCATCAGCTGG + Intergenic
923064010 1:230501449-230501471 GGGGCTGAAGGCTTCCCTGCTGG - Intergenic
1062835209 10:630976-630998 GGAGCTGAGGGCTCCTCAATGGG + Intronic
1064402682 10:15034540-15034562 GGATCTGAGGCCTTCACAGCAGG + Intronic
1066613361 10:37273618-37273640 GGAGCAGATGGATTCACAGCTGG - Intronic
1067842208 10:49690055-49690077 TGAGCTGAAGGCTTCCCTGCAGG + Intronic
1069490745 10:68858372-68858394 GGAGGTGACCGCTCCTCAGCAGG - Intronic
1069828449 10:71268456-71268478 GGAGATGAAGGGTCCCCAGCTGG + Intronic
1069828541 10:71268925-71268947 GGAGCTGAAGGACGCAGAGCTGG - Intronic
1069901401 10:71708567-71708589 GGACATGGAGGCTCCACAGAGGG - Intronic
1070734875 10:78856552-78856574 AGAGCTGAACCCTCCCCAGCAGG - Intergenic
1073251234 10:102121261-102121283 GGAGGTGAAGGCACCAAGGCTGG - Intergenic
1075157291 10:119988929-119988951 GAAGCTCAAGGCCCCACAGCTGG + Intergenic
1077134773 11:993047-993069 GGAGCTGCAGCATCCACAACAGG - Intronic
1077241764 11:1514286-1514308 GGAGCTGAAGACAGCAGAGCTGG - Intergenic
1077490984 11:2860880-2860902 GGAGCTGGAGTCCCCACACCTGG + Intergenic
1078107162 11:8365666-8365688 GTAGCTGAAGGCCCTGCAGCCGG - Intergenic
1078447825 11:11417817-11417839 GAAGCTGCAGGTTACACAGCTGG - Intronic
1078551460 11:12283635-12283657 GGTGGTGATGGCTGCACAGCAGG + Intronic
1081812790 11:45922823-45922845 GGGGCTGCAGGCTCCATCGCAGG - Exonic
1082785401 11:57313672-57313694 GGAGCTGATGGAGTCACAGCGGG + Exonic
1083369371 11:62166211-62166233 GGAGCTGTAGAGTCCACATCAGG - Intergenic
1083892997 11:65606066-65606088 GGCTCTGCAGGCTCCACTGCAGG + Exonic
1084683225 11:70679286-70679308 GGAGCTCAAGGTCACACAGCTGG + Intronic
1086312513 11:85550343-85550365 GGAGCTGCAGGCACCCCAACTGG + Intronic
1086338230 11:85821434-85821456 GGAGGTGAAGGCACCAGAGCTGG + Intergenic
1087231012 11:95663774-95663796 GGACCTGATGGCTTAACAGCTGG - Intergenic
1089138282 11:116266714-116266736 GGAACCCAAGGTTCCACAGCTGG - Intergenic
1089539665 11:119182211-119182233 GGAGCTGCTGGCTGCCCAGCTGG + Exonic
1089615254 11:119691461-119691483 TGAGCTGAAGGCTGCTCTGCGGG + Intronic
1090198502 11:124837851-124837873 GGAGCTGAAGTCTTCAGTGCTGG - Intergenic
1090854312 11:130598547-130598569 GGAGCTGAAGGCCTCCCTGCTGG + Intergenic
1090942158 11:131396395-131396417 GGGGATGAAGGCTGCAGAGCAGG - Intronic
1091268446 11:134288706-134288728 GCTGCCGAAGGCTGCACAGCTGG - Intronic
1093259155 12:16913623-16913645 GGACCTGATGGCTTCACTGCTGG - Intergenic
1094176016 12:27542099-27542121 GGATCTGAGGGTTCCACATCTGG + Intronic
1095943881 12:47742868-47742890 GGAGCTGGAGATACCACAGCAGG - Intronic
1095986682 12:48004141-48004163 GGAGCCGCGGGCTCCAGAGCTGG + Intronic
1098064536 12:66599620-66599642 GTGGCTGATGGCTCCACAGTAGG + Intronic
1099847972 12:88053651-88053673 GGAGCTGAAAGCACCATACCTGG - Exonic
1099874667 12:88390247-88390269 GATCCTGAAGGCACCACAGCTGG - Intergenic
