ID: 1101882292

View in Genome Browser
Species Human (GRCh38)
Location 12:108633792-108633814
Sequence GCTTCTCTGCTTTAGTGACA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 212
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 189}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101882290_1101882292 -10 Left 1101882290 12:108633779-108633801 CCCAGAAGAAGTGGCTTCTCTGC 0: 1
1: 0
2: 2
3: 23
4: 462
Right 1101882292 12:108633792-108633814 GCTTCTCTGCTTTAGTGACAAGG 0: 1
1: 0
2: 1
3: 21
4: 189
1101882288_1101882292 -1 Left 1101882288 12:108633770-108633792 CCTCGTGGGCCCAGAAGAAGTGG 0: 1
1: 0
2: 0
3: 10
4: 129
Right 1101882292 12:108633792-108633814 GCTTCTCTGCTTTAGTGACAAGG 0: 1
1: 0
2: 1
3: 21
4: 189
1101882282_1101882292 30 Left 1101882282 12:108633739-108633761 CCACCGTGCTCAGCAGAGCATGG 0: 1
1: 0
2: 3
3: 34
4: 282
Right 1101882292 12:108633792-108633814 GCTTCTCTGCTTTAGTGACAAGG 0: 1
1: 0
2: 1
3: 21
4: 189
1101882285_1101882292 27 Left 1101882285 12:108633742-108633764 CCGTGCTCAGCAGAGCATGGGAC 0: 1
1: 0
2: 0
3: 19
4: 188
Right 1101882292 12:108633792-108633814 GCTTCTCTGCTTTAGTGACAAGG 0: 1
1: 0
2: 1
3: 21
4: 189

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101882292 Original CRISPR GCTTCTCTGCTTTAGTGACA AGG Intronic
900010731 1:104954-104976 GATTCTATTCTTAAGTGACATGG - Intergenic
900781908 1:4624038-4624060 GCTTTTCTGTTTTGGTGGCAGGG - Intergenic
900858462 1:5205400-5205422 GCTTTTCTCCTTTATTGAGAGGG - Intergenic
901522715 1:9797632-9797654 TCTTCTCTTCTTTTGAGACAGGG - Intronic
904001676 1:27342324-27342346 TCTTCTCTGCTGTTTTGACACGG - Intronic
906804766 1:48770023-48770045 GCTTGCCACCTTTAGTGACAGGG + Intronic
908419514 1:63946247-63946269 TCCTCTCTGCTTTACTGCCAAGG + Intronic
908711524 1:67020945-67020967 GCTTCTCAGCTTAAGTACCAAGG + Intronic
909964735 1:81894757-81894779 GCTTTTCTGCTGGAGTAACAAGG - Intronic
911587734 1:99710313-99710335 GCTTTTGCTCTTTAGTGACAAGG - Intronic
916819843 1:168387417-168387439 GGCTCTCTGCTTTAGTGACGAGG + Intergenic
918606752 1:186436896-186436918 TCTTCTCTGCTTCTGTGACCGGG - Intergenic
919149021 1:193671513-193671535 TATTCTCTGCTTTAGTGTCTAGG - Intergenic
919529420 1:198697937-198697959 ACTACTCTGCTATGGTGACAGGG - Intronic
919579035 1:199348490-199348512 GCTTCCCTGATTTAGGGAAAAGG + Intergenic
920102477 1:203525972-203525994 GTTTGTTTGCTTTAGGGACAGGG - Intergenic
922037804 1:221866403-221866425 GCATCTCTTCTTGGGTGACAGGG + Intergenic
923202378 1:231724969-231724991 GAATCTCTCCTATAGTGACATGG - Intronic
1062766320 10:68558-68580 CCATCTCTGCTTTACTGACATGG + Intergenic
1063191599 10:3699749-3699771 GCCTCTTTAATTTAGTGACATGG + Intergenic
