ID: 1101881828

View in Genome Browser
Species Human (GRCh38)
Location 12:108630901-108630923
Sequence CAGGCCCAGGATTCAGCCGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 213
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 199}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101881823_1101881828 3 Left 1101881823 12:108630875-108630897 CCACAGCTGTCTTGCTGATCAGG 0: 1
1: 0
2: 2
3: 22
4: 199
Right 1101881828 12:108630901-108630923 CAGGCCCAGGATTCAGCCGATGG 0: 1
1: 0
2: 0
3: 13
4: 199
1101881822_1101881828 17 Left 1101881822 12:108630861-108630883 CCAGAAGGCAGGAACCACAGCTG 0: 1
1: 0
2: 11
3: 48
4: 412
Right 1101881828 12:108630901-108630923 CAGGCCCAGGATTCAGCCGATGG 0: 1
1: 0
2: 0
3: 13
4: 199
1101881821_1101881828 26 Left 1101881821 12:108630852-108630874 CCTAAACTTCCAGAAGGCAGGAA 0: 1
1: 0
2: 5
3: 61
4: 573
Right 1101881828 12:108630901-108630923 CAGGCCCAGGATTCAGCCGATGG 0: 1
1: 0
2: 0
3: 13
4: 199

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101881828 Original CRISPR CAGGCCCAGGATTCAGCCGA TGG Intronic
900710244 1:4108916-4108938 CAGAGCCAGGATACAGACGACGG + Intergenic
902747628 1:18483837-18483859 CAGGGCCAGGAAGGAGCCGAGGG + Exonic
902896537 1:19484290-19484312 CAGGCCCTGGATCCAGCATATGG - Intronic
903317653 1:22521129-22521151 CAGGACCAGGATTCAGGCCCAGG - Intronic
903539241 1:24087449-24087471 CAGGCCGAGGGGTCAGGCGATGG - Intronic
903732447 1:25506416-25506438 CCAGCCCAAGATTCAGCCAAGGG - Intergenic
905389661 1:37628391-37628413 CAAGGCCAGGACTCAGCCCAGGG - Intronic
906501591 1:46345059-46345081 CAGGCCCAGGAGGCAGGGGATGG - Exonic
912549086 1:110472939-110472961 CAGGCCCAGGATTCAGACTCAGG - Intergenic
912569363 1:110610158-110610180 CAGGCCCTGCCTTCAGCAGAGGG + Intronic
913957940 1:143320751-143320773 CAGGGCCAGGGTTCAGACCAGGG + Intergenic
914052249 1:144146109-144146131 CAGGGCCAGGGTTCAGACCAGGG + Intergenic
914126948 1:144820432-144820454 CAGGGCCAGGGTTCAGACCAGGG - Intergenic
922404465 1:225298148-225298170 CAGGCCTAGGATGCAGGCAAAGG + Intronic
1064407888 10:15080680-15080702 CTGGCCCAGGGTTCAGCCAGTGG + Intronic
1064874991 10:19983856-19983878 CATGCCCAGGACTCACCTGAGGG - Intronic
1066961884 10:42232919-42232941 CAGGGCCAGGGTTCAGACCAGGG + Intergenic
1067055086 10:43045446-43045468 CAGGCCCTGGATGCTGCCGGGGG - Intergenic
1067267456 10:44757717-44757739 CAGGCCCAGACTACAGCTGAGGG - Intergenic
1070835355 10:79444428-79444450 CCGGCCCAGGTTTCTGCAGAAGG + Intronic
1072742284 10:97916598-97916620 CAGCCCCAGGATTCAGACTGAGG + Intronic
1074753215 10:116606567-116606589 CAGTCCCAGGATCCAGGCCATGG - Intronic
1076699830 10:132265625-132265647 CTGGGTCAGGATTCAGCCGCAGG + Intronic
