ID: 1101884379

View in Genome Browser
Species Human (GRCh38)
Location 12:108648871-108648893
Sequence CCGTGGGTAAGGAAGAAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 293
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 272}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101884379 Original CRISPR CCGTGGGTAAGGAAGAAGAA AGG Intronic
900526652 1:3132578-3132600 CCCTCGGTAAGGAGGAAGGAAGG - Intronic
900572482 1:3365358-3365380 CTGAGGGTCAGGAAGAGGAAAGG + Intronic
901972394 1:12918339-12918361 CTGTGGGTAAAGGAGAAGAGAGG - Intronic
902012785 1:13283423-13283445 CTGTGGGTAAAGGAGAAGAGAGG + Intronic
903057271 1:20644970-20644992 CAGAGGGTGAGGAAGGAGAACGG - Intronic
906004539 1:42457137-42457159 CCGTGGGTAAGCAGGAGGTAAGG - Intronic
906166253 1:43688649-43688671 TCGTGGGGCAGGAGGAAGAATGG + Intronic
906680216 1:47721200-47721222 CTGTGGGAGAGGAAGCAGAATGG - Intergenic
908127610 1:61046602-61046624 ACTTAGGTAAGTAAGAAGAAGGG + Intronic
909362033 1:74772050-74772072 CGGTGGGTAAAGAAGGAAAAAGG + Intergenic
910293200 1:85618350-85618372 CCCTGGGCAAGGAAAAAAAAAGG + Intergenic
910522790 1:88141780-88141802 CCAAGGGAAAGGAAGAAGAGTGG + Intergenic
911574307 1:99556846-99556868 CAGTAGGAAGGGAAGAAGAATGG - Intergenic
912248316 1:107984380-107984402 GAGAGGGAAAGGAAGAAGAAAGG - Intergenic
912879057 1:113390771-113390793 CCGCGGGTTAGGCTGAAGAAAGG - Intronic
913070632 1:115295276-115295298 GGATGGGAAAGGAAGAAGAATGG - Intronic
913566374 1:120076764-120076786 GAGTGGGAAAGGAAGATGAAAGG + Intergenic
913631757 1:120716785-120716807 GAGTGGGAAAGGAAGATGAAAGG - Intergenic
914287135 1:146237480-146237502 GAGTGGGAAAGGAAGATGAAAGG + Intergenic
914548167 1:148688222-148688244 GAGTGGGAAAGGAAGATGAAAGG + Intergenic
914618516 1:149383482-149383504 GAGTGGGAAAGGAAGATGAAAGG - Intergenic
915139396 1:153757822-153757844 CCTGGAGTCAGGAAGAAGAATGG - Intronic
916417213 1:164603068-164603090 GAGTGGGTATGGAAGAAGGAAGG - Intronic
916865766 1:168856426-168856448 CCAGGGGTTAGGAGGAAGAAAGG + Intergenic
917958367 1:180123494-180123516 CTTTGGGTAAAGAAGAAGAGTGG + Intergenic
918366438 1:183812872-183812894 CGGTGGGAAAGGGAGAGGAAAGG + Intronic
919640077 1:200038678-200038700 CTGAGGGGAAGCAAGAAGAAGGG - Intronic
919739938 1:200975313-200975335 CCGCGGGTAGGGAAGAAGGGAGG + Intronic
920429857 1:205911525-205911547 CAGTGGGTTTGGAAGATGAAAGG + Intergenic
920804231 1:209218102-209218124 CCATGGGGAAGGAAGAGTAAAGG + Intergenic
921871937 1:220150671-220150693 CCGTGCTTGAGGAGGAAGAATGG - Exonic
922176691 1:223202775-223202797 CAGTGGGTAAGTGTGAAGAATGG + Intergenic
