ID: 1101880613

View in Genome Browser
Species Human (GRCh38)
Location 12:108623191-108623213
Sequence CTCATCCCTGTTGCCTGATG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 204
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 186}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101880613_1101880616 -7 Left 1101880613 12:108623191-108623213 CCCCATCAGGCAACAGGGATGAG 0: 1
1: 0
2: 1
3: 16
4: 186
Right 1101880616 12:108623207-108623229 GGATGAGATGCAGACCATCTCGG 0: 1
1: 0
2: 0
3: 42
4: 714
1101880613_1101880617 -4 Left 1101880613 12:108623191-108623213 CCCCATCAGGCAACAGGGATGAG 0: 1
1: 0
2: 1
3: 16
4: 186
Right 1101880617 12:108623210-108623232 TGAGATGCAGACCATCTCGGTGG 0: 1
1: 0
2: 0
3: 9
4: 100
1101880613_1101880623 15 Left 1101880613 12:108623191-108623213 CCCCATCAGGCAACAGGGATGAG 0: 1
1: 0
2: 1
3: 16
4: 186
Right 1101880623 12:108623229-108623251 GTGGGGGAGTAATTACGCACGGG 0: 1
1: 0
2: 0
3: 4
4: 37
1101880613_1101880622 14 Left 1101880613 12:108623191-108623213 CCCCATCAGGCAACAGGGATGAG 0: 1
1: 0
2: 1
3: 16
4: 186
Right 1101880622 12:108623228-108623250 GGTGGGGGAGTAATTACGCACGG 0: 1
1: 0
2: 0
3: 5
4: 59
1101880613_1101880619 -2 Left 1101880613 12:108623191-108623213 CCCCATCAGGCAACAGGGATGAG 0: 1
1: 0
2: 1
3: 16
4: 186
Right 1101880619 12:108623212-108623234 AGATGCAGACCATCTCGGTGGGG 0: 1
1: 0
2: 0
3: 12
4: 107
1101880613_1101880620 -1 Left 1101880613 12:108623191-108623213 CCCCATCAGGCAACAGGGATGAG 0: 1
1: 0
2: 1
3: 16
4: 186
Right 1101880620 12:108623213-108623235 GATGCAGACCATCTCGGTGGGGG 0: 1
1: 0
2: 1
3: 7
4: 93
1101880613_1101880618 -3 Left 1101880613 12:108623191-108623213 CCCCATCAGGCAACAGGGATGAG 0: 1
1: 0
2: 1
3: 16
4: 186
Right 1101880618 12:108623211-108623233 GAGATGCAGACCATCTCGGTGGG 0: 1
1: 0
2: 0
3: 9
4: 115
1101880613_1101880624 16 Left 1101880613 12:108623191-108623213 CCCCATCAGGCAACAGGGATGAG 0: 1
1: 0
2: 1
3: 16
4: 186
Right 1101880624 12:108623230-108623252 TGGGGGAGTAATTACGCACGGGG 0: 1
1: 0
2: 0
3: 1
4: 26
1101880613_1101880625 25 Left 1101880613 12:108623191-108623213 CCCCATCAGGCAACAGGGATGAG 0: 1
1: 0
2: 1
3: 16
4: 186
Right 1101880625 12:108623239-108623261 AATTACGCACGGGGTACATGTGG 0: 1
1: 0
2: 0
3: 0
4: 18

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101880613 Original CRISPR CTCATCCCTGTTGCCTGATG GGG (reversed) Exonic
900759471 1:4461308-4461330 ATCATCCCCGTTTTCTGATGAGG - Intergenic
900988778 1:6088170-6088192 CTCATCCCTGTAGGCTGAGGTGG - Intronic
901060829 1:6471227-6471249 ATGATCCCTGTTTCCTGATGAGG + Intronic
901221591 1:7586717-7586739 CCCACCCCTGATCCCTGATGTGG - Intronic
901784385 1:11615101-11615123 CTCATCCCTGGTGCTAGATATGG - Intergenic
902252442 1:15163194-15163216 CTCCTCCCTGCTGCCTAATAAGG - Intronic