1076861859 10:133141591-133141613 CAGGCCCAGGAGCCACCCGCAGG + Intergenic
1077077655 11:708714-708736 CAGGCCCAGGAAAGAGCCAAGGG + Intronic
1077143480 11:1034965-1034987 CTGGCCAAGGGATCAGCCGAGGG - Intronic
1077154329 11:1084732-1084754 CATCCCCAGGATGCAGCCCACGG - Intergenic
1077582161 11:3423382-3423404 CAGGCCCAGGAGCGAGCCCACGG + Intergenic
1078517232 11:12033122-12033144 CAGGGCCATGATTCAGACGTGGG - Intergenic
1078672714 11:13379014-13379036 CAGGCCCAGGACTCAGACCCAGG - Intronic
1083199115 11:61109071-61109093 CAGGGCCAGAATTCAGCCCAGGG - Intronic
1083271989 11:61577323-61577345 CAAGCCCAGGATGCAGGCCAGGG + Intronic
1083631362 11:64097163-64097185 CAGGCTCAGGATGCTGCAGAGGG - Intronic
1083936608 11:65872855-65872877 CTGGCTCAGGAATCCGCCGAAGG - Exonic
1083998844 11:66285124-66285146 AAGGCCCAGGACTCAGCCCCAGG + Intronic
1084154690 11:67307044-67307066 CAGGCCCAGGGTGCAGCTGGGGG - Exonic
1084239078 11:67806199-67806221 CAGGCCCAGGAGCGAGCCCACGG + Intergenic
1085128217 11:74016512-74016534 CAGGCCCAGGAATCAGAACAAGG + Intronic
1086955783 11:92933463-92933485 CAGGAGCAGGATTCAGGCAAAGG + Intergenic
1087262556 11:96027095-96027117 AATGCCCAGGATTGAGCTGATGG + Intronic
1089513880 11:119019087-119019109 CAGCCCGGGGATTCCGCCGAGGG - Intronic
1090996304 11:131868835-131868857 AAGGCCCAGGTTACAGCAGAGGG - Intronic
1092409767 12:8243828-8243850 CAGGCCCAGGAGCGAGCCCACGG + Intergenic
1094493392 12:30975284-30975306 CAGGCCCAGGAGGCAGGCAAAGG - Intronic
1096497161 12:52045285-52045307 CAGCCCCAGGATTCTGCTGCAGG + Intronic
1098356559 12:69617871-69617893 AAGGCCCAGGATTCTGCCTGTGG - Intergenic
1099068978 12:78021778-78021800 CTGGTACAGGAGTCAGCCGATGG - Exonic
1101316710 12:103635566-103635588 CAGGCCCATGCCTCAGCCCAGGG + Intronic
1101881828 12:108630901-108630923 CAGGCCCAGGATTCAGCCGATGG + Intronic
1104464958 12:128982809-128982831 CAGGCCCAGGAGGCAGACAAGGG + Intronic
1105029741 12:132874354-132874376 CAGGACCAGCATTCAGCGCAAGG + Intronic
1107014357 13:35696537-35696559 CAGCCCCAGGCTTCAGCAGAAGG - Intergenic
1107078074 13:36345650-36345672 CAGGCCCAGAATTAAGTCGGAGG + Intronic
1107432098 13:40349403-40349425 CAGGCCCAGGGATCAGAGGAGGG + Intergenic
1108689099 13:52846506-52846528 CAGGCCCGGGATGCAGACGAGGG - Exonic
1113708220 13:112447512-112447534 CAGGCCCAGGTCTCATCAGAAGG - Intergenic
1114833557 14:26175791-26175813 CATGCGCAGGATGCAGCCGCAGG - Intergenic
1115088866 14:29550094-29550116 CAGTCCCAGGTTTCAGCCTTGGG - Intergenic
1119742924 14:77026126-77026148 GAGCCCCCGGACTCAGCCGAGGG - Exonic
1121445075 14:93973665-93973687 CAGGGCCAGGAGGCAGCAGAAGG - Intronic
1122142064 14:99668476-99668498 CAGACCCAGGATTCAGACCCGGG + Intronic