1100604734 12:96142326-96142348 GGAGCAGAAGGTGCCAAAGCAGG + Intergenic
1101879809 12:108618521-108618543 GGAGCTGAAGGCTCCACAGCAGG - Intergenic
1102391557 12:112552984-112553006 GGAGCAGCGGGCTCCCCAGCAGG - Intergenic
1102521302 12:113478817-113478839 GGAGCGGAAGGGTGCCCAGCAGG - Intergenic
1104083754 12:125456542-125456564 AGGGCTGAAGGCTCCTCAGCAGG - Intronic
1104287017 12:127432727-127432749 AGGGCTGAAGGCTCCTCGGCAGG + Intergenic
1107141136 13:36999470-36999492 GGAGCGCTAGGTTCCACAGCGGG + Intronic
1108593943 13:51934641-51934663 GGAGCGGAAGTCCCCAAAGCTGG + Exonic
1108774219 13:53744598-53744620 GGAGCTGAATGCTAAAGAGCAGG + Intergenic
1109120975 13:58456868-58456890 GGAGCAGATGGATTCACAGCCGG + Intergenic
1110513459 13:76381232-76381254 GGAGCTGAAGCCCCATCAGCAGG + Intergenic
1112459419 13:99590185-99590207 TGGGCTGCAGGCTCCACAGCAGG + Intergenic
1113529087 13:111006905-111006927 GGGACTGAAGGCTCCACACGAGG + Intergenic
1120080829 14:80214260-80214282 GCTGCTGAAGTCTCCACTGCAGG - Intronic
1120691601 14:87599067-87599089 GGGGCTGCTTGCTCCACAGCAGG - Intergenic
1120876849 14:89382923-89382945 GTAGCAGGAGGCTCCCCAGCAGG + Intronic
1121223936 14:92307715-92307737 GGAGCTCAAGGCTGCAGAGACGG - Intergenic
1121457992 14:94051223-94051245 GAAGCCGAAGGAGCCACAGCCGG - Exonic
1121775611 14:96588597-96588619 GGTGCCGAAGGCTGAACAGCTGG + Intergenic
1122834657 14:104424879-104424901 GGAGCTGGGGGCGCCACAGCTGG + Intergenic
1123155394 14:106219611-106219633 GGAGATGCAGGCTACACTGCAGG + Intergenic
1123511395 15:21003403-21003425 GGAGATGCAGGCTACACTGCAGG + Intergenic
1123578227 15:21694174-21694196 GGAGATGCAGGCTACACTGCAGG + Intergenic
1123614852 15:22136656-22136678 GGAGATGCAGGCTACACTGCAGG + Intergenic
1124086618 15:26556895-26556917 ACAGCTGCTGGCTCCACAGCAGG - Intronic
1125253765 15:37738247-37738269 GGAGCTGAAAGATCCATTGCAGG + Intergenic
1125553129 15:40562807-40562829 GGAGCCCAAGGCTTTACAGCTGG + Exonic
1125896597 15:43307866-43307888 GGAACCTAAGGCTCAACAGCAGG - Intergenic
1125968169 15:43890901-43890923 GGAGCTGAAGAGGGCACAGCGGG + Intronic
1128599892 15:68987410-68987432 GGAGAGGAAGCCTCCACAGTGGG - Intronic
1129360563 15:75021395-75021417 GGAGCTGGATGTTCCCCAGCTGG + Exonic
1129555436 15:76503359-76503381 GGAGCAGAAAGCTCCCCATCAGG - Intronic
1129741269 15:77990787-77990809 GGAGCCCAAGGCCACACAGCTGG - Intronic
1129790900 15:78340153-78340175 GGAGGTGGAGGCTCCCCAGTTGG + Intergenic
1129844394 15:78761611-78761633 GGAGCCCAAGGCCACACAGCTGG + Intronic
1130257404 15:82332168-82332190 GGAGCCCAAGGCCACACAGCTGG - Intergenic
1130597541 15:85257797-85257819 GGAGCCCAAGGCCACACAGCTGG + Intergenic
1132048965 15:98591207-98591229 GGATCTGAGGGCTCCGCAACAGG - Intergenic
1202987097 15_KI270727v1_random:428419-428441 GGAGATGCAGGCTACACTGCAGG + Intergenic
1132656179 16:1042919-1042941 GGAGCTGCAGGCTCTGGAGCTGG - Intergenic