922599251 1:226837140-226837162 CTGTGTGTAAGGAAAAAGGATGG - Intergenic
922858736 1:228797263-228797285 CCATGGGTGAGGATGAAGTAAGG - Intergenic
1063053210 10:2475646-2475668 CAAGGGGTCAGGAAGAAGAAGGG + Intergenic
1063501815 10:6562136-6562158 TCGTGGGTAAGGAAGAACGAAGG + Intronic
1065430480 10:25649705-25649727 CTGTGGGTTAGCAAGTAGAATGG + Intergenic
1067127114 10:43528068-43528090 CGGAGGCTAAGGCAGAAGAATGG - Intergenic
1067674633 10:48361715-48361737 CCAGGGGAAAGAAAGAAGAAAGG - Intronic
1069538151 10:69270963-69270985 CATTGGGTGAGGAAGAAGAATGG - Intronic
1069700608 10:70422170-70422192 CAGAGGGTAAGGAATATGAATGG - Exonic
1071661683 10:87509614-87509636 TGGTGAGAAAGGAAGAAGAATGG - Intronic
1073195715 10:101689573-101689595 CCCTGGGTAAGGCAGAAAACTGG + Intronic
1074885434 10:117689315-117689337 TCGAGGGTAAGGGGGAAGAAGGG + Intergenic
1076430787 10:130400625-130400647 CCTTGGGTAAGGAAGAACTGGGG - Intergenic
1079004282 11:16781302-16781324 CCCTGAGTAGGGAGGAAGAAAGG + Intronic
1079209049 11:18444429-18444451 CCGGGGGTAAGTAAAAGGAAAGG - Intronic
1080294147 11:30705597-30705619 TCGTGGGTAAGGAGGCAAAAAGG + Intergenic
1080447235 11:32348572-32348594 CCCAGGATAAGGAAGAAGAGAGG + Intergenic
1080459557 11:32441201-32441223 CCGGGAGTGAGGAAGAGGAATGG + Intergenic
1080886187 11:36370188-36370210 CCCTGAGTCAGGAAGAAGCATGG - Intronic
1083341652 11:61962176-61962198 GCGGGGGTAAGGGAGAAGTAAGG + Intronic
1083738937 11:64697547-64697569 GAGAGGGAAAGGAAGAAGAAAGG + Intronic
1084585702 11:70060833-70060855 CTGTGTGTAAGGAAAAAGGATGG + Intergenic
1086068173 11:82768662-82768684 CAATGGGTCAGGATGAAGAAGGG + Intergenic
1087899943 11:103628984-103629006 CAGAGGGTAAGGAACATGAATGG + Intergenic
1089012281 11:115141153-115141175 CGGTGGGGAAGGAAGAGGGAAGG - Intergenic
1089277390 11:117346910-117346932 AGGTGGGTAAAGAAGAAGAAGGG - Intronic
1089357365 11:117862616-117862638 CCTTGGTGAAGGAAGAAGATTGG - Intronic
1089514061 11:119020384-119020406 CCTTTGGTAAGCAAGAAGAGGGG + Intronic
1090182255 11:124710472-124710494 GAGTGGCTAAGGCAGAAGAATGG + Intergenic
1090766462 11:129880331-129880353 CTGTGGGGAATGAAGGAGAATGG - Intronic
1090968145 11:131616258-131616280 TCTTGGGTGAGGAAGGAGAAAGG - Intronic
1092410582 12:8250066-8250088 CCGAGGCTGAGGCAGAAGAATGG - Intergenic
1094045360 12:26160637-26160659 CTATGAGTAAGGAAGAAAAATGG - Intronic
1095587171 12:43862271-43862293 CCGTGGCTGAGGCAGGAGAATGG - Intronic
1096743175 12:53709383-53709405 CCATGAGTAAGGAAGAGAAATGG + Intronic
1097248083 12:57617646-57617668 GGGTGGGTAGGGAAAAAGAAGGG - Intronic
1098237962 12:68436327-68436349 CTGTGGGCAAGCAAGAAGAGAGG + Intergenic