1122177287 14:99930282-99930304 CAGGCCCAGGTTTCAGTTGTTGG + Intronic
1123104753 14:105835744-105835766 CAGACCAAGGCTCCAGCCGATGG + Intergenic
1202930442 14_KI270725v1_random:29323-29345 CAGGGCCAGGGTTCAGACCAGGG - Intergenic
1123421908 15:20142087-20142109 CAGGGCCAGGGTTCAGACCAGGG + Intergenic
1123443173 15:20304548-20304570 CAGGGCCAGGGTTCAGACCAGGG - Intergenic
1123531136 15:21148627-21148649 CAGGGCCAGGGTTCAGACCAGGG + Intergenic
1125388554 15:39166090-39166112 CAGGCCCAGCAATGAGCCCAGGG - Intergenic
1127556354 15:60091277-60091299 CAAGCCCAGGTTTCAGCCTGGGG - Intergenic
1129673819 15:77621765-77621787 CAGGCCCAGGCAGCAGCCGCAGG - Intronic
1131400463 15:92121541-92121563 GATGTCCAGTATTCAGCCGAGGG + Intronic
1132747840 16:1444350-1444372 AAGGCCCAAGCTACAGCCGAGGG - Exonic
1132890620 16:2202622-2202644 CAGGCCCAGGAGTCTGGAGAGGG + Intergenic
1133821785 16:9243577-9243599 CAGAACCAGGCTTCAGGCGAGGG + Intergenic
1134868384 16:17629529-17629551 CAGGTCCAGGATACAGATGAGGG - Intergenic
1136375062 16:29860509-29860531 TAGGACCAGGATTCAGCCCAGGG + Intronic
1136718085 16:32301134-32301156 CAGGGCCAGGGTTCAGACCAGGG + Intergenic
1136723069 16:32339411-32339433 CAGGGCCAGGGTTCAGACCAGGG + Intergenic
1136773889 16:32861012-32861034 CAGGGCCAGGGTTCAGACCAGGG - Intergenic
1136836460 16:33507404-33507426 CAGGGCCAGGGTTCAGACCAGGG + Intergenic
1136841390 16:33545410-33545432 CAGGGCCAGGGTTCAGACCAGGG + Intergenic
1136862934 16:33713597-33713619 CAGGGCCAGGGTTCAGACCAGGG - Intergenic
1136896720 16:34000507-34000529 CAGGGCCAGGGTTCAGACCAGGG + Intergenic
1138216165 16:55207210-55207232 CAGGCCAAGGATCCAGCCTAAGG + Intergenic
1141744021 16:85913900-85913922 CAGGCCCAGGCTTCTGCAGCCGG + Intronic
1142108604 16:88319316-88319338 CAGGCCCCTGACTGAGCCGAAGG + Intergenic
1142130333 16:88429169-88429191 CAGCCCCAGGTTTCACCCCACGG + Exonic
1142412010 16:89921669-89921691 GACGCCCAGGTTTCAGCAGAGGG - Intronic
1203003362 16_KI270728v1_random:178353-178375 CAGGGCCAGGGTTCAGACCAGGG - Intergenic
1203008343 16_KI270728v1_random:216631-216653 CAGGGCCAGGGTTCAGACCAGGG - Intergenic
1203076309 16_KI270728v1_random:1123123-1123145 CAGGGCCAGGGTTCAGACCAGGG - Intergenic
1203134970 16_KI270728v1_random:1714760-1714782 CAGGGCCAGGGTTCAGACCAGGG - Intergenic
1203146644 16_KI270728v1_random:1807705-1807727 CAGGGCCAGGGTTCAGACCAGGG + Intergenic
1203151555 16_KI270728v1_random:1845707-1845729 CAGGGCCAGGGTTCAGACCAGGG + Intergenic
1142469115 17:152912-152934 CAGGTCTAGGATGCAGCTGAGGG + Intronic
1147869762 17:43579018-43579040 CAGGCCCAGGAGCCAGGGGAAGG - Intronic
1149486572 17:57046893-57046915 CAGGTCCTGGAGGCAGCCGAGGG - Intergenic
1150592881 17:66578714-66578736 CAGGCCCAGGATGCAGAGGTGGG - Intronic
1155152550 18:23134870-23134892 CAGGCCAAGGATGCAGCCCCCGG - Intronic
1156116654 18:33794181-33794203 TGGGCCCAGAATTCAGCTGAAGG + Intergenic
1157198561 18:45639864-45639886 CAGCCCCACGATTGAGCCAATGG - Exonic
1160114186 18:76062069-76062091 CAGGCCCAAGAGTTAGCCCACGG - Intergenic
1160533246 18:79577488-79577510 CACACCCAGGATGAAGCCGAGGG - Intergenic
1161357790 19:3828667-3828689 CACACCCAGGATTCTGCCTAAGG - Intronic
1161927651 19:7313068-7313090 CAGGCCCAGGATAGAGGGGAAGG - Intergenic
1165847235 19:38826055-38826077 CTGTCCCAGGATTCATCGGATGG - Intronic
1166046346 19:40233070-40233092 CAGGCCCAGGGTCCAGCGGGAGG + Exonic
1202691646 1_KI270712v1_random:98533-98555 CAGGGCCAGGGTTCAGACCAGGG + Intergenic
925802097 2:7611437-7611459 CAAGCCCTGGATTCAGCGGGAGG - Intergenic
927150529 2:20192844-20192866 CAGACCCAGGAGGCAGCAGATGG - Intergenic
927658432 2:24971682-24971704 CAGGCCCGGGTCTCAGCCGAGGG - Intronic
927672543 2:25081285-25081307 AAGGCGCAGGTTTCAGCTGATGG - Intronic
927791997 2:26017581-26017603 CAGGGCCAGGATTCAGAGCAGGG + Intergenic
928027965 2:27755148-27755170 GGGGCCCAGCATTCAGCTGACGG + Intergenic
929061335 2:37927463-37927485 CAGGACCAGGTTTCAGCAGGTGG - Intronic
933954742 2:87355417-87355439 CAGGGCCAGGGTTCAGACCAGGG - Intergenic
934238938 2:90251643-90251665 CAGGGCCAGGGTTCAGACCAGGG - Intergenic
934274256 2:91565067-91565089 CAGGGCCAGGGTTCAGACCAGGG + Intergenic
934323058 2:91984194-91984216 CAGGGCCAGGGTTCAGACCAGGG - Intergenic
934461372 2:94214980-94215002 CAGGGCCAGGGTTCAGACCAGGG - Intergenic
937574183 2:123399075-123399097 CAGACCCAAGATTCAGACTACGG + Intergenic
937988558 2:127649720-127649742 CAGACCCAGGGTTCACCAGACGG + Intronic
938087150 2:128409139-128409161 CAGGACCAGGACCCAGCCCAAGG - Intergenic
941654719 2:168130946-168130968 CAAGCCCAGGATCCAGTCCAGGG - Intronic
941832983 2:169982929-169982951 CAGACCCACAATTCAGCCCATGG - Intronic
946182676 2:217958386-217958408 CATGCTCAGGATGCAGACGACGG - Intronic
948513761 2:238489983-238490005 CAGGCCCAGGATTCTGAGCAGGG + Intergenic
948604043 2:239123516-239123538 CAGGCTCAGGATTGAGGAGATGG - Intronic
948931614 2:241135879-241135901 CAGGGCCAGGACCCAGCTGAGGG - Exonic
1168800029 20:638706-638728 CAGAGCCAGGATTCAGCCTAGGG - Intergenic
1172148984 20:32777481-32777503 CAGGCCCTGGATGAAGGCGAAGG + Intronic
1173166603 20:40690457-40690479 CCGGCCCAGGGAGCAGCCGACGG - Intergenic
1174178136 20:48657734-48657756 CTGGCCGAGGATTCAGCCCTGGG - Intronic
1174376485 20:50129709-50129731 CAGCCCCAGCAGTCAGCCTAAGG + Intronic
1175924235 20:62464226-62464248 CGGTGCCAGGATTCCGCCGAGGG - Exonic
1178820772 21:35973118-35973140 CAGGCTAAGGATTCAGCACAGGG + Intronic