903354938 1:22740800-22740822 CCCCTCCCTGCTTCCTGATGTGG + Intronic
903472179 1:23594958-23594980 CTCATCCCTGTGGCTTGCTGGGG - Intronic
907316024 1:53573230-53573252 CTCATCCCTTCTGTCTGCTGGGG + Intronic
909949928 1:81706767-81706789 CTCCTCCTTGATGCCTGATCAGG - Intronic
911525510 1:98980079-98980101 AGCATCCCTGATGCCTGAGGTGG - Intronic
912587598 1:110780836-110780858 GACATTTCTGTTGCCTGATGAGG - Intergenic
914830829 1:151169750-151169772 CACAGCCCTGTTTCCAGATGTGG - Exonic
914944570 1:152052685-152052707 CCACTCCCTGTTGCCTAATGCGG + Intergenic
915003019 1:152610911-152610933 CTCATCCTTGATTGCTGATGTGG + Intergenic
921922635 1:220686401-220686423 CTCACCCCTTCTGCCTTATGAGG - Intergenic
923327849 1:232896814-232896836 CTCAGCCCAGTTACCTAATGAGG + Intergenic
1067934108 10:50593753-50593775 TTCATCCCTGTTGACTCATGTGG + Intronic
1069788279 10:71003710-71003732 CTGAGCCCAGTTTCCTGATGAGG - Intergenic
1073597028 10:104811426-104811448 CTCCTCACAGTTGCCTGGTGAGG + Intronic
1074751647 10:116592555-116592577 CTGATCCCTGTGGCCAGCTGAGG + Intronic
1077180288 11:1209205-1209227 TGCATCCCTGTTGCCTGCTCAGG + Intergenic
1082980342 11:59115132-59115154 CTGACCCCTCTTGTCTGATGAGG - Intronic
1086419249 11:86622035-86622057 CTCCTCGCTGAGGCCTGATGAGG - Intronic
1087838736 11:102900871-102900893 CTCCTCCTTCTTGCCTCATGAGG - Intergenic
1088644739 11:111908868-111908890 TTCATCCCTGTCATCTGATGGGG - Exonic
1089658629 11:119971082-119971104 CTCATCCCCGCAGCCTGCTGTGG - Intergenic
1090415347 11:126536578-126536600 CTCTGCCCTGGAGCCTGATGTGG + Intronic
1090886443 11:130881016-130881038 CTCACCCCTTTTGCCATATGAGG + Intronic
1096264269 12:50111092-50111114 CTCACTCCTGCTGCCTGATCTGG - Exonic
1096621023 12:52865626-52865648 CACCTCCCTGGTGCCTGATGTGG + Intergenic
1098131829 12:67359143-67359165 CTCTTCCCTGTTGACTGTAGGGG - Intergenic
1098269385 12:68755089-68755111 CTCTTCCTTGTTGTCAGATGAGG - Intronic
1101880613 12:108623191-108623213 CTCATCCCTGTTGCCTGATGGGG - Exonic
1101991214 12:109487031-109487053 CTCATCCCTGCTCCCTTTTGGGG + Intronic
1102348138 12:112172627-112172649 CCCTCCCCTGCTGCCTGATGCGG - Intronic
1102567134 12:113804104-113804126 GTTATCCCTGTTTTCTGATGAGG + Intergenic
1104732078 12:131112835-131112857 CTCATCTCTGTTGACTCATTGGG - Intronic
1104765983 12:131330552-131330574 CAGATCACTGTTGACTGATGGGG + Intergenic
1105804967 13:23947352-23947374 CCCATCCCTGATGCCCGAGGAGG + Intergenic
1107629074 13:42324873-42324895 CTCATTTCTGTTGCCTGCTGGGG + Intergenic
1111202917 13:84962401-84962423 CTCAATCCTGGTGCCTGCTGTGG - Intergenic
1112465364 13:99639560-99639582 CTCATCCCTTTTGCCTACAGAGG + Intronic
1113987431 13:114329594-114329616 TTCATCCCTGTTGCCATAAGTGG + Intergenic
1119987089 14:79150212-79150234 CTGATCCCTATTGCCAGATGGGG + Intronic