1098532673 12:71558403-71558425 CCCTGGGCAAGGTAGAGGAAGGG - Intronic
1099742907 12:86664272-86664294 GAGAGAGTAAGGAAGAAGAAAGG - Intronic
1101063591 12:100996692-100996714 CAGTGGGGCAGGGAGAAGAATGG + Intronic
1101718726 12:107333039-107333061 CGGTTGTTAAGGAAGAACAAGGG + Intronic
1101884379 12:108648871-108648893 CCGTGGGTAAGGAAGAAGAAAGG + Intronic
1105830190 13:24157401-24157423 CGGAGGCTAAGGCAGAAGAATGG - Intronic
1107739658 13:43435837-43435859 CTGTGGTTGAGGCAGAAGAAAGG + Intronic
1109661935 13:65471600-65471622 CGGTTGGCAAAGAAGAAGAAAGG + Intergenic
1110336522 13:74338359-74338381 ATGTGAGTAAGAAAGAAGAAAGG + Intergenic
1113066043 13:106375118-106375140 CTGCTGGAAAGGAAGAAGAATGG - Intergenic
1114221929 14:20704443-20704465 CTGTGTGTAAGGAAAAAGAATGG - Intergenic
1114555833 14:23561852-23561874 CCGTGGATATGGAAGAACACAGG + Intronic
1114851632 14:26389372-26389394 CCCTGGGAAAGGGAGATGAAAGG + Intergenic
1115365682 14:32554313-32554335 TCTTGAGTAAGGAAGAAGAGAGG + Intronic
1116268442 14:42727584-42727606 CCAAGGGGAATGAAGAAGAATGG + Intergenic
1118110767 14:62716550-62716572 CAGTGGGTGAGGAGGAAGAAGGG - Intronic
1119882020 14:78107120-78107142 CCATGGGTAAGGAAGCACAGGGG - Intergenic
1120251534 14:82065524-82065546 CACAGGGTAAGGGAGAAGAAGGG + Intergenic
1121230519 14:92354253-92354275 GGGTGGGTAAGGCAGGAGAATGG - Intronic
1121492416 14:94369846-94369868 CCCTGGGGAAGGCAGGAGAAGGG + Intergenic
1125597057 15:40894021-40894043 CTTTGGGTAAGGGAGAAGAGTGG + Intergenic
1126158817 15:45589728-45589750 GCGAGAGTAAAGAAGAAGAAAGG - Intronic
1126251138 15:46569605-46569627 CCGTAGGTAAAGCAGAAGAATGG - Intergenic
1126586194 15:50290070-50290092 TCCTGGGTAAGAAAGAAGCAGGG - Intronic
1128260508 15:66229674-66229696 CTCTGGGGAAGGAAGAGGAATGG + Intronic
1129625983 15:77200125-77200147 CCGAGGAGGAGGAAGAAGAAGGG - Intronic
1130096126 15:80857464-80857486 CCAGGGGAAAGGAAGGAGAATGG + Intronic
1132839811 16:1973536-1973558 CAGTGGAGAAGGAAGGAGAAGGG + Intronic
1135467768 16:22701963-22701985 CGGTGGGAAAGGAAGAAGTCAGG - Intergenic
1141827605 16:86492129-86492151 CTGAGGGTAAGGAAGATGAGAGG + Intergenic
1142233845 16:88912187-88912209 CCTTGGGAAAGGAAGAGGCAAGG - Intronic
1142424219 16:89992462-89992484 CCGAGGGGAAGGGAGGAGAAAGG - Intergenic
1143177090 17:4961932-4961954 CCTTGGATAAGGGAGAAGTAGGG + Intronic
1143701525 17:8664254-8664276 CCATGGGAAATGAAGAAAAACGG - Intergenic
1144758898 17:17695959-17695981 CCCTGGGTGAGGAGGGAGAAAGG - Intronic
1146647729 17:34586222-34586244 GCATGGGCAAGGAAGAAGTAAGG - Intronic
1148964909 17:51426993-51427015 CTGTGGGTTCTGAAGAAGAAAGG + Intergenic