1132674833 16:1117254-1117276 GCAGGTGGAGGCTCCGCAGCTGG - Intergenic
1133101687 16:3483886-3483908 GGAGCAGGAGGCTCTCCAGCTGG - Intronic
1137566928 16:49539180-49539202 GGACCTGAATGCTCCAGGGCTGG - Intronic
1138499714 16:57432533-57432555 GCAGCAGCAGGGTCCACAGCAGG + Exonic
1138758192 16:59514328-59514350 GTAGGTGAAAGCTCTACAGCTGG - Intergenic
1141664388 16:85458403-85458425 GGAGCTGAAGGATGCACCCCAGG + Intergenic
1141900552 16:86987833-86987855 GGGGCTAAAGGCTCCAGAGGAGG - Intergenic
1142609454 17:1100602-1100624 GGACCGGAAGGCCCCAGAGCAGG + Intronic
1142858947 17:2749523-2749545 GCAGCTGATGGCGCCGCAGCCGG - Intergenic
1145018635 17:19414112-19414134 GGAGCTGAAGGATACAGACCTGG + Exonic
1149218683 17:54389342-54389364 GGAGCTGTAGACACCAGAGCAGG + Intergenic
1151326640 17:73383795-73383817 GAAGCTGAGAGCTCCAGAGCGGG + Intronic
1151701132 17:75743140-75743162 GGGGCTGAAGGCTCCATCTCTGG + Intronic
1151944516 17:77312168-77312190 GGAGGGGAAGGAGCCACAGCAGG - Intronic
1152151246 17:78602727-78602749 GGCACTGTGGGCTCCACAGCAGG + Intergenic
1152688483 17:81706837-81706859 GGAGCTAACGCCTCCACTGCTGG - Intronic
1155239084 18:23848159-23848181 GGAGCTGAGGCCTCCACAGCAGG + Intronic
1158283230 18:55850755-55850777 GGAGCTGAAGGCTACCCATGAGG - Intergenic
1158608501 18:58917460-58917482 GGAGATAAAGCCTCCACTGCAGG - Intronic
1162069668 19:8146188-8146210 GGAGCAGAAGCCTTCACCGCAGG + Exonic
1162412882 19:10517227-10517249 GAAGCTGGGGGCTCCCCAGCTGG - Intronic
1162807438 19:13145287-13145309 GGAGCAGCAGGCCACACAGCAGG - Exonic
1163722934 19:18906807-18906829 GGAGCTGGAGCCTGGACAGCAGG + Intronic
1164073775 19:21793934-21793956 GGAGCTGAAGCATCTGCAGCAGG - Intergenic
1164458084 19:28425924-28425946 GGAGCTGAAATCTCTACCGCAGG - Intergenic
1165291445 19:34889323-34889345 GGATCTGTGGCCTCCACAGCAGG - Intergenic
1165813049 19:38623919-38623941 GGAGGTGAAGGTTACACAGCTGG + Intronic
1166349867 19:42191543-42191565 GAAACAGAAGGCACCACAGCTGG - Intronic
1166355530 19:42225190-42225212 GGAGGTGACGAGTCCACAGCTGG + Exonic
1166837984 19:45678840-45678862 TGAGGTGAAGGCCACACAGCTGG - Intronic
1167298053 19:48663421-48663443 ACAGCTGAAGGCTACACAGCTGG - Intronic
1167666538 19:50825743-50825765 TGAGCAGAAGCCCCCACAGCTGG - Exonic
925211004 2:2045938-2045960 GGAGCTAAGGACCCCACAGCAGG - Intronic
925291100 2:2749261-2749283 GGATCTGAAACCTCCATAGCGGG + Intergenic
925370368 2:3340402-3340424 GGAACTGAAGTTTCCACAGCAGG + Intronic
927717956 2:25364612-25364634 GCAGCTGGAGGCACCCCAGCAGG + Intergenic
928333254 2:30374055-30374077 GGAGCTGGAGGCCCCACTCCAGG + Intergenic
931671542 2:64653293-64653315 GGAGCTGTCGCCTCTACAGCTGG - Intronic
931842717 2:66171146-66171168 TGAGCTGAAGTCTGCACAGGTGG + Intergenic
931911607 2:66905656-66905678 GAAGCTGAAGGCTCCAGCTCAGG + Intergenic
933777224 2:85778561-85778583 GGTCCTGAAGTATCCACAGCCGG + Intronic