1120890903 14:89490396-89490418 CTGATCCCTGATGCCTTAAGTGG + Intronic
1122143911 14:99677610-99677632 CCCAGGCCTGTTGCCAGATGAGG + Exonic
1122164499 14:99811778-99811800 CTCATTCCTGTTGCCTAGTCTGG - Intronic
1123951298 15:25278867-25278889 CTCACCCCTGTTCTCTGAAGTGG - Intergenic
1124848992 15:33317603-33317625 CTCATCCCTGTAGCAGGATCAGG - Intronic
1125897527 15:43315151-43315173 CCCTTCCCTGTTCCCTCATGTGG - Intergenic
1128147611 15:65340608-65340630 ATCATCCCAGCTGCCTGAGGAGG - Intronic
1128520753 15:68373202-68373224 GTAATCCCTGCTGCCTGGTGTGG + Intronic
1129037896 15:72662012-72662034 CTCCTCCCTCTTTGCTGATGGGG - Intronic
1129211993 15:74075215-74075237 CTCCTCCCTCTTTGCTGATGGGG + Intronic
1129398410 15:75265870-75265892 CTCCTCCCTCTTTGCTGATGGGG - Intronic
1129402018 15:75290145-75290167 CTCCTCCCTCTTTGCTGATGGGG - Intronic
1129711413 15:77822058-77822080 CTCATGGCTGTTGCCTGCTCTGG + Intergenic
1129729119 15:77919536-77919558 CTCCTCCCTCTTTGCTGATGGGG + Intergenic
1130259713 15:82345621-82345643 CTCCTCCCTCTTTACTGATGGGG + Intronic
1130269006 15:82433815-82433837 CTCCTCCCTCTTTACTGATGGGG - Intronic
1130281520 15:82523388-82523410 CTCCTCCCTCTTTACTGATGGGG - Intergenic
1130472893 15:84239571-84239593 CTCCTCCCTCTTTACTGATGGGG - Intronic
1130480384 15:84354142-84354164 CTCCTCCCTCTTTACTGATGGGG - Intergenic
1130491385 15:84433987-84434009 CTCCTCCCTCTTTACTGATGGGG + Intergenic
1130503001 15:84513027-84513049 CTCCTCCCTCTTTACTGATGGGG + Intergenic
1130595186 15:85244205-85244227 CTCCTCCCTCTTTACTGATGGGG - Intergenic
1131282804 15:91034498-91034520 CTCCTCCCTCTTTGCTGATGGGG + Intergenic
1131423913 15:92329910-92329932 CTCACCCCTTTTGCCATATGAGG + Intergenic
1133056455 16:3147794-3147816 AGCATCCCTGTTTCCTGAAGAGG - Exonic
1133161653 16:3915901-3915923 CTTCTCCCTGTTTCCTGATGGGG + Intergenic
1137033593 16:35547754-35547776 CTCCTCCCTGCTGGCTGCTGTGG - Intergenic
1140450520 16:75067057-75067079 CACATACCTGTTGCCTGGTCTGG + Intronic
1140579034 16:76206856-76206878 CTCATCTCTTTTGGCTGGTGAGG - Intergenic
1142123375 16:88398121-88398143 CTGATCCCTGCTCCCTGCTGTGG + Intergenic
1142203675 16:88772805-88772827 CTCCTCCCTGTTCTCTGAGGGGG + Intronic
1142491268 17:281302-281324 CTTATCCCCTTTTCCTGATGGGG - Intronic
1144909814 17:18672021-18672043 CTCATCACTGCTGCGTGACGTGG + Intronic
1144956086 17:19019637-19019659 CTCTTCCCTGCTGCCTGTGGGGG + Intronic
1145043787 17:19596354-19596376 CTCATCCCTGTCTCCCCATGGGG - Intergenic
1146790134 17:35746282-35746304 CTCCTCCCTCTTTCCTGACGAGG + Exonic
1148150643 17:45394914-45394936 GTCATCCCTGAGGCCTGAGGAGG + Exonic
1151352884 17:73542208-73542230 CCCATCCCTGGTGCCTTCTGAGG + Intronic
1152007260 17:77690441-77690463 CCCATCCCAGTGGCCTGACGTGG - Intergenic
1153915626 18:9741877-9741899 CTCATCCAGGTTTCCTGGTGTGG + Intronic