1179787404 21:43737666-43737688 CAGGGCCAGGAGCCTGCCGACGG + Intronic
1179922162 21:44513271-44513293 AAGGCCCCGGCTTCAGCAGAGGG - Intronic
1181348252 22:22236438-22236460 CAGGCCCAGGATTCATCTTGAGG + Intergenic
1181354872 22:22291771-22291793 CAGGGCCAGGGTTCAGACCAGGG + Intergenic
1181450156 22:23014377-23014399 CAGTTCCAGGATTCAGCGGGGGG + Intergenic
1181926705 22:26365507-26365529 CTGTCCCAGGATGCAGCGGATGG - Exonic
1182609363 22:31533705-31533727 CATGCCCAAGATTCAGAAGAAGG - Intronic
1183365586 22:37405013-37405035 GGGACCCAGGATTCAGCCCAGGG - Intronic
950553645 3:13682449-13682471 CAGGCCCAGGGGACAGCCGGGGG - Intergenic
951548645 3:23854488-23854510 CAGGCCAAGGATGGACCCGAAGG - Intronic
953458474 3:43062719-43062741 CTGGCCAAGGATGCAGGCGATGG + Intergenic
954295820 3:49674115-49674137 GAGGCCCAGGACTCAGCCCACGG + Exonic
954392959 3:50276923-50276945 CGGGCGCAGGATTCAGCCGGAGG + Intronic
955073055 3:55588087-55588109 CAGGCTCTGGGTTCAGCCTAGGG - Intronic
958171689 3:89947276-89947298 CAGCCCCTGGTTTCAGCCAAGGG - Intergenic
961050551 3:123742114-123742136 GAGGCCCAGGACTCAGCCCTAGG - Intronic
961299834 3:125915716-125915738 CAGGCCCAGGAGCGAGCCCACGG - Intergenic
961500439 3:127329019-127329041 CAGGACCAGGATTCAGACCTAGG + Intergenic
963603147 3:147393927-147393949 CAGGCCCCGGATTCAGGTCAGGG + Intronic
966853893 3:184181018-184181040 CAGGCCCAGGATCCTGCCCTGGG - Intronic
968673296 4:1863860-1863882 CAGGACCAGGCTTCAGTCGTGGG - Intergenic
969371076 4:6732017-6732039 CAGGGCCAGGACTCAGCCGCAGG + Intergenic
969850040 4:9948749-9948771 TGGGACCAGGATTCAGCAGAGGG - Intronic
970774858 4:19661693-19661715 CAGGGCCAGGATTCAGGAAAAGG + Intergenic
982821469 4:159945164-159945186 GAGGCCCAGGTTTCAGCTAATGG + Intergenic
983061501 4:163166453-163166475 CAGGCCGGCGATTCAGCCGGTGG + Exonic
986072423 5:4298651-4298673 CAGGCACAGGATTCAGGTGAAGG + Intergenic
986732121 5:10642653-10642675 CAAGCCCAGCATGCACCCGAGGG - Intronic
987061420 5:14247204-14247226 TTGGCCCAGGCTCCAGCCGAGGG - Intronic
997600993 5:135138269-135138291 GAGGGCCAGGATTCAGCCCGCGG - Intronic
999037292 5:148366549-148366571 CAGGAGCAGGATTCAACCCAAGG - Intergenic
999088463 5:148913800-148913822 CAGGGCCAGGACTCAGCTGGGGG - Intergenic
999636591 5:153629304-153629326 AAGGCCCCGGAGTCAGCAGAGGG - Intronic
1001800066 5:174535320-174535342 CATGCCCAGGGTCCAGCCCAGGG - Intergenic
1004352092 6:14898845-14898867 CAGGCCCAGAATAAAGCCAAGGG - Intergenic
1005268097 6:24134361-24134383 CAGGCACAGGCTGCAGCTGAGGG + Exonic
1006059797 6:31411577-31411599 CAGGCTCAGGATTCTGTCGGAGG - Intronic
1006592917 6:35171255-35171277 CAGAGCCAGGATTCAGCCCTAGG - Intergenic
1006932129 6:37694914-37694936 TAGGGCCAGGATTCAGCCATAGG - Intronic
1007697175 6:43741107-43741129 AAGGCCCAGGATCCAGGCCAGGG + Intergenic
1009741146 6:67747750-67747772 CAGGTCCAGGATTCAGGCAGTGG + Intergenic
1013833394 6:114301650-114301672 CAGGTCAAGGATTCAGCCCCAGG - Intronic
1015984568 6:138872329-138872351 TAGTCCCAGGATTTAGCAGAAGG - Intronic
1019014030 6:168866928-168866950 CAGGCTCAGTGTTCAGCCAAGGG - Intergenic
1022524087 7:31026477-31026499 CAGCCCCTGGATCCAGCCTAGGG - Intergenic
1023636860 7:42220597-42220619 CAGTCCCAGGATTATGCTGAGGG - Intronic
1023704176 7:42922961-42922983 CAGCCCCAAGATTCAACTGATGG + Intronic
1025286587 7:57667385-57667407 CAAGCCCAGGATTCAGGGCAGGG - Intergenic
1026480200 7:70772127-70772149 CAGGCCCTGTTTGCAGCCGATGG - Intronic
1029274878 7:99398087-99398109 AAGGCCAAGGATTCGGCCTAGGG + Intronic
1029485351 7:100836648-100836670 ACGGCCCAGGAGTGAGCCGAGGG - Intronic
1034526909 7:151670396-151670418 TAGGCCCAGGTTGCAGCTGAAGG - Intronic
1035107952 7:156457897-156457919 CAGGACCAGGATTCAAAAGAAGG + Intergenic
1035245261 7:157558989-157559011 CAGGCCAAGGAGGGAGCCGAGGG + Intronic
1035264353 7:157682839-157682861 GACGCCCAGGATGCAGGCGAGGG + Exonic
1036626565 8:10477617-10477639 CAGGCCCAGAATTCTAACGAGGG - Intergenic
1036850138 8:12194917-12194939 CAGGCCCAGGAGCGAGCCCATGG + Intergenic
1036942518 8:13065251-13065273 CACGCCCAGGATTCATTTGAAGG + Intergenic
1039375085 8:37024858-37024880 CAGGTCCAGGACTCAGCAGGTGG + Intergenic
1040079919 8:43275519-43275541 CAGGCCCAGGCCCCTGCCGAGGG - Intergenic
1040999825 8:53439510-53439532 CTGTCCCAGGATTCATCAGATGG + Intergenic
1045944960 8:107785249-107785271 CAGGGCCAGGAGTCAGCAAATGG - Intergenic
1049205286 8:141360810-141360832 CAGGCCCAGGTCTCAGCTGAGGG - Intronic
1049622257 8:143603832-143603854 CAAGCACAGGTGTCAGCCGAAGG - Intergenic
1053691846 9:40590617-40590639 CAGGGCCAGGGTTCAGACCAGGG - Intergenic
1054272958 9:63046874-63046896 CAGGGCCAGGGTTCAGACCAGGG + Intergenic
1054303102 9:63391583-63391605 CAGGGCCAGGGTTCAGACCAGGG - Intergenic
1054401881 9:64718093-64718115 CAGGGCCAGGGTTCAGACCAGGG - Intergenic
1054435487 9:65202408-65202430 CAGGGCCAGGGTTCAGACCAGGG - Intergenic
1054494906 9:65819279-65819301 CAGGGCCAGGGTTCAGACCAGGG + Intergenic
1055103303 9:72487154-72487176 CAGGTCCAGGAATCAGGGGATGG + Intergenic
1056630755 9:88291100-88291122 CAGGCCCTGGAGACAGCAGAGGG - Intergenic
1057653593 9:96936349-96936371 CAGGACCAGGCAGCAGCCGAGGG - Intronic
1203622508 Un_KI270749v1:136752-136774 CAGGGCCAGGGTTCAGACCAGGG - Intergenic
1186153169 X:6697968-6697990 CAGTCCCACGATTCAGTCCAAGG - Intergenic
1194457149 X:94118921-94118943 CAGGTCCAGGAATCAGGGGATGG + Intergenic
1201403861 Y:13631151-13631173 CTGTCCCAGGATTCATCAGATGG - Intergenic