934979607 2:98829171-98829193 GGCTCTGAAGGATGCACAGCAGG + Intronic
938249418 2:129802654-129802676 GGAGGTGATGGTTCCACACCAGG + Intergenic
938770601 2:134498012-134498034 AGAGCAGCAGCCTCCACAGCAGG + Intronic
946689541 2:222299999-222300021 GGAGCTGAAGTGTCCCCAGCAGG + Intronic
947750772 2:232530802-232530824 GGGGCTGAAGGGACCTCAGCAGG + Intronic
947876110 2:233469304-233469326 GGGCCAGAGGGCTCCACAGCAGG - Intronic
948365414 2:237451639-237451661 GGAGCTGCAGCGGCCACAGCGGG - Intergenic
948375984 2:237520400-237520422 GGAGATGTAGGCATCACAGCAGG - Intronic
948646093 2:239406104-239406126 GGAGCTGAAGTCACTACAGGGGG + Intergenic
949009663 2:241671353-241671375 GGAGCTGCAGCCTTCACATCTGG + Exonic
1168968639 20:1915625-1915647 TTTGCTGAAGGCTCCACAGCTGG + Intronic
1170492841 20:16896444-16896466 GGAGCTCCAGGCTCCTCTGCTGG + Intergenic
1171221738 20:23404410-23404432 GGAGCTGCAAGCTCCTCTGCTGG - Intronic
1171493241 20:25537029-25537051 GGAGATGAAGGCAACAGAGCGGG + Intronic
1172447156 20:34999281-34999303 GGAGCTGGAGGCGGCACAGAGGG + Exonic
1173809008 20:45945054-45945076 AGAGCTGACGGCATCACAGCTGG - Intronic
1173809857 20:45949105-45949127 TGAGCTGGAGGCTCAAGAGCTGG + Intronic
1174351899 20:49974454-49974476 GGAGCTCAAGGGGCCACAGGGGG + Intergenic
1174547543 20:51337039-51337061 GCAGCTCCAGGCCCCACAGCAGG + Intergenic
1175813031 20:61868907-61868929 TGAGCTGCAGGTGCCACAGCTGG - Intronic
1176084770 20:63290907-63290929 GGGGCTGGAGGCTGCACAGGAGG + Intergenic
1176296608 21:5076568-5076590 GGAGCAGAAGCCCCCACACCTGG + Intergenic
1176431698 21:6579985-6580007 GCAGCTGGAGGCTCCTCAGCAGG + Intergenic
1177771256 21:25518921-25518943 GGAGCTGCAAGCTGCACTGCCGG - Intergenic
1179707092 21:43187447-43187469 GCAGCTGGAGGCTCCTCAGCAGG + Intergenic
1179860441 21:44185553-44185575 GGAGCAGAAGCCCCCACACCTGG - Intergenic
1180157888 21:45986830-45986852 GGCGCTCCAGGCTCCTCAGCAGG - Intronic
1180636655 22:17267244-17267266 GGAGCAGAAAGCTCCAAAACTGG - Intergenic
1180879924 22:19196394-19196416 GGTGCTGAGGGCTGCAGAGCAGG - Exonic
1181041057 22:20192807-20192829 CGAGCTGAAGGAGCAACAGCAGG - Intergenic
1182159171 22:28104634-28104656 GAAACTGAAGGCTGCACAGTTGG - Intronic
1182280939 22:29217352-29217374 GGACCTGAAGGCCCCACAGAGGG - Intronic
1182447486 22:30398026-30398048 AGATTTGGAGGCTCCACAGCTGG + Intronic
1182585722 22:31343426-31343448 GGGACTTAAGGCTCCACTGCTGG - Intronic
1183291691 22:37006078-37006100 GAAGCTTAAGGCTCCTCAACAGG + Intronic
1184474502 22:44713195-44713217 GGAACTGCAGCCTCCACAGAGGG + Intronic
1185017492 22:48353254-48353276 GGAGCTGCTGCCTCCCCAGCAGG + Intergenic
950399607 3:12759988-12760010 GGAGCTGTGGGCTCCCCAGGAGG + Intronic
951242335 3:20301712-20301734 GGAGCTGAAGGATACACTTCTGG + Intergenic
951695274 3:25439977-25439999 GGAGCTCAAGCTTCCACAGCAGG - Intronic