1155645748 18:28075551-28075573 CTTCTCACTGTAGCCTGATGAGG - Intronic
1157782710 18:50454282-50454304 CTCAGCCCTGCAGCCTGAGGGGG - Intergenic
1160430281 18:78806312-78806334 CTCATCCCTGTTGGCTGGAAAGG - Intergenic
1162966377 19:14158118-14158140 ACCATCCCTGTTGCCAGGTGTGG - Intronic
1163560973 19:18019257-18019279 CTCATGCCTGCTGCATGCTGGGG - Intergenic
1164526648 19:29017954-29017976 CTCATCCCTGGGGCCTGTTGTGG + Intergenic
1168710266 19:58495889-58495911 CTCAGCTCTGTTGCCTAAAGTGG + Intronic
926165131 2:10517785-10517807 CACATGCCTGTTGCCGGCTGTGG + Intergenic
926416504 2:12654862-12654884 GTCATCCCTCCTGCCAGATGTGG - Intergenic
929682512 2:44005852-44005874 CTGATCCCTGTGGCCAGAGGTGG - Intergenic
931723244 2:65082906-65082928 TTCACCCCTGCTGCCTGCTGAGG + Intronic
933177433 2:79191360-79191382 CTCATCCCTGTTGCCCTTTAAGG - Intronic
934661699 2:96146490-96146512 CCCAGCCCTGCTGCCGGATGTGG + Intergenic
937118913 2:119428763-119428785 CTGACCACTCTTGCCTGATGAGG - Intergenic
938108917 2:128551473-128551495 CTCATACCTGCTGGCCGATGTGG + Intergenic
939534180 2:143404763-143404785 CTTAATGCTGTTGCCTGATGAGG - Intronic
939690863 2:145258607-145258629 CTCATCTCTATTACCTGAGGTGG + Intergenic
940026583 2:149214869-149214891 CTCAGTCCTGTGGCCTCATGCGG - Exonic
944138579 2:196429361-196429383 CTCATCCCTCTTTCCTGCTAGGG + Intronic
945824517 2:214704543-214704565 CTCATCACTGTTTTCTGAAGAGG - Intergenic
1170358745 20:15521129-15521151 CTCAGCCCAGTTGTCTGCTGGGG - Intronic
1170787316 20:19478770-19478792 CTCATTCATGTTACATGATGAGG + Intronic
1171386486 20:24772834-24772856 GTCATCCCTGATGACAGATGAGG + Intergenic
1171432431 20:25091466-25091488 CATATGCCTGTTGCCTGACGGGG + Intergenic
1172813501 20:37668594-37668616 CTCATCCCTGCTTCCTGCAGTGG - Intergenic
1173305286 20:41841702-41841724 CTCATCCATGTTGGTTCATGTGG + Intergenic
1173334245 20:42100078-42100100 CTCATCCCCATTTTCTGATGAGG - Intronic
1173620577 20:44432740-44432762 CCCATCACTGCCGCCTGATGGGG + Exonic
1175225199 20:57440516-57440538 CTCATGCCTGCTGACAGATGAGG - Intergenic
1179144678 21:38757415-38757437 CTCATGCCTGTAGGCTGAGGAGG - Intergenic
1179581470 21:42347218-42347240 CTCATCCCTGTTGCCTCCCCAGG - Intronic
1180220804 21:46356626-46356648 CTCATGCCTGTGACCAGATGTGG - Intronic
1180599988 22:17009311-17009333 ATCCTCCCTGCTACCTGATGGGG - Intergenic
1184099600 22:42335161-42335183 CCCACCCCTCTTGCCTGGTGGGG - Intronic
1184574968 22:45356323-45356345 CTCATCACAGTTGCCTGAATGGG - Intronic
949603269 3:5624949-5624971 CTCATCCCTTTTGCCATTTGAGG + Intergenic
950077769 3:10199397-10199419 CTCATCCCTGTTCAGAGATGAGG - Intronic
952261651 3:31746237-31746259 CTCATGCCTGTCCCCTCATGAGG - Intronic
953550754 3:43900768-43900790 CTCACCCCTGTTGCCATATGAGG + Intergenic
955210016 3:56932126-56932148 TTCATTTCTGTTGCCTGTTGGGG + Intronic