1063536466 10:6888839-6888861 GCTTCTCTGATTTATGGACCTGG + Intergenic
1065253339 10:23839399-23839421 GTTTCTCTTCTTTAGTGAGAAGG + Intronic
1067900308 10:50233261-50233283 GCTTTTCTGTTTTACTGACTAGG - Exonic
1067938305 10:50630373-50630395 TCTTGTCTCCTTCAGTGACACGG + Intergenic
1069286728 10:66723842-66723864 GTTTCTCTGCTTCCCTGACAAGG - Intronic
1069592668 10:69651657-69651679 GCTCCTCTGCTTTCGTCCCAGGG + Intergenic
1073367954 10:102959581-102959603 GTTTGTTTGCTTTAGAGACAGGG + Intronic
1074039558 10:109774791-109774813 GCTTCTGTGCTTTAGAGAAATGG + Intergenic
1074117166 10:110464913-110464935 GCTACTGTGGTTTATTGACAGGG - Intergenic
1079598239 11:22279950-22279972 ACTTCTCTGCTTCATTGACTGGG + Exonic
1080429051 11:32181917-32181939 ATTTCTCTGTTTTAGAGACAGGG + Intergenic
1080975315 11:37332923-37332945 GTTTCTTTGTTTTAGAGACAAGG + Intergenic
1089205339 11:116757044-116757066 CATTCTCTGCTTTAATCACAAGG - Intronic
1089361951 11:117896745-117896767 TTTTTTATGCTTTAGTGACATGG + Intergenic
1093220942 12:16419782-16419804 GCCTTTCTGCTTCAGTGATATGG + Intronic
1093737965 12:22645317-22645339 TACTCTCTGCTTTAGTTACAAGG - Intronic
1094054411 12:26254716-26254738 ACTTTTCTGATGTAGTGACATGG - Intronic
1094202083 12:27804771-27804793 GGTTCTCTGCCTTAGTTAAAGGG - Intergenic
1094625212 12:32117162-32117184 GCTTCTCCCTTTTGGTGACAGGG - Intronic
1094627593 12:32139430-32139452 GCTTATCTAGTTTAGGGACATGG - Intronic
1095254955 12:40023689-40023711 ACTTCTCATCTCTAGTGACATGG + Intronic
1097322846 12:58245368-58245390 GGTTCTCTTGTTAAGTGACATGG - Intergenic
1097937391 12:65268777-65268799 TCTACTCTGCTTTAATAACATGG + Intergenic
1098020076 12:66145621-66145643 GCTTCTCTCCTATAGTGAAAGGG - Intronic
1100173548 12:92004570-92004592 GCTTGCTTGCTTTAGAGACAGGG + Intronic
1100590674 12:96025401-96025423 GCTTCTTTGTTTTACTTACAAGG - Intronic
1101882292 12:108633792-108633814 GCTTCTCTGCTTTAGTGACAAGG + Intronic
1102376350 12:112424593-112424615 GCATCTCTGCTTTGATGACAAGG - Intronic
1103644418 12:122379564-122379586 GCTTCTTTGTTTTTGAGACAAGG - Intronic
1104076337 12:125393051-125393073 GCCTCTCTCTTTTACTGACATGG - Intronic
1106530263 13:30583993-30584015 TTTTCTCTTCTTTAGAGACAAGG - Intronic
1112194389 13:97210916-97210938 GCTGCTGTGATTTAGTGACTTGG + Intergenic
1114261678 14:21041487-21041509 GCTTCTCTGCCTTGGTGTCTCGG + Intronic
1121685195 14:95830544-95830566 TCTTCCCTTCTCTAGTGACAGGG - Intergenic
1123965335 15:25450172-25450194 TCTTCTCTGCTGGAGTCACATGG - Intergenic
1125884076 15:43215320-43215342 GCTGCTCTCCTGTAGTCACACGG + Exonic
1126412328 15:48385156-48385178 GCTGCTCTGCTTCACTGACCAGG + Intergenic
1128202873 15:65824534-65824556 TGATCTCTGCTTCAGTGACAGGG - Intronic
1128695088 15:69755786-69755808 GTTTCTCTGGATTAGTCACAGGG - Intergenic
1129699875 15:77761716-77761738 GCTTCTCAGCTTCAGGGACATGG + Intronic
1130767931 15:86891695-86891717 CCTTCTCTACTCAAGTGACATGG + Intronic
1130906746 15:88246108-88246130 GGTTATCAGCTTTAGAGACAGGG - Intronic
1131021361 15:89102032-89102054 GCTTCAGTGCTTTACTTACAAGG - Intronic
1131995904 15:98132690-98132712 TTTTCTCTGTTTTAGAGACAAGG - Intergenic
1132289994 15:100693368-100693390 TCATCTCTACTTTAGAGACAAGG + Intergenic
1133631037 16:7621886-7621908 GCTTTTCTGCTAAAATGACAGGG - Intronic
1134867694 16:17623095-17623117 GCTGCTCTGCTGTAAAGACAAGG + Intergenic
1135982668 16:27160495-27160517 GTTTCTTTGTTTTAGAGACAGGG + Intergenic
1136005549 16:27326651-27326673 TCTTTTTTGCTTTAGAGACAGGG - Intronic
1137940554 16:52679661-52679683 TCTTCTCTGCTTTAATGTTAGGG + Intergenic
1138314741 16:56060257-56060279 GTTTCTCTGGTTGTGTGACAGGG - Intergenic
1139135036 16:64192358-64192380 GCTTCCCAGCTTTAGAGACCAGG - Intergenic
1139867684 16:70076181-70076203 TCTTCTTTTCTTTAGAGACAGGG + Intergenic
1140387648 16:74555681-74555703 TCTTCTTTTCTTTAGAGACAGGG - Intronic
1142439122 16:90083145-90083167 ATGTCTCTGCTTTACTGACAAGG - Intronic
1143927270 17:10383038-10383060 GTTTCTCTCCTGTAGTGCCAGGG - Intergenic
1145067032 17:19768619-19768641 CTGTCTCTGCTTTACTGACAAGG + Intergenic
1151170755 17:72243902-72243924 GCTTCTCTGATATGGTGGCATGG + Intergenic
1152959190 18:68129-68151 TCGTCTCTGCTTTATTGCCATGG + Intronic
1154355041 18:13618630-13618652 ACTTCACTGCTTTATGGACATGG - Intronic
1156725599 18:40122614-40122636 GTTTCTCTGATTTATTGACAGGG + Intergenic
1157728512 18:49983924-49983946 GCTGCTCTGGGTTAGTCACATGG + Intronic
1157886099 18:51368386-51368408 GCTTCTCTTCTTTAGTTTTAGGG + Intergenic
1158299763 18:56038134-56038156 GCTTCTCATCTTTATTGAAATGG + Intergenic
1158545794 18:58395417-58395439 GCCTCTGTGCTTCTGTGACATGG - Intronic
1158717172 18:59890729-59890751 GCTTTTCTGGTTTAGTGTTATGG - Intergenic
1161785978 19:6325851-6325873 GTTTGTTTGTTTTAGTGACAGGG - Intronic
1162025691 19:7892829-7892851 TCTTCTCTTTTTTAGAGACAGGG + Intronic
1162117605 19:8440707-8440729 GTTTGTTTGCTTTAGAGACAGGG - Intronic
1163313318 19:16526768-16526790 GCTTTTCTTTTTTAGAGACAAGG + Intronic
1165223823 19:34339890-34339912 GCTTCTCTGCAGCAGGGACATGG - Exonic
1168080658 19:54007887-54007909 TTTTCTCTTTTTTAGTGACAAGG - Intronic
926538357 2:14142993-14143015 GTTTATCTCCTATAGTGACAGGG + Intergenic
927908461 2:26879528-26879550 GCTTCTCTTCTCTTGTGACTTGG + Intronic
929697049 2:44126713-44126735 GCATCTCTGATTTAGGGTCAAGG - Intergenic
932288669 2:70556702-70556724 GCTTCTCTGCTATACTGCCTCGG + Intergenic
932426810 2:71642998-71643020 GCTTATCTGGTTTAGTGGGAAGG - Intronic