1149605245 17:57920053-57920075 CTGTGGATCAGGAATAAGAATGG - Intronic
1149849886 17:60028014-60028036 CCATGGAGAAGGAAGCAGAAAGG - Intergenic
1149860282 17:60118510-60118532 CCATGGAGAAGGAAGCAGAAAGG + Intergenic
1149930594 17:60750843-60750865 CAGTGGATAAGGAACAAGAAGGG - Intronic
1151080439 17:71323250-71323272 AGGTGGGGCAGGAAGAAGAAAGG + Intergenic
1152044986 17:77929789-77929811 CCCTGGGAGAGGAAGAAGGATGG - Intergenic
1152747662 17:82048806-82048828 ACCTGGGGAAGGAAGAAGTAGGG + Exonic
1152795286 17:82303443-82303465 CTGTGGGTAAGGAAGGAAAGGGG + Intergenic
1153080796 18:1222255-1222277 CCTTGAGTAAGCAAGAGGAATGG - Intergenic
1155741315 18:29291403-29291425 CCGTGGCTGAGGCAGGAGAATGG + Intergenic
1155872488 18:31044541-31044563 CCCAGGGTAAGAAAGCAGAAAGG + Intergenic
1156584136 18:38413300-38413322 CAGTTGGTGAGGAAGAAGAGAGG - Intergenic
1156996734 18:43478283-43478305 ACATGAGTAAGGTAGAAGAAGGG - Intergenic
1160095252 18:75865926-75865948 CCATGGGAAACGCAGAAGAAAGG + Intergenic
1161237290 19:3204380-3204402 CAGTGGGTAAGGAGGGACAAGGG - Intronic
1164259019 19:23553125-23553147 CTGTGTGTAAGGAAAAAGGATGG - Intronic
1164574699 19:29398933-29398955 AGGTGGGAAAGAAAGAAGAAAGG + Intergenic
1165205889 19:34185434-34185456 GTGTGGGTAAGGGTGAAGAAGGG + Intronic
1165355850 19:35303525-35303547 CCTTGGGCAGGGAAGAAGAATGG - Intronic
1165785669 19:38460354-38460376 CCCTGGGTAAGGAAGGACAATGG - Exonic
1165864053 19:38925338-38925360 CTGTGGGGAAGGAGGAAGAAGGG - Intronic
1168059389 19:53882732-53882754 CCCTGTGGAAGGAAGAAGGAGGG + Intronic
927307904 2:21594984-21595006 CCGTTGGTCAGCAAGAAAAATGG + Intergenic
927704870 2:25290837-25290859 CAGTGGGAAAGGAAGAGGCAGGG - Intronic
927908592 2:26880378-26880400 GCCAGGGTAAGGAAGCAGAAAGG + Intronic
930187554 2:48425594-48425616 CCCTGTGTTAGGAAGAATAATGG - Intergenic
930364278 2:50419560-50419582 CAGTGGGAAAGAAAAAAGAAAGG + Intronic
932330942 2:70897952-70897974 ACGTGAGAAAGGAAGAATAAAGG + Intergenic
933893003 2:86788559-86788581 CCCTGGATAAGGAAAAAGAAGGG + Exonic
934141566 2:89052233-89052255 CTGTGTGTAAGGAAAAAGCATGG - Intergenic
934227677 2:90148310-90148332 CTGTGTGTAAGGAAAAAGCATGG + Intergenic
934551900 2:95267872-95267894 CCAAGGGTAAGGAGGCAGAATGG - Intergenic
935442736 2:103121394-103121416 CAGTGTGTAAAGAAGGAGAAAGG + Intergenic
935558646 2:104538198-104538220 AAGTGGGGAGGGAAGAAGAAGGG + Intergenic
936937357 2:117851207-117851229 CAGTGGGTGAGGAAGAAAGATGG + Intergenic
937139008 2:119582202-119582224 CCATGGGAATGGAAGGAGAATGG + Intronic
939372568 2:141320870-141320892 ACGTGGGTAAGAAATAACAAAGG + Intronic