956583821 3:70842874-70842896 AGCATCCCGGTTTCCTGATGGGG - Intergenic
956740749 3:72273856-72273878 CTCAGCTCTGTTGGCTGTTGGGG - Intergenic
957705772 3:83780950-83780972 CTCATCCCTTTTGCCCCAAGAGG + Intergenic
961499115 3:127318488-127318510 AGCATCTCTGTGGCCTGATGAGG + Intergenic
963382871 3:144553875-144553897 CTCATCTCTCTTGCCTGTAGTGG + Intergenic
967077045 3:186012853-186012875 TTCATCCCTGTTTCCAGATGAGG - Intergenic
967730753 3:192904746-192904768 CTCATCCCTGTTTTCTGATGGGG - Intronic
968563722 4:1298302-1298324 CCCATCCCTGTGACCTGAAGAGG + Intronic
968769496 4:2495274-2495296 CTTATCCCTGTTGCCTAGCGAGG + Intronic
969881452 4:10177579-10177601 CTCATACCTGTAGCCTCAAGGGG - Intergenic
971420084 4:26466773-26466795 CTCATCCCTAGGGCCTGGTGTGG - Intergenic
971554263 4:27993257-27993279 CTTCACTCTGTTGCCTGATGTGG - Intergenic
978102682 4:104862160-104862182 CTGATCCCTGCTGACTGATCAGG + Intergenic
978817738 4:112928699-112928721 CTCTTCCCTGTGTCCTCATGTGG - Intronic
979635686 4:122952599-122952621 CTCATCCTGTTTGCCAGATGAGG + Intronic
986022766 5:3820447-3820469 TTCATGCCTGTTGCCTGGAGGGG + Intergenic
986879654 5:12154183-12154205 CTGACCCCTGCTTCCTGATGGGG + Intergenic
990522440 5:56593117-56593139 CCCAGCTCTGTGGCCTGATGTGG - Intronic
993167209 5:84372732-84372754 ATTATCCCTGTTGACAGATGAGG - Intronic
995496563 5:112750428-112750450 CTCATCACTAATGCCTCATGTGG - Intronic
997655912 5:135554154-135554176 CTCGCCCCTGTTCCTTGATGGGG + Intergenic
999239604 5:150119932-150119954 CTCATGCCTCTGGCCTGGTGGGG - Intronic
1001822118 5:174718632-174718654 CTTCTCCCAGTTGCCTGGTGGGG - Intergenic
1002356358 5:178632509-178632531 CTCTCCCCTGTTGCCTTGTGAGG - Intergenic
1003998217 6:11565475-11565497 ATCATCGCTGATGCCTGATGGGG - Intronic
1004140176 6:13010932-13010954 ATCAGCCCTGCTGCCTGCTGAGG + Intronic
1004816242 6:19314419-19314441 TGCATTCCTGTTGCCTAATGAGG - Intergenic
1008774111 6:55014798-55014820 CTCATCCCTACTTCCTCATGAGG + Intergenic
1009915930 6:69996066-69996088 TTCATCTTTGTGGCCTGATGAGG + Intronic
1009979310 6:70708267-70708289 TTCATCCCTGTTGTCTCAAGTGG + Intronic
1011339351 6:86295839-86295861 CTCATACCTGTTACTTGATGGGG - Intergenic
1013283851 6:108663717-108663739 CTCATCACTGCTGCGTGACGTGG - Exonic
1014140811 6:117939845-117939867 TGCATCCTTGTTGCCTGGTGGGG + Intronic
1018945927 6:168346546-168346568 CTCCTCCCTGTTGCGGGGTGGGG - Intergenic
1020131872 7:5563243-5563265 CCCTTCCCTGGTGGCTGATGGGG + Intronic
1020718561 7:11711538-11711560 CTGATGCCAGTTTCCTGATGAGG - Intronic
1021675927 7:23080903-23080925 CTCTTCCCTGTTGCCTAATTTGG - Intergenic
1021766839 7:23958128-23958150 CTCATCTCTGTTCCCTGGGGTGG + Intergenic
1022014842 7:26340726-26340748 ATCATTCCTGTTGTTTGATGTGG + Intronic
1022257621 7:28675046-28675068 CTCTTCCCTGTAGCCATATGTGG + Intronic