934881649 2:97986770-97986792 GCTTCTATGGATTGGTGACATGG - Intronic
934939012 2:98486473-98486495 GCATCGCTGCTTTGGGGACAGGG - Intronic
934950915 2:98574858-98574880 GCTTTTCTGTTCTGGTGACAGGG - Intronic
935078060 2:99765398-99765420 GCTTCTCTGCAATTGCGACAGGG - Intronic
936673538 2:114687316-114687338 GCTTCTCTAGTGTAGTCACAAGG + Intronic
937210741 2:120268160-120268182 GCATCTCTGCTTTTGCCACATGG + Intronic
937489793 2:122353910-122353932 TTTTGTCTGTTTTAGTGACAGGG - Intergenic
937644036 2:124246028-124246050 GCTTCTCTGCTTCATTGGCCAGG - Intronic
943681178 2:190769759-190769781 GTATCTCTGCTTTAGGGACCTGG + Intergenic
943681328 2:190771002-190771024 GTATCTCTGCTTTAGGGACCTGG + Intergenic
943764234 2:191643610-191643632 GCTTCTCTGCTTCATAGATAAGG - Intergenic
944205033 2:197149547-197149569 GATACTCTCCTTTAGTGACATGG + Intronic
944472263 2:200066609-200066631 GCTTCTCTCCTCTAGTCAAAGGG + Intergenic
948883994 2:240874036-240874058 GCTCATCTCCTTCAGTGACAAGG + Exonic
948974863 2:241457879-241457901 GGTTCTCTGCTGTTGTGGCACGG + Intronic
1169033357 20:2430531-2430553 GCTTCTCTCCTTTGGTGACAAGG - Exonic
1169254948 20:4090109-4090131 GTTTGTTTGCTTTAGAGACAGGG + Intergenic
1169722568 20:8694978-8695000 TCTTTTCTGCATTAGGGACAAGG - Intronic
1174919752 20:54689258-54689280 GCTTCTTTTCTTTTGAGACAGGG + Intergenic
1175162187 20:57017075-57017097 GCTACTATGTTTTAGAGACAGGG - Intergenic
1175644218 20:60657671-60657693 GCTTCCCGGCTTTACTGAGAAGG - Intergenic
1177802989 21:25846857-25846879 TCTTCTGTGCTTTAGTGATGGGG - Intergenic
1177834030 21:26170471-26170493 GCTTCTCTGCATTAAAGACTTGG + Intronic
1178611358 21:34084293-34084315 GGTTTTCTGCCTTAGTCACATGG + Intronic
1178780901 21:35602905-35602927 GCTTCTCTGCCTGCTTGACAGGG - Intronic
1181299486 22:21869235-21869257 GTTTCTCTGTTTTAGAGACAGGG - Intergenic
1181312932 22:21955275-21955297 GCTTCTCTGCTTCTCTGGCAAGG + Intergenic
1181346040 22:22221347-22221369 GCTTCTCTGCTTCTCTGGCAAGG + Intergenic
1182273493 22:29170562-29170584 TCTTCTTTGTTTTAGAGACAGGG - Intergenic
1183076788 22:35432479-35432501 CCTGCTCTGCTCTACTGACAAGG - Intergenic
1183093232 22:35537813-35537835 GCTTCTCTTCTTTAGAGACCCGG + Intergenic
950089513 3:10285560-10285582 GCTTCTCTGCTTGAGTGAGCTGG + Intronic
950935493 3:16834939-16834961 GCTTATTTGTTTTAGAGACAGGG + Intronic
954853142 3:53620110-53620132 ACTTCTCTGCTTTAAAGAGAGGG - Intronic
956806371 3:72817232-72817254 TCTTCTCTCCTTCAGTGACACGG + Exonic
960851095 3:122055401-122055423 GCTTCTCTGCTGCTGTAACAGGG + Exonic
965165755 3:165193473-165193495 GCTTTTCTGCTTTGGGGACCTGG - Intronic
965379697 3:167973128-167973150 CTTTCTCTGCTTTAATGAAAGGG - Intergenic