939548022 2:143577727-143577749 CTGTGGCTAAGGAAATAGAATGG + Intronic
940447938 2:153799778-153799800 CCATGGCTAAGGAAAAAGACTGG - Intergenic
941012977 2:160322304-160322326 CTCTGAGTATGGAAGAAGAAGGG + Intronic
941364817 2:164597621-164597643 CAATGGGTAGAGAAGAAGAAAGG + Intronic
941492028 2:166154248-166154270 CTCTTGGTAAGGAAGAAGGAAGG + Intergenic
942124070 2:172805533-172805555 CCTTGGGTTAAGATGAAGAATGG - Intronic
942373421 2:175310699-175310721 TCCTGGATAAGGAAGAGGAAAGG + Intergenic
942876385 2:180804785-180804807 CTCTGGCTAAGGAGGAAGAAAGG + Intergenic
943747789 2:191480164-191480186 CCCTGGGTAGGGAAGAAGGTAGG + Intergenic
944443774 2:199769168-199769190 CTGTGGGAAAGGATGAAAAATGG - Intronic
947243476 2:228020961-228020983 CAGTGGGTACAGAAGGAGAAGGG + Intronic
948182128 2:235990345-235990367 CTGTGGGTCAGGAATTAGAATGG + Intronic
1168754892 20:309660-309682 CTGTGGGTAAGGAGGCAGGAGGG - Intergenic
1169221305 20:3824624-3824646 CTGTGGGTTTGGAAGAAGAGCGG - Exonic
1169224600 20:3848080-3848102 CCATGAGAAAGGAAGGAGAAAGG + Intronic
1170447270 20:16441258-16441280 CCGTGGGTGAGAAACAAGAACGG - Intronic
1171399074 20:24860011-24860033 CAGAGGGTGAGGAAGAGGAACGG - Intergenic
1171970985 20:31565059-31565081 CGGAGGCTAAGGCAGAAGAATGG + Intronic
1173229557 20:41183552-41183574 CCCTGGGTAGGGGAGAAGGACGG + Exonic
1173255814 20:41393856-41393878 CCGGGGGTTGGGAAGAAGAAAGG - Intergenic
1173528096 20:43748208-43748230 GGGAGGGTAGGGAAGAAGAAAGG + Intergenic
1173951569 20:46997570-46997592 CCCTGGGGGAGGATGAAGAAGGG + Intronic
1177417646 21:20815275-20815297 CCGTAGGAAAGTGAGAAGAAAGG - Intergenic
1178162581 21:29937071-29937093 GTGTGTGTAAGGAAAAAGAAAGG - Intronic
1180627963 22:17207289-17207311 CCCTGGAGAGGGAAGAAGAATGG + Exonic
1180633640 22:17247075-17247097 GGGAGGCTAAGGAAGAAGAATGG + Intergenic
1180738303 22:18035076-18035098 CCTTGGGGAAGGCTGAAGAATGG + Intergenic
1180871197 22:19148295-19148317 TCGCTGGGAAGGAAGAAGAAGGG + Intergenic
1181595775 22:23913657-23913679 CCAGAGGGAAGGAAGAAGAAGGG - Intergenic
1182311401 22:29411099-29411121 TCCTGGATAAGGAAGAGGAAAGG + Intronic
1182630058 22:31678199-31678221 CTGTGGATAAGGAAGGAGGAGGG + Intronic
1183693365 22:39404039-39404061 CCATGGGGATGGCAGAAGAATGG + Intronic
952278892 3:31904150-31904172 AAGTGGGCAAGGAAGAAGCAGGG - Intronic
952711368 3:36435410-36435432 CCGTGGGTAGTTGAGAAGAAGGG - Intronic
952910815 3:38183712-38183734 GCTAGGGAAAGGAAGAAGAAAGG + Intronic
952981420 3:38739080-38739102 GGGTGGGTGAGGAAAAAGAATGG - Intronic
953840905 3:46389598-46389620 CTGTGTGTAAGGAAAAAGGATGG + Intergenic
954899771 3:54008818-54008840 CTGTGGGTAGGGAAGTAGCAGGG - Intergenic
