ID: 1101885477

View in Genome Browser
Species Human (GRCh38)
Location 12:108657557-108657579
Sequence CCTCATCTGGGGAAGGGGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 957
Summary {0: 1, 1: 0, 2: 10, 3: 78, 4: 868}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101885477_1101885487 9 Left 1101885477 12:108657557-108657579 CCATCCCCCTTCCCCAGATGAGG 0: 1
1: 0
2: 10
3: 78
4: 868
Right 1101885487 12:108657589-108657611 GATACTATGTGATCTGGTCAAGG 0: 1
1: 0
2: 1
3: 6
4: 83
1101885477_1101885486 3 Left 1101885477 12:108657557-108657579 CCATCCCCCTTCCCCAGATGAGG 0: 1
1: 0
2: 10
3: 78
4: 868
Right 1101885486 12:108657583-108657605 CAAAGAGATACTATGTGATCTGG 0: 1
1: 0
2: 0
3: 13
4: 171
1101885477_1101885488 22 Left 1101885477 12:108657557-108657579 CCATCCCCCTTCCCCAGATGAGG 0: 1
1: 0
2: 10
3: 78
4: 868
Right 1101885488 12:108657602-108657624 CTGGTCAAGGTCCCTCTGTGAGG 0: 1
1: 0
2: 0
3: 12
4: 169

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101885477 Original CRISPR CCTCATCTGGGGAAGGGGGA TGG (reversed) Intronic
900072658 1:785567-785589 CCTGTTGTGGGGTAGGGGGAGGG + Intergenic
900422738 1:2562615-2562637 CCTCAGCTGGGGAGGTGGGCCGG + Intronic
900465146 1:2821802-2821824 CTCCATCTGGGCAAGGGGGTGGG + Intergenic
900804078 1:4755925-4755947 CGTCACCTGGGGAAGGGTGAAGG + Intronic
900812559 1:4818157-4818179 CCTCACCTGGGGGAGGGTGGAGG + Intergenic
901327193 1:8374216-8374238 CCTCTTCTGGGGAAAGGCAAAGG + Intronic
901643430 1:10704559-10704581 CCTCCTGGGGGGAAGGGGGCCGG + Intronic
901809571 1:11759834-11759856 CCTCATATGTAAAAGGGGGATGG - Intergenic
902411252 1:16212729-16212751 CCGGTTCTGGGGAAGGGGGGCGG - Intergenic
902566327 1:17314091-17314113 CCTCAAGAGGGGAAGGGAGAAGG - Intronic
902617284 1:17630691-17630713 CCTCACCTGGGCAATGGGGATGG + Intronic
902939205 1:19787607-19787629 CATCAGATGGGGAAGGGAGATGG + Intronic
903174535 1:21573082-21573104 CCTCATCTGTGAAACGGGCATGG + Intronic
903178695 1:21594913-21594935 CATCATCCTGGGAAGGGGGCAGG + Intergenic
903189016 1:21646054-21646076 CCTCATCTGTAAAATGGGGATGG + Intronic
903190362 1:21652533-21652555 CCTCACCAGGGCAAAGGGGAAGG - Intronic
903671054 1:25035544-25035566 CCTCATCTGGGAATGGGAAAAGG - Intergenic
903693695 1:25192480-25192502 CCTGTTCTGGGGCAGTGGGAAGG - Intergenic
903882646 1:26522053-26522075 CCTCATCTGAGGAATGGGAATGG - Intergenic
903936655 1:26900109-26900131 CGTCATCTCGGTAAGGGGGTTGG - Exonic
904536379 1:31202190-31202212 CCCCAGCTGGGGAAGGGGTGGGG - Intronic
904768333 1:32867495-32867517 CCTCTTCTGAGGGAGGGCGAAGG + Intronic
904804116 1:33118990-33119012 CCTCTTTTGGGGTAGGGAGAGGG + Intronic
904840268 1:33368011-33368033 CCTCATCTACGGAATGGGGAGGG - Intronic
905137916 1:35814453-35814475 CCTGTTGTGGGGTAGGGGGAGGG - Intronic
905270914 1:36786896-36786918 CCTCATCTGGAAAATGGGGTTGG - Intergenic
905315252 1:37078833-37078855 CCTGATCTCAGGATGGGGGAAGG - Intergenic
905344018 1:37299253-37299275 CCTTGTCTTGGGAAGAGGGAGGG + Intergenic
905380162 1:37556267-37556289 CCTCTTCTGGGGAGGGATGAAGG - Intergenic
905827701 1:41038741-41038763 CCTCATCTGCAGAAGGAGGTGGG - Intronic
905861767 1:41356882-41356904 CCTCATCTGGGAAATGGGAATGG - Intergenic
906450873 1:45946322-45946344 CCTCATCTTGAGACTGGGGATGG + Intronic
906687517 1:47772070-47772092 CCTCAGCTGGGCCAGGGAGAGGG + Intronic
907295355 1:53448577-53448599 CCACCTCTGGGGAGGGGAGAGGG - Intergenic
907441391 1:54480687-54480709 CCCCAGCTGGGGAAGGGAGGAGG - Intergenic
907715857 1:56925405-56925427 CCTCATCTGTGAGATGGGGATGG - Intergenic
908306763 1:62826740-62826762 CCTGTTGTGGGGTAGGGGGAGGG - Intronic
908321591 1:62983869-62983891 TCTCATCTGTAGAATGGGGATGG + Intergenic
909695943 1:78467802-78467824 CCTCATCTGTGCAAGGGTGCTGG + Intronic
910216836 1:84851903-84851925 CCTCAGCTGGTGGTGGGGGAAGG + Intronic
910340374 1:86180453-86180475 CCTGTTGTGGGGAGGGGGGAGGG - Intergenic
910569564 1:88684524-88684546 CCGCCTCTGGCGAAGGGAGAAGG - Exonic
910712650 1:90197557-90197579 CCTTCCATGGGGAAGGGGGATGG + Intergenic
911498266 1:98656783-98656805 CCTCATCTGTAAAATGGGGATGG + Intergenic
912363963 1:109117594-109117616 CCTGATCTGTGAAATGGGGATGG + Intronic
912672589 1:111644774-111644796 CTTTTTTTGGGGAAGGGGGAGGG + Intronic
912933344 1:113983010-113983032 CGTAATGTGGGGAAGAGGGAAGG + Intergenic
913009481 1:114669645-114669667 TCTCTGCTGGGGAAGAGGGAGGG - Intronic
914394303 1:147250453-147250475 CCACATCTGGGGATTGGGAAGGG + Intronic
914968831 1:152288224-152288246 CCTGTTGTGGGGTAGGGGGAGGG - Intergenic
915046176 1:153018749-153018771 CCCTGTCTGGTGAAGGGGGATGG - Intergenic
915093596 1:153443767-153443789 CCTCTCCAGGGGAAGGAGGATGG + Intergenic
915312212 1:155010434-155010456 CGTCATATGGGGGATGGGGAAGG + Intronic
915829843 1:159116676-159116698 CCTGTTGTGGGGTAGGGGGAGGG + Intronic
915845925 1:159265047-159265069 CCTGTTGTGGGGTAGGGGGAGGG - Intergenic
915856400 1:159391420-159391442 CCTGTTGTGGGGTAGGGGGAGGG + Intergenic
915922903 1:159990510-159990532 CCTCATATGGGGAAGGGAGAGGG - Intergenic
915954251 1:160209629-160209651 CCTCAGCTGGAAAAGGGGGCAGG - Intronic
916314116 1:163428436-163428458 TCTCAACTGGAGAAGGAGGAGGG + Intergenic
916601060 1:166294001-166294023 CCTGATGTGGGGTCGGGGGAGGG + Intergenic
916602878 1:166311029-166311051 CCTACTGTGGGGTAGGGGGAGGG - Intergenic
916743543 1:167666817-167666839 CCACATGTGGCCAAGGGGGACGG + Intronic
917033962 1:170726038-170726060 CCTCATTGAGGGAAGGCGGATGG + Intronic
917064311 1:171075127-171075149 CCATATCTGGGGAAGGGAGTAGG - Intergenic
917089261 1:171336539-171336561 CCTCATGTGTGGAAGGGGCCTGG - Intronic
917118655 1:171626562-171626584 CCTCAGCTGGAGAAGGAGGTGGG - Intergenic
917597471 1:176543652-176543674 CCACACCTGGGGATGGTGGAAGG + Intronic
917839579 1:178966744-178966766 CCTCATCTGTGAAATGAGGATGG + Intergenic
917997851 1:180460129-180460151 CCTACTGTGGGGTAGGGGGAGGG - Intronic
918316280 1:183325130-183325152 CCTGATCTGCTGAAGTGGGAAGG + Intronic
918820161 1:189243447-189243469 CCTGTTCTGGGGTGGGGGGAGGG - Intergenic
918935800 1:190919259-190919281 CCTGTTGTGGGGTAGGGGGAGGG + Intergenic
919210931 1:194484872-194484894 CCTGTTGTGGGGTAGGGGGAGGG + Intergenic
919899630 1:202034524-202034546 CCTTATTTGGGGAATGGGGGTGG + Intergenic
920203019 1:204272039-204272061 CTTAATCCGGGGAAGGGGGAGGG - Intronic
920650659 1:207834895-207834917 TCTCATCTGGGAAAGAGTGAAGG - Intergenic
921263017 1:213400532-213400554 CCTCATCTCTGGAAGGGGCAGGG - Intergenic
921297985 1:213722620-213722642 CCTCCACTGGGGAAGGGAGATGG - Intergenic
922268243 1:224008493-224008515 CCTGTTGTGGGGGAGGGGGAGGG + Intergenic
922358642 1:224800320-224800342 ACTGATGTGGGGAGGGGGGAGGG + Intergenic
922432745 1:225571674-225571696 CAACAACTGGGGAAGGGAGACGG + Intronic
922804313 1:228377738-228377760 CCTCACCTGGGGCGGGGGGCAGG + Intronic
923184528 1:231558057-231558079 CCTCATCCTGTGAAGGGTGAGGG - Intronic
923447609 1:234087176-234087198 GCTCATCTAGGGATGGGGAAAGG + Intronic
924088788 1:240481647-240481669 TTTCATCGGGGGAAGAGGGAGGG + Intergenic
924333933 1:242967952-242967974 CCTTAGCAGGGGTAGGGGGACGG - Intergenic
924555973 1:245118933-245118955 CCTCAGCTAGGGAGAGGGGAGGG + Intronic
1062843959 10:690334-690356 CCCCATCTGTGAAAAGGGGATGG + Intergenic
1063609271 10:7549355-7549377 CCACATGGGGGGAAAGGGGAGGG + Intergenic
1064019333 10:11796586-11796608 CCAGAACTGGGGAAGAGGGAGGG + Intergenic
1065576488 10:27125518-27125540 CCTGAACTGGGGAAGTGGGTAGG + Intronic
1067511141 10:46895863-46895885 CTTCAACTGGGGGTGGGGGATGG + Intergenic
1067651111 10:48155999-48156021 CTTCAACTGGGGGTGGGGGATGG - Intergenic
1067944236 10:50680249-50680271 CCTCACATGGGGCTGGGGGAAGG + Intergenic
1068268986 10:54695052-54695074 CCTGTTGTGGGGTAGGGGGAGGG + Intronic
1068297612 10:55094384-55094406 CCTGTTGTGGGGTAGGGGGATGG + Intronic
1068476976 10:57539421-57539443 CCTCTTGTGGGGTGGGGGGAGGG - Intergenic
1068849912 10:61725602-61725624 CCTGTTGTGGGGTAGGGGGAGGG + Intronic
1069539014 10:69279269-69279291 CCTCATGTGGTGAAGGGCGTTGG + Intronic
1069831647 10:71285534-71285556 TCTCATCTGCGAAAGGGGCAGGG - Intronic
1069872220 10:71540154-71540176 CTTCCTCCGGGGTAGGGGGATGG + Intronic
1069888399 10:71638146-71638168 CCTCATCTGTGAAGTGGGGAGGG - Intronic
1070550630 10:77488291-77488313 GCTGCTCTGGGGAAGGGGGATGG + Intronic
1070626466 10:78054514-78054536 CCTCATCTGCAAAAGCGGGAAGG - Exonic
1070685399 10:78476808-78476830 CTTGATCTGGGGCAGGGGCAGGG - Intergenic
1071646080 10:87361558-87361580 CCTCACATGGGGCCGGGGGAAGG + Intronic
1071726392 10:88202291-88202313 CCTGATGTGGGGTGGGGGGAGGG + Intergenic
1071966872 10:90860401-90860423 CCTCACCTGGCAAAGGGGGTAGG + Intergenic
1072025749 10:91454717-91454739 CCTGTTGTGGGGTAGGGGGAGGG - Intronic
1072626033 10:97112575-97112597 CCTCATCTGTGAAATGGGGATGG - Intronic
1072686443 10:97540040-97540062 CCTTCTCTGAGGAAGGGGGAGGG + Intronic
1072806230 10:98425496-98425518 CCCCACCTGGGGAAGAGGCAGGG - Intronic
1073118039 10:101103442-101103464 CCTCATCTGTGACATGGGGATGG + Intronic
1073257740 10:102164883-102164905 CCTAATGTGGGGTGGGGGGAGGG + Intergenic
1074424539 10:113339239-113339261 CCCCATCTGGAGAAAGGTGAAGG - Intergenic
1074696291 10:116052547-116052569 CCTGTTGTGGGGTAGGGGGAGGG - Intergenic
1074954163 10:118371286-118371308 CGTTCTCTGGGGAAGAGGGAGGG - Intergenic
1075178311 10:120186146-120186168 CCTATTCTGCTGAAGGGGGATGG + Intergenic
1075223682 10:120605931-120605953 CCTCAGCTGGGCAAGGAGGCAGG + Intergenic
1075368394 10:121913708-121913730 AGTCATCTTGGGAAGGGGAAGGG - Intronic
1075515847 10:123107559-123107581 GGTGAACTGGGGAAGGGGGAAGG - Intergenic
1075551275 10:123394505-123394527 CCTCATCTGGGGAACGAGGTTGG + Intergenic
1075610044 10:123846117-123846139 CACCATCTGGGGGTGGGGGATGG + Intronic
1075860830 10:125675140-125675162 CCTCATCCAGTGAAGAGGGATGG + Intronic
1076460835 10:130645497-130645519 CCTGTTGTGGGGTAGGGGGAGGG + Intergenic
1076572634 10:131442605-131442627 TCACTTCTGGGGAAGGGAGACGG - Intergenic
1076826359 10:132971631-132971653 CCTCTTGTGGGGAAGGAGCAGGG + Intergenic
1077161074 11:1113164-1113186 CCTCCTCTAGGGAAGGGGTGGGG - Intergenic
1077161083 11:1113187-1113209 CCTGCTCTGGGGAAGGGGCGGGG - Intergenic
1077161094 11:1113210-1113232 CCTCCTCTAGGGAAGGGGTGGGG - Intergenic
1077161103 11:1113233-1113255 CCTGCTCTGGGGAAGGGGCGGGG - Intergenic
1077161114 11:1113256-1113278 CCTCCTCTAGGGAAGGGGTGGGG - Intergenic
1077161123 11:1113279-1113301 CCTGCTCTGGGGAAGGGGCGGGG - Intergenic
1077161134 11:1113302-1113324 CCTCCTCTAGGGAAGGGGTGGGG - Intergenic
1077161143 11:1113325-1113347 CCTGCTCTGGGGAAGGGGTGGGG - Intergenic
1077161154 11:1113348-1113370 CCTCCTCTAGGGAAGGGGTGGGG - Intergenic
1077161163 11:1113371-1113393 CCTGCTCTGGGGAAGGGGCGGGG - Intergenic
1077161174 11:1113394-1113416 CCTCCTCTAGGGAAGGGGTGGGG - Intergenic
1077161183 11:1113417-1113439 CCTGCTCTGGGGAAGGGGCGGGG - Intergenic
1077284025 11:1757999-1758021 CCTCATCCAGGGCTGGGGGAGGG - Intronic
1077354402 11:2108595-2108617 CCTATTGTGGGGAAGGAGGAGGG - Intergenic
1078727600 11:13945572-13945594 CCTCATCTATGAAATGGGGATGG + Intergenic
1079032357 11:16995123-16995145 CCTCATCTGAAAAATGGGGATGG - Intronic
1080199317 11:29650012-29650034 CCTGTTGTGGGGTAGGGGGAGGG + Intergenic
1080238873 11:30103523-30103545 CCTGTTGTGGGGTAGGGGGAGGG + Intergenic
1080578216 11:33619186-33619208 CCTCATCTGGGGAAATCTGACGG - Intronic
1081037237 11:38164153-38164175 CCTGTTGTGGGGTAGGGGGATGG - Intergenic
1081195141 11:40152131-40152153 CCCCATCTGTGGAAGTAGGAAGG + Intronic
1081612732 11:44572756-44572778 CCTCATCTGTGAAATAGGGATGG + Intronic
1081617059 11:44597336-44597358 TCCCATCTGGGGATTGGGGAAGG + Intronic
1081993658 11:47350571-47350593 CCTCAGCAGGGGCAGGGGCAGGG + Exonic
1082019932 11:47523760-47523782 ACTCATGAGGGGATGGGGGAGGG + Exonic
1082814498 11:57499370-57499392 CCACTTCAGGGGAAGGGGGAAGG - Intronic
1083106189 11:60360736-60360758 CCTCCACTGGCGAAGGGGAAAGG + Intronic
1083257784 11:61507385-61507407 CCACTGCAGGGGAAGGGGGATGG - Intergenic
1083838862 11:65291499-65291521 GCAAATCTGGGGAAGAGGGAAGG - Intronic
1083844142 11:65321309-65321331 CCTCCTGTGGGGAAGGCTGAGGG - Exonic
1084089376 11:66870184-66870206 CCCCTTCTGGGGACTGGGGATGG - Intronic
1084418331 11:69047628-69047650 CCTCTTTTGGGGAGGGGGGAGGG - Intergenic
1084814895 11:71640060-71640082 CCTCAGCAGGGGAAGGGGCGGGG + Intergenic
1085203165 11:74713911-74713933 CCTCATGTGGAGAAGACGGATGG + Intronic
1085475033 11:76784022-76784044 CCTCAGGAGGGGGAGGGGGAGGG - Intronic
1086153439 11:83639189-83639211 TCTCACTTGGGAAAGGGGGAGGG - Intronic
1086301399 11:85430202-85430224 CCTGTTGTGGGGAGGGGGGAGGG + Intronic
1086883841 11:92180727-92180749 CTTCCTCTGGGGTAGGGGGAAGG - Intergenic
1087196220 11:95306647-95306669 ACTCATCTGGGAAAGATGGAGGG - Intergenic
1087344310 11:96951279-96951301 CCTGTTGTGGGGTAGGGGGAGGG - Intergenic
1087616774 11:100494661-100494683 CCTGTTGTGGGGAGGGGGGAGGG + Intergenic
1088146482 11:106686542-106686564 CATCAACTGGGGAAGAGGAAGGG + Intronic
1088162059 11:106884032-106884054 CCTGTCATGGGGAAGGGGGAGGG + Intronic
1088546406 11:110963844-110963866 CTTCATCAGGTGAAGGGGCAGGG - Intergenic
1089086085 11:115818022-115818044 CCTCCTCTGGAGCAGGGGAAGGG + Intergenic
1089173500 11:116532462-116532484 CTATATCTGGGGATGGGGGAAGG + Intergenic
1089340583 11:117754695-117754717 AGTCATATGGGGAAGGAGGAGGG + Intronic
1089461284 11:118655843-118655865 CCTCTTCTGGGAAGGGGAGAGGG - Exonic
1089462755 11:118662425-118662447 CCTCACCTGGGGAAAGGGTTTGG - Intronic
1089466820 11:118690900-118690922 CCTCATCTGGGGAAAGGGTTTGG + Intergenic
1090412464 11:126518725-126518747 CCTGGTCTGGGGAAGGGGAATGG - Intronic
1091585351 12:1812849-1812871 CCTCATCTGTGAAACGGGAACGG + Intronic
1091791219 12:3273323-3273345 CTTCGGCTGGGGAAGGGGCAGGG + Intronic
1091858504 12:3757949-3757971 CCACTTGTGGGGCAGGGGGATGG - Intronic
1092284203 12:7119408-7119430 CCTTCTCTGGGGATGGGGGGTGG + Intergenic
1093184275 12:16002132-16002154 GCTGTTGTGGGGAAGGGGGAGGG - Intronic
1093724484 12:22488037-22488059 CCTGTTGTGGGGTAGGGGGAGGG + Intronic
1093835760 12:23826172-23826194 CCTGTTGTGGGGTAGGGGGAGGG - Intronic
1094069816 12:26400874-26400896 CCTCATCTGTAAAATGGGGAGGG + Intronic
1094259722 12:28479457-28479479 CCTGTTGTGGGGTAGGGGGAAGG + Intronic
1094754643 12:33453872-33453894 CAGGATCTGGGGAAGGGGGCAGG + Intergenic
1095403457 12:41841377-41841399 CCCTAGCTGGGGAAGGGAGAAGG - Intergenic
1095407813 12:41887365-41887387 CCTCTTTTTGGGATGGGGGATGG - Intergenic
1095485383 12:42679082-42679104 CCTCTTCTGGGGAGGGATGAAGG + Intergenic
1095855373 12:46854543-46854565 CCTGTTGTGGGGGAGGGGGAGGG + Intergenic
1096240295 12:49956203-49956225 CCTCCTCAGGAGAAGGGGAAGGG + Exonic
1096286012 12:50300937-50300959 CCTGTTGTGGGGTAGGGGGAGGG + Intergenic
1096496656 12:52042862-52042884 CCTCTTCCAGGGAAGGAGGAAGG - Intronic
1096517348 12:52164266-52164288 TCTCTTGTGGGGAAGGGGGCAGG + Intergenic
1096598461 12:52713165-52713187 TCTCATCTGGGGTAGGGGTAGGG + Intergenic
1096814395 12:54192639-54192661 CCTGATTTGGGGAAGGGAAAAGG + Intergenic
1097302998 12:58037908-58037930 CCTGTTGTGGGGTAGGGGGAGGG + Intergenic
1097326381 12:58282008-58282030 CCTGTCCTGGGGTAGGGGGAGGG - Intergenic
1097736948 12:63192845-63192867 CCTCATGATGGGAAGGAGGAGGG + Intergenic
1097870606 12:64598886-64598908 CCTGATGTGGGGTGGGGGGAGGG - Intergenic
1098334923 12:69393691-69393713 CTAAATCTGGGGAAAGGGGATGG + Intergenic
1098613048 12:72485580-72485602 CCTCACCTGTAGAATGGGGAGGG - Intronic
1099042792 12:77676679-77676701 TGTCATCTAGGCAAGGGGGAGGG + Intergenic
1099385978 12:82014094-82014116 CCTGTTGTGGGGTAGGGGGAGGG - Intergenic
1099388767 12:82051826-82051848 CCTGTTGTGGGGTAGGGGGAGGG + Intergenic
1099531044 12:83781613-83781635 CCTGTTGTGGGGTAGGGGGAGGG + Intergenic
1100374175 12:93997026-93997048 CCTAAACTGGGGAAGGGCGATGG + Intergenic
1101434729 12:104654882-104654904 CCTGTTCTGGAGATGGGGGAGGG - Intronic
1101885477 12:108657557-108657579 CCTCATCTGGGGAAGGGGGATGG - Intronic
1102131978 12:110538750-110538772 CCTCATCTGCAAAACGGGGATGG + Intronic
1102492499 12:113297598-113297620 CCTGACCTGGGAAGGGGGGAAGG - Exonic
1102654472 12:114469915-114469937 ACCCATCTGGGGATGGGGGTGGG - Intergenic
1103025615 12:117571466-117571488 AACCACCTGGGGAAGGGGGAGGG + Intronic
1103261511 12:119593220-119593242 CCCCACCTGGGGGAGGGGGTCGG + Intergenic
1103526951 12:121575457-121575479 CCTGATCTGGAGCAAGGGGAAGG + Intronic
1104291333 12:127471784-127471806 CCTGTTGTGGGGAGGGGGGAGGG + Intergenic
1104421250 12:128637445-128637467 AGTCATCTGAGGGAGGGGGAAGG - Intronic
1105003098 12:132703754-132703776 CAGCATCTGGGGAAGTGAGAAGG + Intronic
1105705737 13:22966467-22966489 CAGCATCTGGAGAAGGCGGAGGG + Intergenic
1105858640 13:24391452-24391474 CAGCATCTGGAGAAGGCGGAGGG + Intergenic
1105890908 13:24681422-24681444 CCTCCTCTGGGGAGGCCGGAGGG - Intronic
1105986302 13:25570856-25570878 CCTCACCTGGGGAAGAGGCCTGG - Exonic
1106406817 13:29481642-29481664 CCTCTTCTGGGGCAGTGGGAGGG - Intronic
1106623627 13:31396116-31396138 CCTGTTGTGGGGTAGGGGGAGGG - Intergenic
1106904074 13:34386597-34386619 CCTCTTGTGGGGTTGGGGGAGGG - Intergenic
1107206299 13:37793434-37793456 CCTGTTGTGGGGTAGGGGGAGGG - Intronic
1107328531 13:39271858-39271880 CCCCTTCTGGAGAAGGGAGATGG - Intergenic
1107998820 13:45888157-45888179 CCTCATCTGCAAAAGAGGGATGG - Intergenic
1108140481 13:47415982-47416004 CCCCACCTGTGAAAGGGGGAGGG - Intergenic
1108962104 13:56247216-56247238 CTTTATCTGTGGAAAGGGGAGGG - Intergenic
1109449834 13:62497525-62497547 CCTCCACTGGGAAAGAGGGAAGG + Intergenic
1109778374 13:67074298-67074320 CCTCATCTGGGGAAGGGGCGAGG - Intronic
1110010046 13:70321063-70321085 CCTGTTGTGGGGAGGGGGGAGGG - Intergenic
1110912577 13:80982269-80982291 CCTGTTGTGGGGTAGGGGGATGG - Intergenic
1112309822 13:98308432-98308454 CATCACCTGAGGAAGGGGAATGG + Intronic
1113010149 13:105754985-105755007 CCTGTTGTGGGGTAGGGGGAGGG + Intergenic
1113834487 13:113319669-113319691 CCTCACCTGGGAGAGGGGGACGG + Intronic
1114600857 14:23954338-23954360 TCCCATCTAGGTAAGGGGGAGGG - Intronic
1114605082 14:23989485-23989507 TCCCATCTAGGTAAGGGGGAGGG - Intronic
1114609671 14:24030559-24030581 CCTCTTGTGGGGTGGGGGGAGGG + Intergenic
1114610539 14:24037050-24037072 TCCCATCTAGGTAAGGGGGAGGG - Intergenic
1114627111 14:24136881-24136903 CCTGACCTGGGGAAGGGTGGAGG - Intronic
1115415008 14:33122334-33122356 CCTCTTCTGGAGAAAGGTGATGG - Intronic
1115426329 14:33264265-33264287 CCTGTTGTGGGGTAGGGGGAGGG + Intronic
1116078526 14:40143830-40143852 CCTGTTGTGGGGCAGGGGGAAGG + Intergenic
1116548844 14:46207826-46207848 CCTGTTCTGGGGTGGGGGGAGGG + Intergenic
1116756362 14:48953675-48953697 CCTGTTGTGGGGAGGGGGGAGGG - Intergenic
1116866899 14:50038619-50038641 TCTCATCTGGGGAAGCTGGAGGG - Intergenic
1117070266 14:52049817-52049839 CCACTTCTGGTGAAGGGAGAGGG + Intronic
1117227706 14:53680215-53680237 CCTTTTGTGGGGTAGGGGGAGGG - Intergenic
1117377577 14:55129779-55129801 CGTGATCTGGGGAAGGGTGACGG - Intronic
1117726476 14:58679717-58679739 CATGGTCTGGGGAAGAGGGATGG + Intergenic
1119146822 14:72324504-72324526 CCTGTTGTGGGGTAGGGGGATGG - Intronic
1119423107 14:74519697-74519719 CAGCAGCTGGGGAACGGGGATGG - Intronic
1119711820 14:76828024-76828046 CCTCAGACAGGGAAGGGGGAAGG + Intronic
1119760389 14:77146664-77146686 TCTCTGCTGGGGTAGGGGGAGGG - Intronic
1119892041 14:78190135-78190157 CCTCAATTGTGGAAGAGGGAAGG - Intergenic
1120194047 14:81463876-81463898 CCTTATATGGGAAAGGTGGAGGG - Intergenic
1120454009 14:84708446-84708468 CCACATGTGGGGAAGGGAGATGG - Intergenic
1120563515 14:86025904-86025926 CCTGTTGTGGGGTAGGGGGAGGG + Intergenic
1121492905 14:94372532-94372554 CCTCCTGAGGGGGAGGGGGAGGG + Intergenic
1121799756 14:96764782-96764804 CCTGTTGTGGGGTAGGGGGAGGG - Intergenic
1121907560 14:97760965-97760987 TCTCTTCTGGGAAATGGGGATGG + Intronic
1122006195 14:98705868-98705890 CCTCACCTGTGAAATGGGGAGGG + Intergenic
1122138518 14:99648328-99648350 CCTCATCTGTGGAAGGGGAAAGG - Intronic
1122242094 14:100375881-100375903 CCTCATCTGTGGAATGGGCATGG + Intronic
1122267987 14:100555546-100555568 CCTCATCTGGAAAACGGGGTGGG - Intronic
1122463130 14:101912119-101912141 TCTAACCAGGGGAAGGGGGAAGG + Intronic
1122495847 14:102154371-102154393 CCTCACATGGTGGAGGGGGAAGG + Intronic
1123035681 14:105470981-105471003 GCTCTGCTGGGGAAGGGGGTTGG - Intergenic
1123736786 15:23192502-23192524 CCTCAGTTGGGGAAGGAGCAAGG + Intergenic
1124287485 15:28415480-28415502 CCTCAGTTGGGGAAGGAGCAAGG + Intergenic
1124288007 15:28421182-28421204 CCTCAGTTGGGGAAGGAGCAAGG + Intergenic
1124437582 15:29663706-29663728 CCTGTTGTGGGGGAGGGGGAGGG + Intergenic
1124709320 15:31992519-31992541 ACTCATCTGGGCAAGGTGCAAGG - Intergenic
1125219085 15:37312771-37312793 CCTGTTGTGGGGTAGGGGGAGGG - Intergenic
1125520174 15:40344052-40344074 CCTTGTCTGGGAATGGGGGAGGG - Intergenic
1125732385 15:41900509-41900531 CCCCATCTGTAGAATGGGGAGGG - Exonic
1126541935 15:49833367-49833389 CCTGTTGTGGGGTAGGGGGATGG - Intergenic
1126554745 15:49973174-49973196 ACAGATCAGGGGAAGGGGGATGG + Intronic
1126653797 15:50954842-50954864 CCTGTTGTGGGGTAGGGGGACGG - Intronic
1126877922 15:53064114-53064136 CCTGTTGTGGGGTAGGGGGAGGG + Intergenic
1127122683 15:55785258-55785280 CCTCTTCTGGTGGAGGGAGACGG - Intergenic
1127274157 15:57427559-57427581 CCTCATCAGGGAAAGGGGTGAGG - Intronic
1127282361 15:57503227-57503249 CCTCATCAGGAGTAGGAGGAAGG - Intronic
1127375622 15:58382023-58382045 CCTCTTCTGGGAAGGAGGGAGGG + Intronic
1127793222 15:62416719-62416741 CCTCCTCTGGGCAAAGGGGCAGG - Intronic
1128346334 15:66854738-66854760 CATTCACTGGGGAAGGGGGAGGG + Intergenic
1128676967 15:69617179-69617201 CCTGCTGTGGGGTAGGGGGAGGG - Intergenic
1128749515 15:70139073-70139095 CTTCATCTGTGAAATGGGGATGG + Intergenic
1128749649 15:70139932-70139954 CTTCATCTGTGAAATGGGGATGG + Intergenic
1128797695 15:70477485-70477507 CCCCATGTGGGTTAGGGGGAAGG + Intergenic
1128899721 15:71409279-71409301 CCTCATCTGGGCAAGGGTTTTGG - Intronic
1128979179 15:72174462-72174484 CCACAGCTGGGGCATGGGGATGG - Intronic
1129030771 15:72616074-72616096 CCACTGCTGGGGGAGGGGGAGGG + Intergenic
1129052765 15:72796742-72796764 CCCCATCTGCAGAATGGGGATGG + Intergenic
1129160576 15:73745413-73745435 CCTCAGCTGGGGATCAGGGAAGG - Intronic
1129477614 15:75796598-75796620 CCACTGCTGGGGGAGGGGGAGGG + Intergenic
1129518023 15:76168743-76168765 CCTCCACTGGGGGATGGGGAGGG + Intronic
1130029946 15:80304314-80304336 CCTGTTGTGGGGTAGGGGGAGGG - Intergenic
1130417717 15:83709582-83709604 CACCTTCTGGGAAAGGGGGATGG + Intronic
1131152131 15:90053838-90053860 CCTCACCTAGGGAAGGGAGGAGG - Intronic
1131202428 15:90410679-90410701 CCTGTTGTGGGGTAGGGGGAGGG + Intronic
1131424806 15:92336996-92337018 ACTCATCTGTGGAAGGGCCACGG - Intergenic
1131737574 15:95350144-95350166 CCTCATCTGGAAAATGAGGAGGG + Intergenic
1131936197 15:97508286-97508308 CCTGTTGTGGGGTAGGGGGATGG + Intergenic
1132175662 15:99711931-99711953 CCTCATCTGGAAAATGGGGATGG + Intronic
1132199632 15:99942469-99942491 CCCTTTCTGGGGAGGGGGGAAGG + Intergenic
1132277292 15:100579018-100579040 CCTGTTGTGGGGTAGGGGGAGGG + Intronic
1132729532 16:1354648-1354670 CCTGATGTGGGGATGGGGGTGGG - Intronic
1132811508 16:1800825-1800847 GCTCATGTGGGAAAGGCGGAGGG - Intronic
1132816366 16:1829383-1829405 CTTCATCTGAGTAATGGGGATGG - Intronic
1133411093 16:5569571-5569593 CCTCATCTGTGAAATGGGGATGG - Intergenic
1133463981 16:6012202-6012224 CCTCATCTGTAGAATGAGGATGG + Intergenic
1133708913 16:8382246-8382268 CCGCTTCTGGGGGAGGGGAAGGG + Intergenic
1133758764 16:8781679-8781701 ACTCATCTTGGGAAGGGCCATGG + Exonic
1133872795 16:9705227-9705249 CCTCATCTGTAAAAGGCGGATGG - Intergenic
1134095600 16:11416446-11416468 CCTCATCTGCAGAATGGGAATGG + Intronic
1134248394 16:12557017-12557039 CCTCATCTTGGGGCGGGGGGGGG - Intronic
1134572825 16:15306254-15306276 CCTCATATGTGGAAGGTGGAAGG - Intergenic
1134729561 16:16449782-16449804 CCTCATATGTGGAAGTTGGAAGG + Intergenic
1134828600 16:17305153-17305175 CCTGATTTGGGGAACTGGGATGG - Intronic
1134838586 16:17382854-17382876 CCTCACCTGGGTAATGGGGATGG - Intronic
1134937875 16:18262124-18262146 CCTCATATGTGGAAGGTGGAAGG - Intergenic
1135804401 16:25529030-25529052 CCTCATATGGTGCAGGGGGAAGG + Intergenic
1136227501 16:28868964-28868986 CCTCAGCTGGGGCAGGGGCAGGG - Intronic
1136317915 16:29465083-29465105 CCATATCTGGGGAGGGGAGAAGG + Exonic
1136432490 16:30204432-30204454 CCATATCTGGGGAGGGGAGAAGG + Exonic
1136605353 16:31330010-31330032 CCTCATCTCGGGAGGTGAGATGG - Intronic
1137007685 16:35293168-35293190 CCTGTTGTGGGGTAGGGGGAGGG + Intergenic
1137434927 16:48447370-48447392 CCCCACCTGGGGAAGGGTGCTGG - Intronic
1137715842 16:50597908-50597930 CCTCATCTGGTGGTTGGGGATGG + Intronic
1137978621 16:53051612-53051634 CCTGTTGTGGGGTAGGGGGAGGG + Intergenic
1138121679 16:54405364-54405386 CCTCATCTGTAGAATGGGAAGGG + Intergenic
1138139833 16:54558644-54558666 CCTCATCTGTAAAATGGGGATGG + Intergenic
1138139987 16:54559801-54559823 CCTCATCTGTAAAATGGGGATGG - Intergenic
1139327610 16:66164320-66164342 CCTCAAATGGGGCAGGGGGAAGG + Intergenic
1139336441 16:66235032-66235054 CCTCACATGGTGAAGGGAGAAGG - Intergenic
1139397204 16:66649738-66649760 CCTCATGGGGGGCAGGGGCAGGG + Intronic
1139568716 16:67796957-67796979 ACTCATCAGTGGAAGAGGGATGG - Intronic
1140538692 16:75734980-75735002 CCTGTTTTGGGGTAGGGGGAGGG - Intronic
1140690301 16:77477398-77477420 CCTCACATGGTGAAGGTGGAGGG + Intergenic
1141586127 16:85034775-85034797 TCTCATCTGTGAAATGGGGACGG - Intronic
1141824421 16:86468856-86468878 CCTCAGCTGGGGAATGGGGATGG + Intergenic
1141890298 16:86922066-86922088 CCAATTCTGGGGAAGGAGGAAGG + Intergenic
1142050934 16:87957773-87957795 CGTCATCTGGTGAAAGGTGAAGG - Intronic
1142354149 16:89594208-89594230 CCTCATCTGGGGTTGGGAGGGGG + Intronic
1142932619 17:3299675-3299697 GCTCTTCTGGGGAAGTGTGAAGG - Intergenic
1143179041 17:4972986-4973008 CCACATCTGAGGAAGGGGGCGGG + Exonic
1143252520 17:5533801-5533823 CCACATCAGGGGCAGAGGGATGG + Intronic
1143263377 17:5616979-5617001 CCTCCTCTGGGGTGGGGTGAAGG - Intronic
1144228402 17:13174329-13174351 CCTGTTGTGGGGTAGGGGGAGGG - Intergenic
1144590339 17:16518384-16518406 TCTCCTTTGGGGAAGGGGGCAGG + Intergenic
1144769357 17:17750985-17751007 CCTCCTCTGTGGAAGGCGGAAGG - Intronic
1144775883 17:17784322-17784344 CCTAGGCTGGGGAAGGCGGAAGG + Intronic
1145000659 17:19302290-19302312 TCTCATCTGCAGAATGGGGACGG - Intronic
1146433565 17:32822367-32822389 CCTGTTGTGGGGTAGGGGGAGGG + Intronic
1146484932 17:33235245-33235267 CCTGATCCTGGGAAGGGGGAGGG - Intronic
1146935827 17:36812168-36812190 CCTCATCTGTGAAATGGTGATGG - Intergenic
1147375203 17:40018920-40018942 GCTCAGCTGGGGAAGGGCCAGGG - Intergenic
1147427772 17:40354493-40354515 CCTCATCTGCGGAGGTGGGCAGG + Exonic
1147739318 17:42661470-42661492 TCACCTCTGGGGAAGGGAGAGGG + Intronic
1147769758 17:42859458-42859480 CCTCATCTGGGGCCTGGGGCAGG - Intergenic
1148154367 17:45414256-45414278 CTTCCACTGGGGGAGGGGGAAGG - Intronic
1148231455 17:45937841-45937863 CCTCAGCTGGGAAAGTGGCAGGG - Intronic
1148260147 17:46175092-46175114 CCTCATTTGGGGCAGGGAGGGGG - Intronic
1149061081 17:52422549-52422571 CCTGTTGTGGGGTAGGGGGAGGG + Intergenic
1149576197 17:57715377-57715399 CCTCACCTGTGCAATGGGGAGGG - Intergenic
1149932445 17:60769556-60769578 CCTGCCGTGGGGAAGGGGGAGGG + Intronic
1150473110 17:65454178-65454200 CCTCATGTGGGGAAGGTGGAGGG - Intergenic
1150889014 17:69123006-69123028 ACTGTTCTGGGGTAGGGGGAGGG + Intronic
1151561343 17:74871541-74871563 CCTTCACAGGGGAAGGGGGAGGG + Intronic
1151718319 17:75842699-75842721 CCTCCTCCGGGGGAGAGGGAAGG + Intronic
1151796881 17:76352792-76352814 CCTCATCTGTGAAATGGGCATGG - Intronic
1151804634 17:76397793-76397815 CCTCACCTGGGGCAGGATGATGG + Exonic
1151963490 17:77419531-77419553 CCAGCCCTGGGGAAGGGGGAGGG - Intronic
1152272613 17:79333877-79333899 CGGCATCTGGGAGAGGGGGAAGG - Intronic
1152409714 17:80117289-80117311 GCTCATCTGGGAAATGGGGATGG - Intergenic
1152531360 17:80921323-80921345 CCTCATCTGTGTCAGGAGGATGG - Intronic
1152558725 17:81067367-81067389 CCTGAGCAGGGGAAGGGGGCGGG + Intronic
1152614512 17:81331602-81331624 CCACCTGTGGGGCAGGGGGAGGG + Intergenic
1152617434 17:81344445-81344467 TCTAAACTGGGGAGGGGGGAGGG + Intergenic
1152690236 17:81714664-81714686 CCTCATCTGCAGAAGGAGAATGG + Intronic
1152901229 17:82942226-82942248 CCCCATCTGGGGAGCGGGAAGGG - Intronic
1154352676 18:13599232-13599254 GCTGAACTGGGGAAGGGAGAGGG + Intronic
1154999832 18:21675240-21675262 CCTCATCTGTGGAATGAGGTGGG + Intronic
1155007656 18:21742112-21742134 CCTCCTCTTGGGAAGGGGTCTGG + Intronic
1155429842 18:25743849-25743871 CCCCACCTGGTGAGGGGGGATGG - Intergenic
1155632408 18:27908576-27908598 CAACTTCTGGGGAAGGGAGATGG - Intergenic
1156384703 18:36594584-36594606 CCTCATCTGCACAATGGGGATGG + Intronic
1157307082 18:46525199-46525221 CCTCCTCTGTGTAAGGGGGCTGG + Intronic
1157396143 18:47343264-47343286 CATCCTCTGGGGAAGGGAGAGGG - Intergenic
1157630279 18:49088404-49088426 CCTGTTGTGGGGTAGGGGGAGGG + Intronic
1158833939 18:61310747-61310769 CCTGTTGTGGGGTAGGGGGAGGG - Intergenic
1159129607 18:64266203-64266225 CCTGTTGTGGGGTAGGGGGAGGG - Intergenic
1160044185 18:75371492-75371514 CCTCATCTGTGGGATGGGAATGG + Intergenic
1160464341 18:79063570-79063592 CCTCATCTGGGGAAAGGTGAAGG + Intergenic
1160838754 19:1136977-1136999 CAGCACCTGGGGAATGGGGATGG + Intronic
1160939936 19:1615510-1615532 CCTCGTCTGGGCTATGGGGAGGG + Exonic
1161067087 19:2243983-2244005 CCTCATCTGGAAGACGGGGACGG - Intronic
1161163107 19:2771569-2771591 CCCCATCGGGGGGGGGGGGAGGG + Intronic
1161205828 19:3040919-3040941 GCTCATCTGGAAAAGGGGCATGG + Intronic
1161476412 19:4488378-4488400 CCACTTCTGGGCAATGGGGATGG - Intronic
1161630468 19:5352428-5352450 CCTGAGCTGGGGGAGGGGAAAGG + Intergenic
1161796142 19:6387722-6387744 CCACATCTGGGGAACAGGGCCGG + Intronic
1162066015 19:8126012-8126034 TCACATCTGGGTAAGGAGGAGGG + Exonic
1162617521 19:11814243-11814265 GTCCATCCGGGGAAGGGGGAAGG + Intergenic
1163273386 19:16267547-16267569 TCTCATCTGTGAAATGGGGATGG + Intergenic
1163573627 19:18098000-18098022 TCTCATGGTGGGAAGGGGGAAGG + Intronic
1163846397 19:19640566-19640588 CCTCCCCTGGGGAAGATGGATGG + Exonic
1164118913 19:22247894-22247916 CCTGTTGTGGGGTAGGGGGAGGG - Intergenic
1164376932 19:27695587-27695609 CCTGTTGTGGGGTAGGGGGAGGG - Intergenic
1164563695 19:29311225-29311247 CTTCATCTGGGGGAGGGAGGAGG - Intergenic
1164725299 19:30461931-30461953 CCTCTTCTGGAGAAGGGGTGGGG - Intronic
1164834659 19:31349611-31349633 CCTCGTCTGGGGACGGGGCGGGG - Intergenic
1164933380 19:32192519-32192541 CCTGTTGTGGGGAGGGGGGAGGG - Intergenic
1164944466 19:32281826-32281848 CCTGTTGTGGGGAGGGGGGAGGG - Intergenic
1165135311 19:33664440-33664462 CCTGTTGTGGGGAGGGGGGAGGG - Intronic
1165407736 19:35641413-35641435 TCTCATTTGATGAAGGGGGAAGG - Intergenic
1166156705 19:40918143-40918165 CATCATGTGGGGTGGGGGGAGGG + Intergenic
1166195383 19:41202433-41202455 CCTCACCTAGGAAATGGGGATGG + Intronic
1166765194 19:45248740-45248762 CCACATCTGGGAAATGGGGTGGG + Intronic
1166827120 19:45616553-45616575 CCCCGTCTGGGGGAGGGGGAGGG + Exonic
1167134818 19:47609916-47609938 CCTCAGCTGGGGGTGGGGGAGGG - Intronic
1167363541 19:49043110-49043132 CCTCATCCTGGGGAGTGGGAGGG + Intergenic
1167713240 19:51124995-51125017 CCTGCTCTGGGGGAGGGAGAGGG + Exonic
1167715831 19:51142393-51142415 CCTGCTCTGGGGGAGGGAGAGGG + Exonic
1168259589 19:55185979-55186001 CTTCACCTGGGGGAGGAGGAGGG + Exonic
1168318020 19:55492563-55492585 CCTCATCTGCAGACAGGGGAGGG - Intronic
1202663304 1_KI270708v1_random:92457-92479 CCTGTTGTGGGGTAGGGGGAGGG + Intergenic
925063107 2:908718-908740 CTTCACCTGGGGAAAGGGGCAGG - Intergenic
925447051 2:3936018-3936040 CCTGATGTGGGGTGGGGGGAGGG - Intergenic
925635182 2:5935652-5935674 TCTCATATGGGGATGGGGCAGGG - Intergenic
926049943 2:9738238-9738260 CCTCATCTGTGAAATGGGGATGG - Intergenic
926928406 2:18011770-18011792 CCTCTTCTGTGAAATGGGGATGG + Intronic
927064789 2:19460545-19460567 CATCACCTGGGGATGGTGGATGG - Intergenic
927207210 2:20618207-20618229 CCTTTCCTGGGAAAGGGGGAAGG + Exonic
929276236 2:40027786-40027808 CCTGACCTGGGGTGGGGGGAAGG + Intergenic
929538857 2:42804220-42804242 CCTCTGCTGAGGAATGGGGAGGG - Intergenic
930658559 2:54031273-54031295 CCTGATGTGGGGTGGGGGGAGGG - Intronic
930884907 2:56314391-56314413 CCTCATCTGTGGAATGAGAAGGG + Intronic
930908307 2:56600452-56600474 CCTGTTATGGGGTAGGGGGATGG - Intergenic
931188096 2:59973284-59973306 CCTCATCTGTAAAATGGGGATGG - Intergenic
931762800 2:65432084-65432106 CCTGATTTGGGGAGGGGGGGCGG + Exonic
932427015 2:71644347-71644369 CCTGATCTTGGGAAGGGGTAGGG - Intronic
932520785 2:72409710-72409732 CCTGCTGTGGGGTAGGGGGAGGG + Intronic
932526078 2:72470615-72470637 CCTGTTGTGGGGTAGGGGGAGGG - Intronic
932587981 2:73044218-73044240 CCTCATCTTGGCAAAGGGCATGG + Intronic
932718024 2:74116994-74117016 CCTCAAATGGGCAAGGGAGAGGG + Intergenic
933529610 2:83490076-83490098 ACTCTTCTGGGGTTGGGGGAGGG + Intergenic
933972852 2:87484111-87484133 GCTGATGTGGGGAAGGGAGAAGG - Intergenic
934118693 2:88819544-88819566 CCTGTTGTGGGGTAGGGGGAGGG + Intergenic
934712310 2:96523965-96523987 CCTCCTCTGGGAAAGGGCCAGGG - Intergenic
935698331 2:105789090-105789112 CCTCAGCTGAGGAAGGTGGGTGG - Intronic
936073596 2:109387529-109387551 TCACATCTGGGGAAGGGTGATGG - Intronic
936320869 2:111466102-111466124 GCTGATGTGGGGAAGGGAGAAGG + Intergenic
936589175 2:113786898-113786920 CCTGTTGTGGGGTAGGGGGAGGG - Intergenic
936644730 2:114355898-114355920 CCTGTTGTGGGGTAGGGGGAGGG - Intergenic
937343285 2:121105518-121105540 TCTCATCTGGGAAATGGGGATGG - Intergenic
937410494 2:121670581-121670603 CCTCCTCTGGGGGAGGTGGCAGG - Intergenic
937436598 2:121886730-121886752 GATCTTCTGGGGAAGGGAGAGGG - Intergenic
937614444 2:123905029-123905051 CCTGTTGTGGGGTAGGGGGAAGG - Intergenic
938343376 2:130549682-130549704 CCTCATCGGGCGGAGGGGGACGG + Intronic
938346457 2:130571040-130571062 CCTCATCGGGCGGAGGGGGACGG - Intronic
938377947 2:130820724-130820746 CCTCCTCTGCGGCACGGGGAAGG + Intergenic
939957282 2:148537810-148537832 CCACATCTGGGGAAGGCTTAGGG - Intergenic
942184373 2:173410653-173410675 CCTCATCTGGAAATGGGAGATGG - Intergenic
943120964 2:183734777-183734799 CCTATTGTGGGGTAGGGGGAGGG + Intergenic
943820969 2:192320422-192320444 CCTGTTGTGGGGTAGGGGGAAGG + Intergenic
944077627 2:195749825-195749847 ACTGTTGTGGGGAAGGGGGAGGG + Intronic
944999293 2:205331417-205331439 CCTCATCTGGGCTAGGGTGGAGG + Intronic
945027925 2:205637075-205637097 CCTCATTTGGTAAAGGGGGGTGG - Intergenic
945058389 2:205887878-205887900 CCTGATCTGTGGAATGGGGGTGG - Intergenic
945182323 2:207104609-207104631 CCTCATCTAGAAAATGGGGAGGG - Intronic
945553763 2:211254065-211254087 CCTGTTGTGGGGTAGGGGGAGGG - Intergenic
946046099 2:216822372-216822394 CCTAATCTGGAAAATGGGGATGG - Intergenic
946074807 2:217064884-217064906 TCTCATTTGGGGATGGGGGGCGG + Intergenic
946105668 2:217367559-217367581 CTACAGCTGGGGAAAGGGGAAGG - Intronic
946302221 2:218830894-218830916 GCTCATCTCTGGAAGGGGAATGG + Exonic
946327547 2:218992597-218992619 CCTCAGCTGGGGCAGGGGTAGGG + Intronic
946807884 2:223490017-223490039 CCTCATCTGAGAAATAGGGATGG + Intergenic
946940961 2:224769869-224769891 CCTCAACTAGGGATGGCGGAGGG + Intronic
947324681 2:228961475-228961497 CCTCCCCTGGGGAAGGAGCAAGG - Intronic
948146988 2:235715453-235715475 CCTCCTCAGGTGAAAGGGGAGGG + Intronic
948266362 2:236637942-236637964 CCAGATCTGGGGAGGAGGGAAGG - Intergenic
1169660403 20:7972642-7972664 CTCCAAATGGGGAAGGGGGAGGG + Intergenic
1170378861 20:15734056-15734078 TCTGATCTGGGCAAGGGAGAGGG + Intronic
1170783397 20:19447272-19447294 CCTCCTCTGGCAAACGGGGAAGG + Intronic
1170796606 20:19552873-19552895 CTTCATCAGAGGAAAGGGGAGGG + Intronic
1170920548 20:20674929-20674951 CCTAAAATGGTGAAGGGGGAGGG + Intronic
1171023983 20:21611954-21611976 CCTGTTGTGGGGTAGGGGGATGG + Intergenic
1171400924 20:24872661-24872683 CATCCCCAGGGGAAGGGGGAGGG + Intergenic
1171442998 20:25180987-25181009 CCTGTTGTGGGGAAGGGGGCAGG - Intergenic
1171480441 20:25451713-25451735 CCTGTCCTGGGGTAGGGGGAGGG - Intronic
1171504814 20:25624446-25624468 GGTGATCTGGGGACGGGGGAAGG + Intergenic
1172094897 20:32455812-32455834 GCTGTTCTGGGGGAGGGGGATGG + Intronic
1172116802 20:32577879-32577901 CCTCATCTGGAAAATGGGAATGG - Intronic
1172884121 20:38219984-38220006 TCCCTTCTAGGGAAGGGGGAGGG - Intronic
1172933366 20:38601475-38601497 CCTCCTCTGTGAAATGGGGATGG - Intergenic
1172942213 20:38661923-38661945 CCTACTATGGGGGAGGGGGAGGG + Intergenic
1173055748 20:39610917-39610939 CCTGTTGTGGGGAAGGGGGTTGG + Intergenic
1173252211 20:41370034-41370056 CCACATCTGGGGCTGGGGAAGGG - Intergenic
1173556858 20:43972607-43972629 CCTCATCTGTTAAATGGGGATGG - Intronic
1173852985 20:46230487-46230509 CCTCAGCTGTGAAATGGGGATGG - Intronic
1174520986 20:51130474-51130496 CCTCATCTGAAGAAGGGGGTCGG + Intergenic
1174962492 20:55174112-55174134 CCCCTTTGGGGGAAGGGGGAAGG + Intergenic
1174997027 20:55581440-55581462 CCTGAGCTGGGGTAGGGGGCTGG + Intergenic
1175470007 20:59220933-59220955 CCTCATCTGTAGAATGGGGCTGG + Intronic
1175830410 20:61962264-61962286 CCTGATAAGGGGAAGGCGGATGG + Intronic
1175900794 20:62359192-62359214 CCTCATCTGAGGGAGGCGGGAGG + Intronic
1175919617 20:62444613-62444635 CCTCATCTGTGCAGCGGGGAAGG + Intergenic
1175948784 20:62571567-62571589 CCTGAGGTGGGGGAGGGGGATGG + Intergenic
1175988173 20:62774642-62774664 CCTCCACTGGGGCAGGCGGAGGG + Intergenic
1176084407 20:63289521-63289543 CTTCCTCGGGGGTAGGGGGACGG + Intronic
1176201792 20:63864265-63864287 CCTCATCTGTGGAGTGGGGAGGG + Intergenic
1177322101 21:19535999-19536021 CCTGTTGTGGGGTAGGGGGAAGG - Intergenic
1177336258 21:19732654-19732676 CCTGTTGTGGGGTAGGGGGAGGG - Intergenic
1177851996 21:26359652-26359674 CCTGTTGTGGGGTAGGGGGAGGG + Intergenic
1178628973 21:34243050-34243072 CATCCTCTGGGGCAGGTGGAAGG + Intergenic
1178836863 21:36105520-36105542 CCTCCCCTAGGGAAAGGGGAAGG + Intergenic
1178860802 21:36287451-36287473 ACTCAGCTGTGGCAGGGGGACGG + Intronic
1178935039 21:36854368-36854390 GCACATCTGGGGCACGGGGAAGG + Intronic
1179037801 21:37774498-37774520 CCTGTTGTGGGGTAGGGGGAGGG - Intronic
1179426231 21:41280644-41280666 CCACATCTGCGGAATGTGGAAGG + Intronic
1179938196 21:44618585-44618607 ACCCAGCTGGGGATGGGGGATGG - Intronic
1179951445 21:44710965-44710987 GCTCATGTGGGGAAGGAGCAGGG + Intronic
1180727118 22:17954459-17954481 CATCACCTGGGGCATGGGGAGGG + Intronic
1181456810 22:23064512-23064534 CCAACTCTGGGGCAGGGGGAGGG - Intronic
1181728303 22:24826894-24826916 CCTCATCTGTGTAACGGGGATGG - Intronic
1181802777 22:25358261-25358283 CCTCATCTGTGAAAGAGGAAGGG - Intronic
1182055003 22:27345644-27345666 CCTCAACTGGAGAAGGAAGAGGG - Intergenic
1182117013 22:27762321-27762343 CCTCATCTATGAAATGGGGATGG + Intronic
1182137783 22:27921733-27921755 CATCATCTGGGGAATGGTGGAGG + Intergenic
1182151281 22:28028872-28028894 CGTCATCTGTGAAATGGGGATGG - Intronic
1182191332 22:28463755-28463777 CCTGTTGTGGGGTAGGGGGAGGG + Intronic
1182586480 22:31346646-31346668 GCGGATCTGGGGAATGGGGAGGG - Intergenic
1182823786 22:33244373-33244395 CCTCATCTGCACAATGGGGATGG - Intronic
1183093820 22:35540720-35540742 CCTCATCTGGGGACAGGAGGAGG + Intergenic
1183096861 22:35557428-35557450 TTTCATCTGGGGATGGGGGTTGG - Intergenic
1183241424 22:36660622-36660644 CCTCACCTGGGCAAGGTGGGGGG - Intronic
1183255156 22:36757211-36757233 CCTCATTTGTAAAAGGGGGATGG + Intergenic
1184340722 22:43884438-43884460 CTTCATCTGCAGAAGGTGGAGGG - Intronic
1184842269 22:47058928-47058950 CCTCAACTGAGGGAGGGGTATGG - Intronic
1185111893 22:48904963-48904985 CCACATCAGGGGAACGGAGAGGG - Intergenic
1185111910 22:48905028-48905050 CCACATCAGGGGAACGGAGAGGG - Intergenic
1185152800 22:49175628-49175650 CCTCATGAGGTGAAAGGGGAAGG - Intergenic
1185168381 22:49276489-49276511 CTTCAGCTGGGGCTGGGGGATGG - Intergenic
1185196125 22:49470591-49470613 CCCCAACTGCGGAAGGAGGACGG + Intronic
1185281202 22:49970876-49970898 CGTCATTTGGGGGCGGGGGAGGG - Intergenic
1185392276 22:50569022-50569044 TCTGAGCTGGGGGAGGGGGAGGG + Exonic
949207629 3:1459209-1459231 CCTCTTGTGGGGTAGGGGGAGGG - Intergenic
949249791 3:1970181-1970203 CCACATCTGGGGAGGGGTCATGG - Intergenic
949510041 3:4759540-4759562 CCTCATCTGTGAAATGTGGAAGG + Intronic
949593261 3:5515901-5515923 CCTGTTGTGGGGTAGGGGGAGGG - Intergenic
949620138 3:5801726-5801748 CCTGTTGTGGGGTAGGGGGAGGG - Intergenic
949668760 3:6373495-6373517 CCTGTTGTGGGGTAGGGGGAGGG + Intergenic
949935495 3:9112617-9112639 CCTCTCCTGGGGAAGGCGGAGGG + Intronic
950250383 3:11460457-11460479 CCTGATGTGGGCAAGGGAGAGGG + Intronic
950374560 3:12560060-12560082 CCTCATCTGTGAAATGAGGATGG + Intronic
950521382 3:13499949-13499971 CCTCATCTGTAAAATGGGGATGG + Intronic
950561010 3:13724591-13724613 ACTCTTCTGGGCAATGGGGAAGG - Intergenic
950653844 3:14424517-14424539 CCTGCTCTGGGCAATGGGGAGGG + Intronic
950670559 3:14522900-14522922 CTTCATCTGGGGAAGGGGCATGG + Intronic
950704705 3:14772679-14772701 CCTCACCTGTGCAAGGGAGAGGG + Intronic
950869039 3:16213024-16213046 CCTCACCTGGGGCCAGGGGAGGG + Intronic
951010909 3:17677990-17678012 CCTGTTGTGGGGTAGGGGGAGGG + Intronic
951308745 3:21098557-21098579 GCTCATCTGTGGAATGGGAATGG - Intergenic
951861459 3:27258368-27258390 CCTGTTGTGGGGTAGGGGGAGGG - Intronic
952490711 3:33870010-33870032 GCTGATGAGGGGAAGGGGGATGG + Intergenic
952838905 3:37627934-37627956 CTGCCTCTGGGGAAGGGGGCTGG + Intronic
952966055 3:38621975-38621997 TCTCATCTGTGCAATGGGGAAGG + Intronic
953418294 3:42735422-42735444 CCACAGCTGGGGATGGGAGAGGG + Intronic
954298026 3:49684950-49684972 GCTTGCCTGGGGAAGGGGGAAGG + Intronic
954403137 3:50329851-50329873 CCTCCTGTGGGGAAAGGGGTTGG - Exonic
954584404 3:51720965-51720987 CCTGACATGGGAAAGGGGGAGGG + Intergenic
954619839 3:51989243-51989265 CCTCATCTGTGAAATGGAGATGG - Intergenic
954688474 3:52383369-52383391 CTTGATCTGGGGAGGGGTGAAGG - Exonic
955146555 3:56325788-56325810 TCTCATCTGTAGAAAGGGGATGG - Intronic
956051852 3:65256671-65256693 CCTGGGCTGGGGAAGGGGGGTGG - Intergenic
956492153 3:69784606-69784628 TCTAATATGGGGGAGGGGGAAGG - Intronic
956525810 3:70159323-70159345 CCTCTTGTGGGGTGGGGGGATGG - Intergenic
956728875 3:72178364-72178386 AATCACCTGGGGAAGGGGTAGGG + Intergenic
956882597 3:73526371-73526393 CCTTATCTGTGGAATGGGTATGG - Intronic
958111290 3:89149631-89149653 CCTGTTGTGGGGAGGGGGGAGGG - Intronic
959917505 3:111832464-111832486 TTTCCTCTGGGGAATGGGGATGG - Intronic
960368767 3:116808466-116808488 CCTGTTGTGGGGTAGGGGGAGGG + Intronic
960677062 3:120205495-120205517 TCCCATATGGGGAAGGGGGCCGG - Intronic
960731497 3:120732711-120732733 CCTGTTGTGGGGTAGGGGGAGGG - Intronic
960923618 3:122774261-122774283 CCTGATTTGGGGTATGGGGAAGG + Intronic
961483543 3:127199891-127199913 CCTCAGCTGGGGAGGGGAGAGGG + Intergenic
961485144 3:127210910-127210932 CCCCCTCTGTGGAATGGGGAGGG - Intergenic
961584796 3:127913525-127913547 CCTTTTTTGGGGGAGGGGGATGG - Intergenic
961638505 3:128349969-128349991 CCACCACTGTGGAAGGGGGATGG - Intronic
962481647 3:135803222-135803244 CCACATCTAGCGGAGGGGGAAGG - Intergenic
962613643 3:137103102-137103124 CATAAGCTGGGGTAGGGGGAGGG - Intergenic
962752516 3:138444266-138444288 CCTCAGATGGGGAGGGTGGAGGG + Intronic
963212313 3:142706776-142706798 CCTGATCTGGGGAAGAAGAAGGG + Intronic
963239509 3:142989232-142989254 CCTGTTGTGGGGTAGGGGGAAGG + Intronic
963293127 3:143513993-143514015 CCTGTCCTGGGGTAGGGGGACGG - Intronic
963630963 3:147729458-147729480 CCTGTTGTGGGGTAGGGGGAGGG - Intergenic
964305629 3:155336490-155336512 CAACATCTGGGGAAGGGGAAAGG - Intergenic
964330687 3:155599012-155599034 CTTCATATGGGGAGGGGGGCGGG - Intronic
965271783 3:166626890-166626912 CCTGTTGTGGGGTAGGGGGACGG - Intergenic
965614986 3:170585041-170585063 ACTCATTTGGGGAGGGGGCAGGG + Intronic
966400990 3:179546732-179546754 CTCCACCTGGGGAAAGGGGAGGG + Intergenic
967126347 3:186427868-186427890 CTGCAGCTGGGGAAGGGGGCAGG + Intergenic
967431085 3:189385973-189385995 CCTGTTGTGGGGTAGGGGGAGGG - Intergenic
967680936 3:192363082-192363104 CCTGTTGTGGGGTAGGGGGAGGG + Intronic
968620052 4:1599957-1599979 CTGCATCAGGGGAAGGGAGAGGG - Intergenic
968927842 4:3559209-3559231 CCTCACCAGAAGAAGGGGGAGGG + Intergenic
969597184 4:8156193-8156215 CCTGAGCTGGGGCAGGGGGTGGG - Intronic
969600541 4:8173645-8173667 CCTCATCTGTGCAAGGGCGATGG - Intergenic
969627687 4:8316148-8316170 CCGCATCTGGAGGTGGGGGAGGG - Intergenic
969639248 4:8387253-8387275 CCTCATCTGCAGCACGGGGACGG - Intronic
969807760 4:9623920-9623942 CCTCTTGTGGGGTGGGGGGAGGG + Intergenic
970085438 4:12340789-12340811 CCTGTTGTGGGGTAGGGGGAGGG + Intergenic
970237711 4:13975402-13975424 CCTCACATGGCGAAAGGGGAAGG + Intergenic
970791482 4:19862950-19862972 CCTGTCCTGGGGCAGGGGGAGGG - Intergenic
970996143 4:22269225-22269247 CCTGTTCTGGTGAAGGTGGAAGG - Intergenic
971096851 4:23416374-23416396 CCTGTTGTGGGGAGGGGGGAGGG - Intergenic
971774868 4:30950103-30950125 CAACACCTGGGGAAGGGAGATGG - Intronic
972686160 4:41355449-41355471 CCTGTTGTGGGGTAGGGGGAGGG + Intergenic
972784748 4:42315793-42315815 CCTCCCCTAGGGAAAGGGGAAGG + Intergenic
973153744 4:46922150-46922172 GCTAATGTGGGGAAGGGGGTGGG + Exonic
974292168 4:59947411-59947433 CATTTTCTGGGGAAGGAGGAGGG - Intergenic
974415097 4:61596019-61596041 CCACAGCCGGGGAATGGGGAGGG + Intronic
974507247 4:62791578-62791600 CCTCATCTGGGGTGGGTTGAGGG - Intergenic
975340036 4:73229126-73229148 CCTGTTGTGGGGTAGGGGGAGGG + Intronic
975579331 4:75892476-75892498 CCTCATCTGGAAAAGGGGCGGGG + Intronic
975686818 4:76924397-76924419 CCATATCTGGGGAGGGGAGAGGG + Intergenic
975691043 4:76963951-76963973 CCTGTTGTGGGGTAGGGGGAGGG - Intronic
975813705 4:78195708-78195730 CCTCATCCGGGGAAGCGCAAGGG - Intronic
976017550 4:80576028-80576050 CCTGTTGTGGGGTAGGGGGATGG + Intronic
976150595 4:82087517-82087539 ACTCTTCTGGGGTGGGGGGAGGG - Intergenic
976700955 4:87967701-87967723 CTTCATCTGGTGAAAGGGTAAGG + Intergenic
976726919 4:88223794-88223816 CCTCATCTGGAGAGGGATGAAGG + Intronic
978004207 4:103596751-103596773 ACTCTTGTGGGGTAGGGGGACGG - Intronic
978695416 4:111571080-111571102 CCTGTTGTGGGGTAGGGGGAAGG + Intergenic
979048831 4:115903615-115903637 CCTGTTGTGGGGGAGGGGGAGGG + Intergenic
980024802 4:127752412-127752434 CCTGTTGTGGGGTAGGGGGAGGG + Intronic
980588433 4:134850778-134850800 CCTGTTGTGGGGTAGGGGGATGG + Intergenic
980653178 4:135747939-135747961 CCTGTTGTGGGGCAGGGGGAGGG - Intergenic
981290669 4:143071340-143071362 CCTCACCTGGTGAGGAGGGATGG + Intergenic
981555391 4:145988001-145988023 ACTCTTCTGGGGAGGGAGGAAGG - Intergenic
982683735 4:158463339-158463361 CCTGTTGTGGGGTAGGGGGAGGG - Intronic
983278171 4:165644165-165644187 CCTGTTGTGGGGTAGGGGGAGGG + Intergenic
983451318 4:167914546-167914568 CCTGTTGTGGGGCAGGGGGAGGG + Intergenic
984043121 4:174762382-174762404 TCTGATCTGGGGATGGGGGCTGG - Intronic
984603651 4:181758294-181758316 CATCTTCAGGGGAAGGGAGAAGG + Intergenic
984853989 4:184177283-184177305 CCCCATCTGGTGAGGAGGGATGG - Intronic
986033033 5:3910914-3910936 CCTGTTGTGGGGTAGGGGGAGGG + Intergenic
986275564 5:6272211-6272233 CACCAGCTGGGGAAGGGGGAAGG - Intergenic
986849000 5:11788826-11788848 CCTGTTGTGGGGTAGGGGGAGGG - Intronic
987073314 5:14358161-14358183 CCACAGCTGGGGAAGGGGAGAGG - Exonic
987183018 5:15386252-15386274 CCAGCTCTGGGGAAGGAGGAGGG - Intergenic
987774691 5:22349076-22349098 CCTCATATGGTGAAGGGACAAGG - Intronic
987781117 5:22436262-22436284 CCTGTTGTGGGGTAGGGGGAGGG + Intronic
987908755 5:24114346-24114368 CCTGTTGTGGGGTAGGGGGAGGG - Intronic
989062275 5:37421080-37421102 CCTCACCTGTCGAAAGGGGATGG - Intronic
989127643 5:38072612-38072634 CTTCATCTGTAAAAGGGGGAGGG + Intergenic
989804604 5:45587542-45587564 CCTCTTGTGGGGTAGGGGGAGGG + Intronic
990038829 5:51354654-51354676 CCTGTTGTGGGGTAGGGGGATGG + Intergenic
990163581 5:52970816-52970838 CCTGTTGTGGGGTAGGGGGACGG - Intergenic
990482705 5:56227331-56227353 CCTGTTGTGGGGTAGGGGGAGGG + Intronic
990510629 5:56486400-56486422 CCTCATCTGTAAAATGGGGAGGG - Intergenic
990592947 5:57283944-57283966 CCTTATCTTTGGAAAGGGGAGGG + Intergenic
990829081 5:59936204-59936226 CCTGTTGTGGGGTAGGGGGAAGG + Intronic
990922434 5:60982547-60982569 CCTGATGTGGGGTGGGGGGAGGG - Intronic
990934201 5:61129635-61129657 CCTGTTGTGGGGTAGGGGGAGGG + Intronic
991446271 5:66703138-66703160 CCTCATGTGGGGAGGGGAGTAGG + Intronic
991490031 5:67173711-67173733 CCTGTTGTGGGGTAGGGGGAGGG + Intergenic
991657102 5:68914897-68914919 GACCATGTGGGGAAGGGGGAAGG - Intergenic
992444879 5:76824336-76824358 CTTCATCTGGGGTTCGGGGATGG - Intronic
992611280 5:78510393-78510415 CCTCACCTAGGGGAGAGGGAGGG + Exonic
992712613 5:79475186-79475208 CCTCATCTTCAAAAGGGGGATGG - Intronic
992947117 5:81821953-81821975 ACTCAGTTGTGGAAGGGGGATGG + Intergenic
993212734 5:84975543-84975565 CCTGTTGTGGGGTAGGGGGAGGG - Intergenic
994392856 5:99206375-99206397 TAACATCTGGGGAGGGGGGAAGG - Intergenic
994531438 5:100977770-100977792 CCTGTTGTGGGGGAGGGGGAGGG - Intergenic
994793690 5:104265682-104265704 TCACAGCTGGGGAAGGGGGGTGG - Intergenic
994888134 5:105593229-105593251 CCTCTTTTGGGGAAGAGGGAGGG - Intergenic
995123184 5:108556767-108556789 TCTCATCTGAGGGAAGGGGAGGG + Intergenic
995177408 5:109194897-109194919 CCCCATTTGGGGACGGGGGGAGG + Exonic
995280647 5:110331758-110331780 CCTCACATGTGGAAGGGGAAGGG - Intronic
995356519 5:111243321-111243343 CATCACCTGGGGAAGAGTGAAGG + Intronic
995472401 5:112516633-112516655 CCTCTTGTGGGGTGGGGGGATGG - Intergenic
995855736 5:116590206-116590228 CCTGTTGTGGGGTAGGGGGAGGG + Intergenic
996819857 5:127614540-127614562 CCTGTTTTGGGGTAGGGGGAAGG + Intergenic
997006218 5:129819471-129819493 CCTGTTCTGGGGTGGGGGGATGG + Intergenic
998417885 5:141958755-141958777 CCTCATCTGTAGAGTGGGGATGG + Exonic
998498446 5:142611363-142611385 CCTCACCTGTGGAATGGGAATGG - Intronic
998906461 5:146910548-146910570 CCTCATCTGCAAAAGGGTGATGG + Intronic
999689734 5:154136379-154136401 CATCATCTGGGGATGGTAGAGGG - Intronic
999814009 5:155157742-155157764 CCTGTTGTGGGGTAGGGGGAGGG - Intergenic
999861278 5:155649299-155649321 CCTCATCTGTAAAATGGGGATGG + Intergenic
999956609 5:156709862-156709884 CCTACTCTGGGGAAATGGGAAGG + Intronic
1001037387 5:168307164-168307186 CCTCATCTGCAGAATGGAGATGG - Intronic
1001287645 5:170435471-170435493 CCTCATCTGGAGAGCGGGGCTGG + Intronic
1001401761 5:171450460-171450482 CCTCATCTGTGGAATGGGGATGG - Intronic
1001489376 5:172144852-172144874 CCTCATCTGTAAAAGGGGGTGGG - Intronic
1001773200 5:174311161-174311183 CCTCATCTGTGGAATGGGCGTGG + Intergenic
1001935030 5:175697572-175697594 CCCCAGCGGGGGAATGGGGAAGG - Intergenic
1002184354 5:177447261-177447283 CCGCGTCGGGGGAGGGGGGAGGG - Intronic
1002461428 5:179375842-179375864 GCTCAGCAGGGGAGGGGGGAAGG + Intergenic
1002599612 5:180346709-180346731 CTTCATCTGGGGTAGGGGGTTGG - Intronic
1002965740 6:1964819-1964841 CCTGTTGTGGGGTAGGGGGAGGG - Intronic
1003264568 6:4553981-4554003 CCTCATCTGGGTCAAGGCGATGG + Intergenic
1003946445 6:11080453-11080475 CATCCTCTGGGGAAGAGAGAGGG - Intergenic
1004065148 6:12236973-12236995 CCTGATGTGGGGTGGGGGGAGGG - Intergenic
1004075334 6:12339660-12339682 CCTCACCTGGGGCAGAGGGCAGG + Intergenic
1004461624 6:15842066-15842088 CCACCTCTGGGGAGGGGAGAGGG - Intergenic
1004955134 6:20721109-20721131 CCTGTTGTGGGGTAGGGGGAGGG - Intronic
1005932129 6:30491648-30491670 GCTCAGGTGGGGAAGGGAGAAGG + Exonic
1006509169 6:34512484-34512506 CCTCAGCTGGGGGACAGGGAGGG - Intronic
1007021726 6:38528050-38528072 CCACTACTGGGGAATGGGGAAGG - Intronic
1007397782 6:41587322-41587344 CCCCAGCTGTGGAAGGGCGAGGG + Exonic
1007638017 6:43311973-43311995 CTTCATCTGGGTAATGGGGTAGG + Intronic
1007765713 6:44158680-44158702 CCTCAGCTGGGTAAGGGGCTGGG + Intergenic
1007795374 6:44342800-44342822 CCTCCCCTGGGGAAGGGGGTGGG + Exonic
1007918019 6:45579262-45579284 CCTCATCTGTAAAATGGGGATGG - Intronic
1008109759 6:47478607-47478629 CCTCCTCGTGGGATGGGGGAGGG + Intronic
1008570200 6:52809378-52809400 CGAGATCTGGGGAAGGGGCATGG + Intergenic
1008857763 6:56112505-56112527 CCTCTGCTGGGGAAGGGGGAGGG - Intronic
1009384327 6:63070425-63070447 CCTGTTGTGGGGTAGGGGGAGGG - Intergenic
1009429634 6:63551684-63551706 CCTGTTGTGGGGTAGGGGGAGGG - Intronic
1009874335 6:69486184-69486206 CCTGTTTTGGGGTAGGGGGAGGG + Intergenic
1010272980 6:73935764-73935786 CCTGTTGTGGGGTAGGGGGACGG - Intergenic
1010351777 6:74883432-74883454 CCTGTTGTGGGGCAGGGGGAGGG - Intergenic
1010980153 6:82363032-82363054 CTACATCTGGGGAGGGGGGCGGG + Intergenic
1011752619 6:90468554-90468576 CCACATATGGGGTATGGGGAAGG - Intergenic
1011863478 6:91791284-91791306 CCTCTTGTGGGGTTGGGGGAGGG - Intergenic
1012861998 6:104571252-104571274 CCTGTTGTGGGGTAGGGGGAGGG + Intergenic
1013486500 6:110601439-110601461 CCTGTTGTGGGGTAGGGGGAGGG + Intergenic
1013501695 6:110758466-110758488 CCTCATTTGGGGATGGGGTAAGG - Intronic
1013501935 6:110760784-110760806 CCTCATCTGTATAATGGGGATGG - Intronic
1014097327 6:117474562-117474584 CCTGTTGTGGGGCAGGGGGAGGG + Intronic
1014815189 6:125927803-125927825 CCTCAGTTGGGGAAGGGGATAGG + Intronic
1015360249 6:132331732-132331754 CCACAGCTGGGAAAGGGTGATGG + Intronic
1015420670 6:133004270-133004292 CCTGTTGTGGGGTAGGGGGAGGG - Intergenic
1015930620 6:138355761-138355783 CCTGTTGTGGGGAGGGGGGAGGG - Intergenic
1016109684 6:140206859-140206881 CCTCATATGGGGTAAGGGGTCGG - Intergenic
1016218657 6:141636755-141636777 CCTGTTGTGGGGTAGGGGGAGGG - Intergenic
1016363320 6:143290931-143290953 CCCCATCTTGGGAAGAGGGTGGG - Intronic
1016388802 6:143554580-143554602 CCTCACCTGAGGAAAGGTGAAGG + Intronic
1017173030 6:151475758-151475780 CCTCACGTGGAGAAGGCGGACGG + Intergenic
1017505449 6:155064898-155064920 CCTCCTCTGGGGAAGAGGAGAGG - Intronic
1017595645 6:156025901-156025923 CCTCACATGGTGGAGGGGGAGGG - Intergenic
1018589256 6:165399573-165399595 CCTGTTGTGGGGAGGGGGGAGGG - Intronic
1018980475 6:168598281-168598303 CCTCGTTTGGGGGTGGGGGATGG + Intronic
1019412519 7:912426-912448 CCACATCTGGGGGAGGGGTGCGG + Intronic
1019609961 7:1931325-1931347 CCTCATCTGGAGAATGGGGAGGG + Intronic
1019880041 7:3850851-3850873 CCTGTTGTGGGGTAGGGGGAGGG + Intronic
1020719507 7:11723318-11723340 CCTGTTGTGGGGTAGGGGGAGGG + Intronic
1021430734 7:20555952-20555974 CCTGTTGTGGGGTAGGGGGAGGG + Intergenic
1021685159 7:23178255-23178277 AATCATCTTGGGAAGGAGGAAGG - Intergenic
1021982319 7:26066889-26066911 CCTCATCTGTAAAATGGGGATGG - Intergenic
1023363311 7:39438093-39438115 CCTGTTGTGGGGTAGGGGGATGG - Intronic
1023805677 7:43871243-43871265 CCTAATCAGAGGAAAGGGGAAGG + Intronic
1023986780 7:45101609-45101631 CAGCATCTGGGGAAGGGGTGTGG + Exonic
1024244106 7:47456414-47456436 CCCCACCTGGGGAATGGGGGTGG + Intronic
1024390588 7:48807204-48807226 CCTCACATGGTGAAGGGGCAAGG - Intergenic
1024918004 7:54525249-54525271 CCCAAACTGTGGAAGGGGGAAGG - Intergenic
1024963013 7:54997132-54997154 ACTCAGCAGGGGAAAGGGGAAGG - Intergenic
1025092884 7:56077988-56078010 TTGCATCTGGGGAAGGGGAAGGG - Intronic
1025109309 7:56200141-56200163 CCTGTTGTGGGGAGGGGGGAGGG - Intergenic
1026015714 7:66669308-66669330 CCTCCTCTGGTGACTGGGGAGGG - Intronic
1026228001 7:68459567-68459589 CCTCCTCTGAGGATGGAGGATGG + Intergenic
1026559113 7:71433348-71433370 CCCCATCTGTGGAGGAGGGATGG + Intronic
1027250844 7:76397827-76397849 CCTCACCTGGGGATGGGGGCGGG + Exonic
1027435125 7:78156289-78156311 CCACATGTGGGGAAGGGGACAGG + Intronic
1028020395 7:85764524-85764546 CTTCATGTGGGGTGGGGGGAGGG - Intergenic
1028306249 7:89269211-89269233 CCTGTTGTGGGGTAGGGGGAAGG - Intronic
1028745700 7:94323991-94324013 CCTCATCTGCCAAAGGGGAAGGG - Intergenic
1028840881 7:95429181-95429203 CCTCTTGTGGGGTAGGGGGAGGG - Intronic
1029057962 7:97766389-97766411 CCTGTTGTGGGGTAGGGGGAGGG + Intergenic
1029099236 7:98114634-98114656 CTGCATCTGGTGAAGGGAGACGG + Intronic
1029176793 7:98670252-98670274 CCTCATCTGTAGAATGGAGAAGG + Intergenic
1029515261 7:101019747-101019769 CCTGAGCTGGGAAAGGAGGAGGG - Intergenic
1029714832 7:102320168-102320190 CCCCATCTGGAGATGGGGAATGG - Intronic
1029750567 7:102540312-102540334 CCTCATTTGGGAAAGGTAGAGGG + Intronic
1029768520 7:102639420-102639442 CCTCATTTGGGAAAGGTAGAGGG + Intronic
1029976124 7:104835914-104835936 TCCCATTTGGGGAAAGGGGAGGG - Intronic
1030676410 7:112390379-112390401 CCTCATCTGTAAAATGGGGATGG + Intergenic
1030997595 7:116377220-116377242 CCTGTTGTGGGGTAGGGGGAGGG + Intronic
1031326804 7:120410694-120410716 CCTGTTGTGGGGTAGGGGGAGGG - Intronic
1032322539 7:130898016-130898038 CCTCATCTGTGAAATGGGGATGG - Intergenic
1032476633 7:132215638-132215660 TCTCCTCTGGGGAAGGGAGAGGG + Intronic
1032518857 7:132527409-132527431 CCTCATCTGCTCAATGGGGATGG - Intronic
1032939300 7:136770032-136770054 CCTGTTGTGGGGTAGGGGGAGGG - Intergenic
1033346579 7:140529786-140529808 CCTGTTGTGGGGTAGGGGGACGG + Intronic
1033673591 7:143516051-143516073 CTTGATGTGGGGAAGGGGCAAGG + Intergenic
1034343052 7:150370112-150370134 CCTCCTCCGCGGAAGGAGGAAGG - Intronic
1034453391 7:151149919-151149941 CCTTGGCTGGGGAAAGGGGAAGG - Intronic
1035607829 8:940617-940639 CGTTTTCGGGGGAAGGGGGAAGG + Intergenic
1035695368 8:1591776-1591798 CCTCTGCTGGGGATGGGTGAGGG - Intronic
1035905769 8:3508350-3508372 CCTGTTATGGGGCAGGGGGAGGG + Intronic
1036216042 8:6880761-6880783 CCTGTTGTGGGGTAGGGGGAGGG - Intergenic
1036729509 8:11249971-11249993 CCTCATCTGAAAAATGGGGATGG - Intergenic
1036984943 8:13519132-13519154 CTACATCTGGGGAGGGGGGAGGG - Intergenic
1037057423 8:14459260-14459282 CCTGTTGTGGGGTAGGGGGATGG + Intronic
1037195004 8:16178252-16178274 CCTGTTGTGGGGTAGGGGGAGGG - Intronic
1037801628 8:22039093-22039115 CCTCATCTGGGAAATGGGGCTGG - Intergenic
1037821685 8:22138230-22138252 CCACAACCGGGGAAGGGAGAGGG + Exonic
1038500547 8:28040035-28040057 CCTCTTCTGGAGAAGGTAGATGG - Intronic
1039630371 8:39106159-39106181 CTCCATCTGGGGCAGGTGGAGGG - Intergenic
1041026728 8:53694340-53694362 CCTCTTGTGGGGTCGGGGGAGGG - Intergenic
1041518664 8:58730636-58730658 CCTGTTGTGGGGAGGGGGGAGGG + Intergenic
1041991799 8:64001568-64001590 TCTCATGTGGGGTGGGGGGAGGG - Intergenic
1042026778 8:64432392-64432414 CCTGTTGTGGGGTAGGGGGAGGG - Intergenic
1042692993 8:71524224-71524246 CCTCATCTGGTAAATTGGGAGGG - Intronic
1042713113 8:71741664-71741686 CCTGTTGTGGGGTAGGGGGAGGG - Intergenic
1042829400 8:73009866-73009888 CCCCATCTTGGGACGGGGGCGGG - Intronic
1042980588 8:74522317-74522339 CCTGTTGTGGGGTAGGGGGAGGG + Intergenic
1043744413 8:83855486-83855508 CCTGTTCTGGGGTTGGGGGAGGG + Intergenic
1043754420 8:83985228-83985250 CCTCCTCTGGGGAAATGGAAAGG - Intergenic
1043994748 8:86799345-86799367 AATCATCAGGGGAAGGGGAAAGG - Intergenic
1044219782 8:89656542-89656564 CCTGTTGTGGGGTAGGGGGAGGG - Intergenic
1044722163 8:95160913-95160935 ACTCACCTGGGGGTGGGGGAGGG + Intergenic
1044954852 8:97469418-97469440 CCTCATCTGTAAAATGGGGACGG + Intergenic
1045294610 8:100862405-100862427 CCTCATCTGAGGATGGGTGATGG - Intergenic
1045414716 8:101954313-101954335 ACCCATCTGGGCAAGGGAGAAGG - Intronic
1045566253 8:103319113-103319135 CCTAAACTGGGGAAAGGGGAAGG + Intronic
1045585235 8:103527538-103527560 CCTGTTGTGGGGAGGGGGGATGG - Intronic
1045638577 8:104222509-104222531 CCCAATCTAGGGAAGTGGGAAGG - Intronic
1045722723 8:105132964-105132986 TCACATCTGGGTAAGGGAGAAGG - Intronic
1045789040 8:105959283-105959305 CCTGTTGTGGGGCAGGGGGAGGG + Intergenic
1046009369 8:108527862-108527884 CCTGTTGTGGGGTAGGGGGAGGG - Intergenic
1046259475 8:111747741-111747763 CCTGTTGTGGGGTAGGGGGAGGG - Intergenic
1046604379 8:116354592-116354614 TCTGATGTGGGGGAGGGGGAAGG - Intergenic
1046628481 8:116600386-116600408 CCTGTTGTGGGGTAGGGGGACGG - Intergenic
1047317335 8:123746530-123746552 CCTGTTGTGGGGTAGGGGGAGGG + Intergenic
1047559925 8:125975797-125975819 CCACAGATGGGGATGGGGGATGG + Intergenic
1047863400 8:128993925-128993947 CCTGATCTTTGGAAGGCGGAAGG + Intergenic
1048314812 8:133354077-133354099 CCTCTTATGGGGTGGGGGGAAGG - Intergenic
1048354582 8:133642788-133642810 CCCCACCTGTGGAAGGCGGAAGG + Intergenic
1048400745 8:134066990-134067012 CCTGTTGTGGGGTAGGGGGAGGG + Intergenic
1048699457 8:137071670-137071692 CCTGTTGTGGGGTAGGGGGAGGG + Intergenic
1048809468 8:138272954-138272976 CCTCATCTGTGAACTGGGGATGG + Intronic
1049218663 8:141418957-141418979 TCTCACCTGGGGCAGGGGTAGGG + Intronic
1049223764 8:141440048-141440070 CCTCATCTGTAGAATGGGGCAGG - Intergenic
1049245323 8:141559377-141559399 CCTCATCTAGAAAATGGGGACGG - Intergenic
1049556703 8:143286097-143286119 CATCAGCTGGGGGAGGGGAAGGG - Intergenic
1049598062 8:143493474-143493496 CCACACCTGGAGAAGGTGGAAGG + Intronic
1049639835 8:143710468-143710490 ACTCATCTGGGGTGGGGGGCAGG + Intronic
1050014828 9:1222454-1222476 CCTCACTTGGTGAAGGTGGAAGG - Intergenic
1050063931 9:1738850-1738872 CCTAATTTGGAGAAGGAGGAGGG - Intergenic
1050381734 9:5037699-5037721 CCTGTTCTGGGGTGGGGGGATGG + Intronic
1050500590 9:6294041-6294063 CTACTTCTGGGGAAGGGAGAGGG - Intergenic
1051141470 9:13984098-13984120 CCTCATCTGGAAAATAGGGATGG - Intergenic
1051864306 9:21662223-21662245 CCTGTTGTGGGGTAGGGGGAGGG - Intergenic
1052070993 9:24081171-24081193 CCTCTGCTAGGGAAGGTGGAAGG + Intergenic
1052207027 9:25854928-25854950 CCTCTTCTGGGGGTGGGAGAGGG - Intergenic
1052495081 9:29214245-29214267 GCTCAGCTGGAGAAAGGGGAGGG + Intergenic
1052586881 9:30440630-30440652 CCTGTTGTGGGGTAGGGGGATGG - Intergenic
1053299119 9:36936267-36936289 ACTCCTGTGGGGAAGGGGGATGG + Intronic
1053428330 9:38025637-38025659 CCTCATCTGTGAAATGAGGATGG + Intronic
1053481131 9:38417368-38417390 TCTCATCTGTGAAATGGGGATGG - Intronic
1053672241 9:40378089-40378111 CCTGTTGTGGGGCAGGGGGAGGG + Intergenic
1053802693 9:41774290-41774312 CCTCACCAGAAGAAGGGGGAGGG + Intergenic
1054190999 9:61985636-61985658 CCTCACCAGAAGAAGGGGGAGGG + Intergenic
1054383352 9:64518123-64518145 CCTGTTGTGGGGCAGGGGGAGGG + Intergenic
1054462292 9:65471930-65471952 CCTCACCAGAAGAAGGGGGAGGG - Intergenic
1054512383 9:65998221-65998243 CCTGTTGTGGGGCAGGGGGAGGG - Intergenic
1054647370 9:67602081-67602103 CCTCACCAGAAGAAGGGGGAGGG - Intergenic
1055564461 9:77554130-77554152 CCTCATCTGGGAAACGGGAATGG + Intronic
1055731434 9:79282770-79282792 CGTCATTTGAGGAAGGGGTATGG - Intergenic
1058013586 9:100004601-100004623 CTTCATGTGGGGAAAGGAGAAGG - Intronic
1058120634 9:101134969-101134991 CCTCATCTGCAAAATGGGGAAGG - Intronic
1058383876 9:104410128-104410150 CCGCATATGGCAAAGGGGGAAGG - Intergenic
1058764183 9:108165428-108165450 TATCAGGTGGGGAAGGGGGATGG - Intergenic
1058805445 9:108586799-108586821 CCTCATGTGTGAAATGGGGATGG - Intergenic
1059017975 9:110542815-110542837 CTTCTTTTGGGGAGGGGGGAGGG + Intronic
1059407977 9:114113659-114113681 TCTCATCTGGTGTTGGGGGAGGG - Intergenic
1059910501 9:119038587-119038609 CCTGTTATGGGGTAGGGGGAAGG - Intergenic
1059960334 9:119558440-119558462 CAGCATCTGGGGAAGCAGGAGGG + Intergenic
1059992789 9:119881089-119881111 TCTTGCCTGGGGAAGGGGGATGG - Intergenic
1060218602 9:121752881-121752903 CCTCATCTGAAAAAGGAGGAAGG - Intronic
1060965900 9:127712148-127712170 CCAGTCCTGGGGAAGGGGGAAGG + Intronic
1061004606 9:127921446-127921468 CATGATCTGGGCAAGGGGGGAGG - Exonic
1061008520 9:127942087-127942109 CCCGTTCTGGGCAAGGGGGAAGG - Exonic
1061548163 9:131316666-131316688 CCTCACCTGGGGGAAGGGGAAGG - Intergenic
1061670580 9:132185968-132185990 CCTGGTGTGGGGAAGGAGGAGGG + Intronic
1062010516 9:134264386-134264408 CCTCATCTCTGAAATGGGGATGG + Intergenic
1062213979 9:135379102-135379124 CCTCCTCGGGGGAAGGCAGAGGG + Intergenic
1062555741 9:137112718-137112740 GCCCATCTGGGGCCGGGGGAAGG + Intronic
1062670918 9:137708931-137708953 CCACATCAGAGGAAGGGGGCAGG - Intronic
1185612892 X:1402785-1402807 CTGCATTTGGGGAGGGGGGAAGG - Intergenic
1186487630 X:9945955-9945977 CCTCACCTGGAGAAAGGGGAAGG - Intronic
1186555859 X:10557582-10557604 CCTCATCTGCAGAATGAGGATGG + