ID: 1101881944

View in Genome Browser
Species Human (GRCh38)
Location 12:108631667-108631689
Sequence AGGTGTAACTTGGTTCTTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 109}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101881944_1101881955 26 Left 1101881944 12:108631667-108631689 CCACCAAGAACCAAGTTACACCT 0: 1
1: 0
2: 1
3: 13
4: 109
Right 1101881955 12:108631716-108631738 TCCAGAGGCAGTAAGGTACTTGG 0: 1
1: 0
2: 1
3: 16
4: 170
1101881944_1101881949 -2 Left 1101881944 12:108631667-108631689 CCACCAAGAACCAAGTTACACCT 0: 1
1: 0
2: 1
3: 13
4: 109
Right 1101881949 12:108631688-108631710 CTGTTGGAACCCAAACTTGCTGG 0: 1
1: 0
2: 0
3: 10
4: 83
1101881944_1101881953 19 Left 1101881944 12:108631667-108631689 CCACCAAGAACCAAGTTACACCT 0: 1
1: 0
2: 1
3: 13
4: 109
Right 1101881953 12:108631709-108631731 GGCCTGATCCAGAGGCAGTAAGG 0: 1
1: 0
2: 1
3: 18
4: 159
1101881944_1101881952 11 Left 1101881944 12:108631667-108631689 CCACCAAGAACCAAGTTACACCT 0: 1
1: 0
2: 1
3: 13
4: 109
Right 1101881952 12:108631701-108631723 AACTTGCTGGCCTGATCCAGAGG 0: 1
1: 0
2: 0
3: 20
4: 192

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101881944 Original CRISPR AGGTGTAACTTGGTTCTTGG TGG (reversed) Intronic
900970085 1:5987158-5987180 AGGTGTTACCAGCTTCTTGGTGG + Intronic
906007385 1:42487706-42487728 AGGTCTCTCTTGGCTCTTGGAGG - Intronic
908484737 1:64579610-64579632 AGGTAGAACTTGCTTCTTGATGG + Intronic
908810018 1:67971787-67971809 AGGTGAAACGTGTTTCTTGTAGG + Intergenic
909040872 1:70649874-70649896 ATGTGGAAAATGGTTCTTGGAGG + Intergenic
912243181 1:107933244-107933266 AGGTTTAATTTGGTTGGTGGTGG + Intronic
917586632 1:176433749-176433771 AGGTGACACTTCCTTCTTGGAGG + Intergenic
919495525 1:198261980-198262002 GGGTGAAAATTGGTTCTTTGTGG - Intronic
919545009 1:198904909-198904931 TGGTGTAACTTTTTTTTTGGGGG + Intergenic
921344592 1:214169195-214169217 ATGTGTAACTTGGTTATCAGCGG - Intergenic
921728477 1:218550765-218550787 GGGTAAAAATTGGTTCTTGGTGG + Intergenic
1069134133 10:64742816-64742838 GGGTGTAATTTAGTTCTTGTGGG + Intergenic
1072410042 10:95193505-95193527 AGGTGTAACTTGGTTACTGGTGG - Intergenic
1072978769 10:100081695-100081717 AGGTGGACCTTGGATTTTGGCGG - Exonic
1075657686 10:124172988-124173010 AGGTTTAACTTGAGTCTTGACGG + Intergenic
1077367975 11:2168910-2168932 AGGCTTAACCTGGTTCTGGGCGG + Intronic
1077425823 11:2476568-2476590 AGGTGATTCTTGGTTCTTTGAGG + Intronic
1077542007 11:3151139-3151161 AGGTGTTCCTTGGCTCGTGGCGG - Intronic
1079142918 11:17824985-17825007 AGGTGTTCCTTGGATTTTGGAGG - Intronic
1080805018 11:35644943-35644965 AGGGATGACTTGGTTCTTTGTGG + Intergenic
1087674029 11:101138420-101138442 AGGTGTAACTTGGGACTTGATGG + Intergenic
1088099523 11:106140392-106140414 AAGTGAAAATTGGTTCTTTGAGG + Intergenic
1095337940 12:41050976-41050998 AAGTGAAAGTTGGTTCTTGTGGG - Intronic
1097292561 12:57930684-57930706 AGGTGAAAATTGATTCTTGAGGG - Intergenic
1101124740 12:101620450-101620472 AAGTGTAACTTGGCTCCAGGAGG - Intronic
1101228455 12:102713678-102713700 GGGTGAAAATTGGTTCTTGGAGG + Intergenic
1101665052 12:106805231-106805253 TTGTATAACTTGGTTGTTGGTGG - Intronic
1101881944 12:108631667-108631689 AGGTGTAACTTGGTTCTTGGTGG - Intronic
1109277593 13:60319805-60319827 AGTTGAAACTTGGTTCTTGAAGG - Intergenic