956062037 3:65357473-65357495 GGGTGGGAAAGGAAGAACAAGGG - Intronic
956290256 3:67653953-67653975 CCGTGGGTCAAGGAGAAAAATGG - Intronic
957221642 3:77390152-77390174 GCGTGGTTAAGGTGGAAGAAGGG - Intronic
957982471 3:87526853-87526875 CAGTAGGTAAAGAGGAAGAAAGG - Intergenic
958077567 3:88702285-88702307 CAATAGGTAAGGAAGAAAAAAGG + Intergenic
960533163 3:118787983-118788005 CCTTGGGTCAGGGAGAATAAAGG - Intergenic
961563842 3:127749527-127749549 CAGTGAGTAAGGATGAATAAAGG - Intronic
961893858 3:130151581-130151603 CACTGGCTAAGGGAGAAGAAAGG + Intergenic
962411496 3:135144867-135144889 CCCAGGGTAAGGAGGAAGATAGG + Intronic
962743183 3:138378136-138378158 CCCTGGGTGAGGAGTAAGAAGGG - Intronic
968641081 4:1715371-1715393 CTGTGGGTCAAGAAGCAGAATGG + Intergenic
971543950 4:27860630-27860652 CAAAGGTTAAGGAAGAAGAAAGG - Intergenic
974549036 4:63348951-63348973 CCCAGGGCAAGGAAGAACAAAGG - Intergenic
974675223 4:65079791-65079813 CGGTGGCTAAGGCAGGAGAATGG - Intergenic
975510639 4:75190944-75190966 CTGTGGTGAAGGAAGAAGAGAGG - Intergenic
976784497 4:88802689-88802711 CTGTGGCTAGGGGAGAAGAAAGG - Intronic
977292831 4:95181763-95181785 CTGTGGGAAAGAAAGAAGGATGG + Intronic
977350546 4:95880018-95880040 CAGTGGGAGAGGAATAAGAATGG - Intergenic
980560706 4:134470685-134470707 TGGAGGGTAAGGAAGAGGAAAGG - Intergenic
980676064 4:136083004-136083026 GCGTGAGTTAGCAAGAAGAAAGG - Intergenic
986206343 5:5628522-5628544 CCCTGGGCAAGGCAGAAAAATGG - Intergenic
986808036 5:11327191-11327213 CAGTGGGAAAGGACAAAGAAGGG + Intronic
987166281 5:15201835-15201857 CCCTGAGTAAGGGAAAAGAAAGG + Intergenic
988372335 5:30387717-30387739 TCATGGGAAAGGAAGTAGAAAGG + Intergenic
989162077 5:38400957-38400979 CATAGGGTACGGAAGAAGAAGGG - Intronic
990381640 5:55226148-55226170 CCGTGGGTATATAAGAAGAGTGG - Intronic
990688516 5:58335512-58335534 CAGTGGGTAAGAAAGAAGCAAGG - Intergenic
990887280 5:60609100-60609122 CCCTGGGAAAGGAAAAGGAAAGG + Intronic
991267615 5:64740502-64740524 CAGTGGGTTATGAAGTAGAAAGG + Intronic
992856265 5:80864611-80864633 CTGTGGAGGAGGAAGAAGAAGGG + Intronic
993335825 5:86657277-86657299 AGGTGGGTGAGGAAGAAGATGGG + Intergenic
994994188 5:107038790-107038812 CCATGGGGAAAGAAGAACAAGGG - Intergenic
995605053 5:113845241-113845263 GCATGGGGAAGGAAGTAGAATGG + Intergenic
996777794 5:127151681-127151703 CAGAGGATAAGGAGGAAGAAAGG - Intergenic
997697017 5:135869702-135869724 CCATGGGTCTGGAAGAGGAAGGG + Intronic
997914441 5:137910341-137910363 CCGTGGGTAGTGAAGAGGAAAGG + Intronic
999661765 5:153871775-153871797 GAGTTGGTAAGGAAGAAGCAGGG - Intergenic
999960610 5:156752290-156752312 CCGGGGGGAAGGAAATAGAAGGG + Intronic