965493976 3:169375024-169375046 TCTTCTTTTCTTTAGAGACAGGG - Intronic
967202288 3:187082859-187082881 CCTTCTCTGCTTCAGAGAAAGGG - Intergenic
968266496 3:197367333-197367355 GCTTCTCTGCCTTGTAGACACGG + Intergenic
969295054 4:6264974-6264996 TCTTCTCTTCTTTTGAGACAGGG + Intergenic
975587147 4:75961535-75961557 GCTTCTCTGATTTAGTGTGCCGG - Intronic
978817373 4:112923920-112923942 GCACCTCTGCTTTAATGACTTGG + Intronic
980286645 4:130787313-130787335 AATTTTCTGCTTTATTGACATGG - Intergenic
980565830 4:134539200-134539222 TTTTCTCTGCTTTAGTGTCTTGG + Intergenic
981223989 4:142270022-142270044 GTTTCTCTGCCTTAGTGAAAAGG + Intronic
983972141 4:173888735-173888757 GCTTCTCTTTTTAAGTGACCTGG + Intergenic
985122037 4:186653779-186653801 GCTTCTGGGCTACAGTGACACGG + Intronic
987475595 5:18388666-18388688 GCTTTGCAGCTTTAGAGACAGGG + Intergenic
988649672 5:33134300-33134322 TCTTTTCTGCTTTAGTATCAGGG + Intergenic
989004152 5:36791156-36791178 ATTTCTCTCATTTAGTGACATGG + Intergenic
991411261 5:66347758-66347780 CATTCTCTGCTTTAGTCTCAGGG + Intergenic
992070711 5:73146066-73146088 GCTTTTGTGCTATATTGACATGG + Intergenic
992583321 5:78204771-78204793 CCTTCTCTGCCTCAGTGACAGGG - Intronic
994205284 5:97027873-97027895 GCTGCTCAGTTTTAGTGAGATGG + Intronic
994582767 5:101667520-101667542 GCTTGTCTTCTTTGGTGACTTGG - Intergenic
995363074 5:111321101-111321123 GTTTCTCTGCTTTGGTTACCAGG + Intronic
996163196 5:120192822-120192844 ATATCTTTGCTTTAGTGACAGGG + Intergenic
997891807 5:137683536-137683558 GTTTCTCTGCTCTAGGGAAAAGG + Intronic
998393039 5:141800076-141800098 GTCACTCTGCTTTACTGACATGG + Intergenic
998875527 5:146595148-146595170 GCTTCAGTGCTTTGGTGACAAGG + Intronic
1001937018 5:175712532-175712554 GCTTTCCTGCTTGTGTGACATGG - Intergenic
1003794307 6:9582683-9582705 GTTTATCGGATTTAGTGACATGG + Intergenic
1004000991 6:11597083-11597105 ATTTCTATGGTTTAGTGACATGG - Intergenic
1004153792 6:13148666-13148688 GCTCCTCTGTGTTAATGACATGG + Intronic
1005349917 6:24924079-24924101 GCTGGTCTGCTTTACAGACATGG + Intronic
1007359285 6:41343471-41343493 TCTTTTCTGTTTTAGAGACAAGG - Intronic
1008069346 6:47083956-47083978 GCTCCTCTGGTTTTTTGACATGG + Intergenic
1010846158 6:80711117-80711139 TCTTCTCTGCTGTAGTGACTGGG - Intergenic
1012526917 6:100188894-100188916 CCTACTCTGCTTTAGTCACTTGG + Intergenic
1014398916 6:120963123-120963145 GCTGCTCTGTTTTATTGAGAAGG + Intergenic
1014477304 6:121889355-121889377 ACTTCTCTCCTATAGTCACAGGG + Intergenic
1015413033 6:132916004-132916026 TCTTTCCTGTTTTAGTGACAAGG + Intergenic
1017643050 6:156513003-156513025 GCTTCTTTGCTTCAGTTTCAGGG - Intergenic
1018718600 6:166555171-166555193 GCATCTCTTCATAAGTGACAGGG + Intronic
1021235934 7:18142597-18142619 GTTTCTCTGCTTTAATCAGAGGG + Intronic