952962835 3:38603677-38603699 CGAGATGCAGGCACCACAGCAGG - Intronic
953786589 3:45915942-45915964 GAAGCTGAAGCCTCAAAAGCCGG - Intronic
954110989 3:48432938-48432960 GGAGCTGAAGGCTTTACTCCTGG - Exonic
955388134 3:58496380-58496402 CTAGCTGAGGGCGCCACAGCTGG - Intronic
960056026 3:113277012-113277034 GGAGCTCCAGGCTCCCCAACAGG - Intronic
961035344 3:123637994-123638016 GGGGCTGAGGGTTCCACAGGAGG - Intronic
962311688 3:134331421-134331443 GGAGCCCCAGGCTCCACAGAGGG + Intergenic
967875451 3:194265525-194265547 GGTGCTGCAGGCTGCACTGCCGG - Intergenic
969614763 4:8245922-8245944 GGAGCTCAACGGTCCCCAGCTGG + Intergenic
969631779 4:8343213-8343235 GGAGTTGAAGGCACCACTGCGGG + Intergenic
971054467 4:22896992-22897014 GGAGCTGACAGCTACCCAGCAGG + Intergenic
972285450 4:37643849-37643871 GAAGCTGAAGAGGCCACAGCTGG + Intronic
976835593 4:89369472-89369494 GGACCTGAAGGCACTGCAGCAGG + Intergenic
978701847 4:111656363-111656385 GGCACTGAAGGCTTGACAGCAGG + Intergenic
982173524 4:152683834-152683856 GCAGCTGGAGCCTGCACAGCCGG + Intergenic
984478028 4:180261569-180261591 GGAGATCAAACCTCCACAGCAGG + Intergenic
985383491 4:189420491-189420513 GGAGTTGAATGCTCAACACCAGG - Intergenic
986345065 5:6827053-6827075 GGATCCGCAGGCTCCAAAGCTGG - Intergenic
991461188 5:66860990-66861012 GGAGCAGATGGCCCCATAGCTGG - Intronic
994121092 5:96113659-96113681 GGAGCTGAAGCCTTGGCAGCTGG + Intergenic
994765323 5:103908909-103908931 GGAGCAGACTGCTCCACAGAGGG - Intergenic
995490816 5:112690135-112690157 GCAGCTGAAGGTTTTACAGCTGG + Intergenic
996811852 5:127524617-127524639 GGTGCTGAAGGCCTCACAGGAGG - Exonic
996921251 5:128770087-128770109 GGAGCTGTATGCTCCACCCCAGG + Intronic
997710382 5:135999181-135999203 GGAGATGATGCCTGCACAGCAGG + Intergenic
999169036 5:149577626-149577648 TGAGCTGAATGCTCCAAACCTGG - Intronic
999864444 5:155685317-155685339 GGATCTGAAGGTACAACAGCTGG - Intergenic
1001436219 5:171701693-171701715 GGAACTGAAGTGTCCACATCGGG - Intergenic
1002858161 6:1056314-1056336 GAAGCAGAAGACTCCACAGCCGG + Intergenic
1003049961 6:2771149-2771171 GCAGCTGCAGAGTCCACAGCAGG - Intronic
1004515670 6:16320601-16320623 GAAGCCAAAGGCTCCCCAGCTGG + Intronic
1007696651 6:43737939-43737961 GGAGCTGATGTGGCCACAGCTGG + Intergenic
1008858339 6:56118466-56118488 GGACCTGATGGCTTCACTGCTGG + Intronic
1012002290 6:93667901-93667923 GCAAGTGAAGGCTACACAGCAGG + Intergenic
1016594524 6:145784669-145784691 GCAGGAGAAGGCTCCACAACAGG + Intergenic
1017183482 6:151576874-151576896 TGATGTGAAGGCTCCACGGCGGG + Intronic
1019163081 6:170081763-170081785 GGTCCTGGAGGCTCCACAGGAGG + Intergenic
1019285975 7:223293-223315 TGGGCTGCAGGCTCCACGGCGGG + Intronic
1022098929 7:27157729-27157751 ATAGGTGAAGCCTCCACAGCTGG - Intronic
1023291154 7:38670396-38670418 GGAACTGAAGGAACAACAGCAGG + Intergenic
1023359010 7:39396846-39396868 GGAGATGTAGCCTCCATAGCCGG + Intronic