1001225231 5:169939006-169939028 CCGAGGCTAAGGTAGGAGAATGG - Intronic
1001862223 5:175067380-175067402 CCTTTGGTGAGGAGGAAGAAAGG + Intergenic
1002413215 5:179101119-179101141 GCGTGGGTGACGCAGAAGAAGGG + Intergenic
1004650261 6:17600929-17600951 CCGGGGCTCAGGAAGTAGAAGGG - Exonic
1004886812 6:20059092-20059114 CCATGGGTGGGGAAGTAGAATGG + Intergenic
1004982905 6:21046386-21046408 GCCTGGGTATGTAAGAAGAAGGG + Intronic
1005771783 6:29081256-29081278 CCGAGGGTTATGAAGAACAATGG - Intergenic
1008588260 6:52968615-52968637 CTGTGGGAAATGAAGAAGCAGGG + Intergenic
1010388885 6:75313446-75313468 CAGTGTGAATGGAAGAAGAATGG - Exonic
1010786177 6:80004243-80004265 CCGCGGGAAACGAAGGAGAAGGG + Intronic
1010999727 6:82574249-82574271 GCAGGGGTGAGGAAGAAGAAGGG + Intergenic
1012567644 6:100679646-100679668 CCTTGGGTAGGAAAAAAGAAGGG + Exonic
1012617556 6:101295291-101295313 CTGTGGTGAAGCAAGAAGAAAGG + Intergenic
1013105065 6:107020026-107020048 AGGAGGGTAAGGAAGGAGAATGG + Intergenic
1013566925 6:111374502-111374524 CAGTGGGTAGGGAAGCAGAAAGG + Exonic
1014754889 6:125292020-125292042 GCCTGAGTAAGGAAGTAGAAAGG + Intronic
1016977420 6:149822990-149823012 CAGAGAGAAAGGAAGAAGAAAGG + Intronic
1017787895 6:157771802-157771824 CAGTGGGTGAGGCAGGAGAATGG - Intronic
1017847882 6:158275254-158275276 CCGTGGCAAATGAAGAAGATGGG - Intronic
1018516521 6:164585617-164585639 CCTGGGGAAAGCAAGAAGAATGG + Intergenic
1018753632 6:166829484-166829506 CAGAGGCTAAGGAAGGAGAATGG + Intronic
1019135727 6:169906567-169906589 CCTGGGGTCAGGAAGAAGACAGG + Intergenic
1021804089 7:24338016-24338038 CAGTGGGGAAGGATGAAGAGAGG + Intergenic
1023088209 7:36593568-36593590 CCATGTGTAAAAAAGAAGAAAGG - Intronic
1028380858 7:90196940-90196962 CTGGGAGTGAGGAAGAAGAAGGG - Intronic
1028646752 7:93106981-93107003 TCTTGGGTAAGGAACAAGAAGGG - Intronic
1030193750 7:106833512-106833534 CCGTGTGTAAGGAAAAAGGATGG - Intergenic
1030495326 7:110291543-110291565 CCCTGGGTGAGGCAGAAGAATGG + Intergenic
1031083379 7:117279325-117279347 CTGTGGGGGAGGAAGTAGAAAGG - Intronic
1033581838 7:142745215-142745237 TCTTGGGTAAGGCAGCAGAACGG - Intergenic
1035988810 8:4465007-4465029 CCTTGGGAAAGGAAGAAAATAGG + Intronic
1036850954 8:12201134-12201156 CCGAGGCTGAGGCAGAAGAATGG - Intergenic
1036872319 8:12443415-12443437 CCGAGGCTGAGGCAGAAGAATGG - Intergenic
1036878911 8:12495769-12495791 CACAGGGTAAGGGAGAAGAAAGG + Intergenic
1037379387 8:18268353-18268375 TTGTTGGAAAGGAAGAAGAAAGG + Intergenic
1037877311 8:22554429-22554451 CTGTGGGGAAGGAGGAAGGAAGG - Intronic
1038807174 8:30805110-30805132 CTGTGGGCAGTGAAGAAGAAAGG - Intronic