1021621099 7:22551876-22551898 GCATCGCTGCTTCAGTGAGAAGG - Intronic
1023411802 7:39895211-39895233 TGTTCTCTGTTTTAGTGCCACGG + Intergenic
1023805910 7:43872891-43872913 GCCTCTCTGCTTTACTCATAGGG - Intronic
1024876478 7:54029895-54029917 GCTTATATACTTTAGTGAAAGGG + Intergenic
1032602905 7:133318407-133318429 GTTTCTCTGCTTTTGTAACTGGG + Intronic
1034567337 7:151925980-151926002 GGTTCTTAGCTTTTGTGACACGG + Intergenic
1034756600 7:153627615-153627637 GCTTCTATGTTTTGGTGGCAGGG - Intergenic
1039303000 8:36230446-36230468 GCTTCTCTACCTTACTGACTGGG - Intergenic
1041899294 8:62963402-62963424 GCTTCTGGGCTTTAGCAACATGG - Intronic
1042793277 8:72632563-72632585 GCCTGTCTGCTTCAGTGACTAGG - Intronic
1043990565 8:86748157-86748179 TCTTCTCTGCTTAGGTGGCATGG - Intergenic
1045109217 8:98924090-98924112 GCTTCTCTGCTTTCTTCAAATGG - Intronic
1047665761 8:127089387-127089409 GCTTCTCTGTTTTACTTATAAGG - Intergenic
1048357761 8:133667458-133667480 TCCTCTGTGCTTTGGTGACATGG - Intergenic
1050115524 9:2259465-2259487 GCTGCTCTGCTTGAATCACATGG + Intergenic
1050687397 9:8187506-8187528 GCTTCTGTGGTTTAGTGAGTGGG + Intergenic
1051347305 9:16163815-16163837 GTTTCTCTTCTCTAGTGAAATGG - Intergenic
1051392578 9:16581810-16581832 GCTTTCCTGCTTTATTAACAAGG - Intronic
1052599841 9:30612391-30612413 GCTTCCCTGCTCTGGTGACCTGG + Intergenic
1054966930 9:71039554-71039576 CCTTCTCTACTTTTGTGAGAAGG - Intronic
1056238420 9:84619083-84619105 CCTTCTCTGCTCTGGGGACAAGG + Intergenic
1057198646 9:93128794-93128816 GTTTCTGTGCTTTTGTGACTAGG - Intronic
1058803528 9:108567712-108567734 GCTTCTCTGCTTTGCTGAACTGG - Intergenic
1059562619 9:115349812-115349834 ACTGCTCTGCTTGAGTGTCATGG - Intronic
1062738922 9:138155750-138155772 TCGTTTCTGCTTTACTGACATGG - Intergenic
1185455539 X:308671-308693 ACTTTTCTTCTTTAGAGACAGGG - Intronic
1186066307 X:5769463-5769485 GCTTTTCTGCTTTATTGAACTGG + Intergenic
1190427123 X:50344437-50344459 GCTTCTCTGCTTTGGGAAGAGGG - Intronic
1192844882 X:74896228-74896250 GCTTTTCAACTTTGGTGACAAGG - Intronic
1193825742 X:86223939-86223961 GCTTGTATGTCTTAGTGACATGG + Intronic
1194858555 X:98965279-98965301 CCTTCTCTTTTTTTGTGACAGGG + Intergenic
1200966346 Y:9042653-9042675 TTGTCTCTGCTTTAGTGACATGG + Intergenic
1201746919 Y:17386287-17386309 GCTTCCCTGCTTTTGGGACTTGG - Intergenic
1201790372 Y:17833329-17833351 TTGTCTCTGCTTTAGTGAAAAGG + Intergenic
1201811182 Y:18072660-18072682 TTGTCTCTGCTTTAGTGAAAAGG - Intergenic
1202147090 Y:21809523-21809545 TTGTCTCTGCTTTAGTGACATGG - Intergenic
1202352020 Y:24003073-24003095 TTGTCTCTGCTTTAGTGACAAGG + Intergenic
1202518759 Y:25667046-25667068 TTGTCTCTGCTTTAGTGACAAGG - Intergenic