1109663600 13:65498332-65498354 AGGTGAAAAATGATTCTTGGAGG - Intergenic
1113385516 13:109844311-109844333 AAGTGTAACTTTGTTGTTAGTGG + Intergenic
1118554351 14:66998124-66998146 ATGTGGAACTGGCTTCTTGGGGG + Intronic
1119127655 14:72142712-72142734 TGTTGTAAATTGGTTCTTGAGGG - Intronic
1119247891 14:73128647-73128669 AGGGGTCACAAGGTTCTTGGTGG + Intergenic
1123099028 14:105783242-105783264 AGCTGTAATTTGGGCCTTGGTGG + Intergenic
1127845079 15:62862929-62862951 ATGTGTATCTTGGTTTTTGTTGG - Intergenic
1128530293 15:68440475-68440497 AAGTGTAAGTTGTTTTTTGGAGG - Intergenic
1130533161 15:84763130-84763152 AGGGGCAGCTTGGTCCTTGGGGG + Intronic
1131268549 15:90932957-90932979 AGGTTGAAGATGGTTCTTGGGGG - Intronic
1132470722 16:101471-101493 AAGGGTAACTTGGTTCTTTCGGG + Intronic
1133646789 16:7772021-7772043 AAGTAAAAATTGGTTCTTGGGGG + Intergenic
1134687215 16:16167248-16167270 AAGTGGTACTTGGTTGTTGGAGG + Intronic
1137711532 16:50570299-50570321 AGGCAGAAATTGGTTCTTGGGGG + Intronic
1138418480 16:56884757-56884779 AGGTGTAACTTTTTTGTGGGGGG + Intronic
1141566129 16:84903248-84903270 GGGGGTACCTGGGTTCTTGGGGG - Intronic
1142811510 17:2397638-2397660 AGGTGTAACTGGGTCCTTCCTGG - Intronic
1153277572 18:3382828-3382850 TGGTGAAACTTGATTATTGGTGG + Intergenic
1153921298 18:9792723-9792745 AGGTGGTACCTTGTTCTTGGGGG + Intronic
1157889643 18:51403458-51403480 AGGTGAAAATTGATTCTTAGGGG + Intergenic
1159045491 18:63366229-63366251 AGGTGTGATTTATTTCTTGGCGG - Intronic
1160219881 18:76967026-76967048 ATGTGTTATTTGGTTGTTGGAGG + Intronic
1160219884 18:76967065-76967087 ATGTGTTATTTGGTTGTTGGAGG + Intronic
1160219887 18:76967104-76967126 ATGTGTTATTTGGTTGTTGGAGG + Intronic
1160219890 18:76967143-76967165 ATGTGTTATTTGGTTGTTGGAGG + Intronic
1160219893 18:76967182-76967204 ATGTGTTATTTGGTTGTTGGAGG + Intronic
1160219896 18:76967221-76967243 ATGTGTTATTTGGTTGTTGGAGG + Intronic
1160249706 18:77191123-77191145 AGCTGTAATTTGTTTTTTGGGGG + Intergenic
1160376789 18:78419927-78419949 AGGAGAAACTTGGAGCTTGGAGG - Intergenic
1161554888 19:4935553-4935575 TTTTTTAACTTGGTTCTTGGAGG + Intronic
1162261494 19:9538227-9538249 GGGTGAAAGTTGGTTCTAGGGGG - Intronic
1162732479 19:12727142-12727164 AGGTGTGACTTTGGCCTTGGGGG - Intergenic
1166145668 19:40833200-40833222 AGATGTAACATGGCTATTGGAGG + Intronic
1166149777 19:40864102-40864124 AGATGTAACATGGCTATTGGAGG + Intronic
1166319005 19:42004959-42004981 CAGTGTAGCTTGGTGCTTGGAGG - Intronic
1167313735 19:48752331-48752353 AGGAGCATCTTGGTTCCTGGAGG + Intronic
1168669461 19:58229649-58229671 AGGGGTAACTGGGGTGTTGGGGG + Intronic
928325501 2:30316417-30316439 GGGTGAAAATTGGTTCTTGGGGG - Intronic
929804200 2:45130336-45130358 AGTGGTAACTTGGATGTTGGTGG - Intergenic
929905672 2:46044180-46044202 AAGAGTAACTTGGTGCTTAGTGG + Intronic
933388080 2:81636823-81636845 AGGTGAAACATGTTTCTTGTAGG - Intergenic
934550735 2:95260010-95260032 AGGTGAAACCTGGATCCTGGAGG + Intergenic
936696618 2:114957473-114957495 AGGGGAAACTTTGTTGTTGGTGG + Intronic
939606309 2:144259023-144259045 AGGAATAACTTGTTTCTTTGGGG - Intronic
940143525 2:150521919-150521941 AGGTGAATATTGGTTCTTGGAGG - Intronic
943525046 2:189006088-189006110 GGGTTAAAATTGGTTCTTGGGGG - Intronic
1170385049 20:15807190-15807212 AGTTGGAGCTTGGTTATTGGTGG - Intronic
1171287907 20:23957286-23957308 AGGTGGAACCTGGTGCTTGAGGG - Intergenic
1172989897 20:39027082-39027104 GGGTGGAAACTGGTTCTTGGAGG - Intronic
1173363515 20:42365491-42365513 AGATGAAAATTGGTTCTTGGTGG - Intronic
1177385901 21:20409094-20409116 AGGTGTATATTGGTTCAGGGTGG - Intergenic
1178378864 21:32091935-32091957 TGGTGTCATTTGGCTCTTGGTGG + Intergenic
951279430 3:20730301-20730323 AGGTGAAGCATGTTTCTTGGAGG + Intergenic
952399491 3:32950226-32950248 AGATAAAACTTGGCTCTTGGAGG + Intergenic
953431601 3:42844870-42844892 TGGTGCCACCTGGTTCTTGGTGG + Intronic
954972712 3:54664518-54664540 AGGAGTAACTTGGTCTTTGTGGG + Intronic
959914749 3:111804193-111804215 GGGTGAAAATTGGTTCTTGGGGG - Intronic
963853979 3:150235433-150235455 AGGTGTAAGCTGGACCTTGGAGG + Intergenic
964937765 3:162113459-162113481 GGATTTAACTTGGCTCTTGGAGG - Intergenic
966370320 3:179244892-179244914 AGGTGGAACTTGGCACTTTGTGG - Intronic
971087385 4:23294667-23294689 ATGTGTAATTTGTTTCTTGCTGG + Intergenic
974586345 4:63883722-63883744 AGGTGAAGCTTGTTTCTTGTAGG + Intergenic
988711240 5:33777785-33777807 AGTTGTAACTTTTTTTTTGGTGG - Intronic
989341472 5:40380144-40380166 AGGTCTAACATGAATCTTGGAGG + Intergenic
993394374 5:87365098-87365120 AGGTGGCTCTTGATTCTTGGAGG + Intronic
998070363 5:139193159-139193181 GGGTGAAAATTGATTCTTGGGGG + Intronic
999198422 5:149799022-149799044 AGGTCACACTTGGCTCTTGGTGG - Intronic
999680453 5:154054406-154054428 ATGAGTAAATTGGTCCTTGGTGG + Exonic
1001017236 5:168152669-168152691 TGGTTTAATTTGGTTTTTGGAGG - Intronic
1006968384 6:38013747-38013769 AGGTGTAACCTGGACATTGGAGG - Intronic
1013343146 6:109235234-109235256 AGGTGGAAAGTGGTTCTTGGAGG - Intergenic
1014346288 6:120273315-120273337 AGGAGTAAGTTGGTTATTGTGGG - Intergenic
1014818819 6:125962802-125962824 GGGTGAAAATTGGTTCTTGGTGG + Intronic
1016164358 6:140922123-140922145 AGGTGGAACATTGTGCTTGGGGG - Intergenic
1022792680 7:33704554-33704576 AGGGGTAACTTGATTGTAGGGGG + Intergenic
1023277350 7:38534191-38534213 GGCTGAAAATTGGTTCTTGGTGG - Intronic
1023570628 7:41567709-41567731 AGGTGCCCCTTGGTTCTTGTGGG - Intergenic
1025982103 7:66414994-66415016 AACTGTAACTTGGTTCTAGAAGG + Intronic
1025990825 7:66495294-66495316 AACTGTAACTTGGTTCTAGGAGG + Intergenic
1028726845 7:94097489-94097511 GGGTGAAAATTGGTTCTTGGGGG - Intergenic
1028929248 7:96394782-96394804 AGGTGAAATATGTTTCTTGGGGG + Intergenic
1034763448 7:153695466-153695488 GGGTGAAAATTGGCTCTTGGAGG + Intergenic
1035358046 7:158290578-158290600 GGGTTTAACTTGGTTGGTGGGGG + Intronic
1035947901 8:3985685-3985707 AGTTGTTACTTGATTCTTGGAGG - Intronic
1036411875 8:8509578-8509600 AGGTATAACTTGGTAATTGGTGG + Intergenic
1050704130 9:8376726-8376748 ATGTGTCACTTGTTTCTTGTAGG - Exonic
1053241038 9:36495840-36495862 AGATGTACATTGGTTTTTGGCGG - Intergenic
1060543473 9:124447196-124447218 AGGTGTAACCTGGGTGCTGGGGG + Intergenic
1060791575 9:126489043-126489065 GGGTGTCACTTGGTTGTGGGTGG + Intronic
1186906330 X:14114915-14114937 GGGTGAAAATTGGTTCTTGTTGG - Intergenic
1187021116 X:15382976-15382998 AGGGGAAAATTGGTTCGTGGAGG - Intronic
1189771316 X:44430525-44430547 AGGTGTAGCTGGCTTCTGGGAGG - Intergenic
1190859678 X:54332351-54332373 AGGTTTTACTTGATTCTTTGAGG - Intronic
1201855942 Y:18541998-18542020 AGGTGTAGGTTGGATCTGGGAGG + Intergenic
1201877379 Y:18778387-18778409 AGGTGTAGGTTGGATCTGGGAGG - Intronic