1023585664 7:41727165-41727187 GGTCCTGAGGGCTCCACAGCTGG - Intergenic
1024599788 7:50970234-50970256 GGAGCAGCAGGCTCCAGTGCAGG - Intergenic
1025601696 7:63005867-63005889 GGAGCTCAGAGCTCCACAGGTGG - Intergenic
1026067678 7:67089422-67089444 GGTGCGGAAGACTCCACTGCAGG + Intronic
1029438467 7:100575014-100575036 GGGGCTGAAGGCACCGCAGGTGG + Exonic
1030112528 7:106038895-106038917 TGAGATCAAGGCTCCCCAGCAGG + Intergenic
1031952943 7:127910897-127910919 GTAGCTGCTGGCTCCACTGCTGG + Intronic
1032017518 7:128389355-128389377 GGAGCTGAGTGCCTCACAGCTGG + Intergenic
1032148023 7:129401480-129401502 GCTGCTGAAGGCTGCAGAGCAGG + Intronic
1034311810 7:150095066-150095088 AGAGCTGGAGGGACCACAGCAGG - Intergenic
1034312237 7:150099113-150099135 GGAACTGACAGCTCCACTGCTGG - Intergenic
1034794615 7:154001545-154001567 GGAACTGACAGCTCCACTGCTGG + Intronic
1034795044 7:154005588-154005610 AGAGCTGGAGGGACCACAGCAGG + Intronic
1035593201 8:833932-833954 GGAGCTGGTGGCTCCTCAGTGGG + Intergenic
1036409842 8:8489245-8489267 GGAGCTGGAGGGTTTACAGCAGG - Intergenic
1040621358 8:49096253-49096275 GGAGCTGGAGGCTCCCCAGGTGG - Intergenic
1041192562 8:55368359-55368381 AGACTTGGAGGCTCCACAGCAGG - Intronic
1041965376 8:63669564-63669586 GGAGCTGCCTTCTCCACAGCTGG - Intergenic
1044881353 8:96726422-96726444 GGTTCTGAAGGCTCTACAGGAGG + Intronic
1046436557 8:114196895-114196917 GGAGAAGAAGGCTCTACAGTAGG - Intergenic
1049175354 8:141189357-141189379 GGTGATGAAGGCACCACACCCGG + Intronic
1049315318 8:141963172-141963194 GGAGTAGAAGGAACCACAGCTGG - Intergenic
1049346599 8:142142551-142142573 GGAGCTGTGGCCTCCACAGAGGG + Intergenic
1049557692 8:143291271-143291293 TGAGCTGAAGGCGCCGCGGCTGG + Intronic
1049756043 8:144311752-144311774 GGAGATGATGGGTCCAGAGCTGG - Exonic
1055382563 9:75724755-75724777 AGAGCTGATGGCTCCCAAGCAGG - Intergenic
1058693973 9:107543641-107543663 GGCACTGAAGTCTCCAAAGCTGG + Intergenic
1060842556 9:126805188-126805210 GGAGTTAAGGGCTCCTCAGCAGG + Intronic
1060989636 9:127841011-127841033 GGAGCTAGAGGTTCCCCAGCAGG - Intronic
1061490008 9:130939423-130939445 GGGGCTGGAGACCCCACAGCTGG - Intergenic
1061972034 9:134050167-134050189 GGAGCTGAAGGTCACACAGCTGG - Intronic
1062186189 9:135219917-135219939 AGAGCTGGAGGCCACACAGCGGG + Intergenic
1062710491 9:137972644-137972666 GGATCTGACAGCTCCACAGTGGG + Intronic
1185467585 X:363765-363787 AGAGCCGCAGGCTCCACAGTGGG - Intronic
1190491023 X:50982973-50982995 GGATCTGAAGGATCCAGAGGTGG + Intergenic
1190719363 X:53134445-53134467 GGAGATGAGGGATCCACAGTTGG + Intergenic
1191122741 X:56922831-56922853 GGAGCAGAAGTCTGCACAGCTGG + Intergenic
1191715288 X:64190080-64190102 GGGGCTGAAGCCTCCAGAACTGG + Exonic
1196825317 X:119735983-119736005 GGAGCTGAGAGCCCCACAGAGGG + Intergenic
1200014776 X:153151464-153151486 GGAGCTGAGGACACCAGAGCGGG + Intergenic