1022440275 7:30427454-30427476 CACAACCCTGTGGCCTGGTGTGG + Intronic
1023787230 7:43719911-43719933 CTCCTCCCTGTTCTGTGATGTGG - Intronic
1024030475 7:45456026-45456048 CCCCTCCCTGGTGCCTGCTGTGG - Intergenic
1024222551 7:47299857-47299879 CTCATCCCTGTCTCCAGGTGAGG - Intronic
1026266164 7:68797755-68797777 CTCATCCCAGTTTACAGATGGGG - Intergenic
1027486606 7:78769562-78769584 CTGATCTCTGTTTTCTGATGGGG - Intronic
1029158851 7:98536948-98536970 TTCATCCCTGTTGCTGGAAGTGG + Intergenic
1029243664 7:99182742-99182764 TTTTTCCCTGTGGCCTGATGTGG - Intronic
1030574657 7:111271176-111271198 CTCCTTCCTGTTGCCATATGAGG + Intronic
1032688661 7:134260670-134260692 CTCACCCCTGCTGCTTGTTGGGG + Intronic
1033639300 7:143245760-143245782 CTCCTCCCTGTGTCCTCATGTGG - Intronic
1034529633 7:151687781-151687803 CTCATCCCTGTGGAATGTTGGGG + Intronic
1035557521 8:577988-578010 CTCACCCCTGCTGCATGAGGTGG - Intergenic
1037598523 8:20374254-20374276 CTCTTCACTGTTTCCTGATGTGG - Intergenic
1043872678 8:85452147-85452169 CTCATTCCTGTTTACAGATGAGG - Intergenic
1044328457 8:90888471-90888493 CTCATTTCTTTTGCCTGAAGTGG + Intronic
1047194341 8:122707926-122707948 CTCATCCCTTCTGCCCCATGAGG - Intergenic
1047373630 8:124276340-124276362 CTCATGCCTGTAGTCTGAGGTGG - Intergenic
1048275472 8:133062552-133062574 CTCTTCCCTCTTGCCTGACCCGG - Intronic
1048646613 8:136428034-136428056 CTCCTTCCTTTTGCCTGAAGAGG + Intergenic
1049580749 8:143409491-143409513 CGCAGCCCTGCTTCCTGATGCGG + Intergenic
1049776230 8:144406664-144406686 CTCTGCACTGCTGCCTGATGTGG + Intronic
1050271479 9:3950405-3950427 CTCATACATCTTGCTTGATGTGG + Intronic
1053255151 9:36610713-36610735 CTCTCCCCTGTATCCTGATGTGG - Intronic
1054810736 9:69431741-69431763 CTCATCTCTCTTGGCAGATGAGG + Intronic
1056000107 9:82206383-82206405 ATCATCCCTGTTTCTAGATGAGG + Intergenic
1056297355 9:85206145-85206167 CTCATGCCTGTGGCTTGGTGAGG - Intergenic
1060109114 9:120894100-120894122 GTCGTCCCTGTTGACAGATGAGG - Intronic
1061934369 9:133849274-133849296 CTCATCCCTGCTACCTGGAGGGG + Intronic
1062728214 9:138091225-138091247 CTCATCCATGTTGCCACAAGCGG - Intronic
1186124365 X:6397100-6397122 CTCCTCCCTGTGTCCTCATGTGG + Intergenic
1187683330 X:21791269-21791291 ATCATCCCTGTTTTCAGATGAGG + Intergenic
1189107761 X:38255445-38255467 CTCCTCCCTGTTCCTTAATGTGG + Intronic
1191887615 X:65905068-65905090 CTCCAGCCTGTTGCCTGCTGAGG + Intergenic
1197431197 X:126367146-126367168 CTCATCACTGTTTCCTCAGGTGG - Intergenic
1198275559 X:135095278-135095300 TTCACCCCTGCTGCCTGAAGTGG - Intergenic
1198310962 X:135425451-135425473 TTCACCCCTGCTGCCTGAAGTGG + Intergenic
1199058816 X:143329111-143329133 CTAATCCCTGTGGCCTGAAGTGG + Intergenic
1201888811 Y:18919103-18919125 CTCATGTCTGATGCATGATGTGG + Intergenic