1038843809 8:31210521-31210543 CCCTGTGAAAGGAAGGAGAAGGG - Intergenic
1040420552 8:47236232-47236254 CAGTGGTTAAGGAAGAGGGAGGG + Intergenic
1040470431 8:47731750-47731772 CTGGGGGTAGGGAGGAAGAAAGG + Intronic
1042303118 8:67307458-67307480 CCACGGACAAGGAAGAAGAATGG + Intronic
1044836505 8:96300586-96300608 CCATTGATAAGGAAGAATAATGG + Intronic
1045737264 8:105310790-105310812 CAGTGGATAAGGAAACAGAATGG + Intronic
1047059170 8:121203841-121203863 CCGTTGGTGGGGAAGAAGACAGG + Intergenic
1049816678 8:144606349-144606371 CCGAGGAGAAGGAAGAGGAAGGG - Intergenic
1051538667 9:18189620-18189642 CCATGGATGAGGAATAAGAAGGG - Intergenic
1052780377 9:32776697-32776719 TGGTGGGTAAGGCAGATGAAGGG + Intergenic
1052900552 9:33791179-33791201 TCTTGGGTAAGGCAGCAGAAGGG - Intronic
1053302068 9:36959401-36959423 TTGTGGGCAAGGAAGAAGACAGG - Intronic
1055166085 9:73195761-73195783 TCTTGGGTATGTAAGAAGAAGGG + Intergenic
1057128621 9:92638180-92638202 CCGTTGGAAGGGAAGAAGAACGG + Exonic
1057352941 9:94315793-94315815 CCATGGGAAAGAATGAAGAAAGG - Intergenic
1057654805 9:96941798-96941820 CCATGGGAAAGAATGAAGAAAGG + Intronic
1058839314 9:108890884-108890906 CTGTGGGGAAGGAAGGAGAGTGG - Intronic
1059851072 9:118340819-118340841 CCATGGGTCATGAAGAACAATGG - Intergenic
1185762865 X:2701563-2701585 CCAGGTGTAAGGAAGAGGAAGGG + Intronic
1186069378 X:5801598-5801620 CCCTGGTAAAGGAAGAAGGAAGG + Intergenic
1187625843 X:21112831-21112853 CCAAGGGAAAGGAAGAAGAGAGG - Intergenic
1187768517 X:22669531-22669553 CCCTGTGTAAGGGAGGAGAAAGG - Intergenic
1189965917 X:46373094-46373116 CCGGGGGTAAGGTCAAAGAAGGG - Intergenic
1190042318 X:47081302-47081324 CCATGGGTAAGGATGAAGGCTGG + Exonic
1192250622 X:69410516-69410538 CTTTGGGTAACGGAGAAGAATGG + Intergenic
1192265652 X:69535845-69535867 GCATGGGCAAGGAAGAAGCATGG + Intergenic
1193665967 X:84317344-84317366 TAGTGGGGAAGGAATAAGAAAGG - Intergenic
1194100717 X:89700273-89700295 AAGGGGGAAAGGAAGAAGAAAGG - Intergenic
1196117997 X:112017659-112017681 GGATGGGGAAGGAAGAAGAAAGG - Intronic
1199086308 X:143634059-143634081 CGGTGGGTGAGGAGGAAGAGAGG + Intronic
1199309258 X:146303572-146303594 AGGTGCGTAGGGAAGAAGAAAGG - Intergenic
1200007548 X:153097831-153097853 CTGTGTGTAAGGAAAAAGGATGG + Intergenic
1200409612 Y:2848313-2848335 TGGTGGGCAAGGAAGAAGACAGG + Intronic
1200453670 Y:3361349-3361371 AAGGGGGAAAGGAAGAAGAAAGG - Intergenic
1200690028 Y:6297940-6297962 CCTTGGGGAGTGAAGAAGAATGG + Intergenic
1201045245 Y:9876780-9876802 CCTTGGGGAGTGAAGAAGAATGG - Intergenic
1201742535 Y:17339377-17339399 ACAGGGGCAAGGAAGAAGAAAGG + Intergenic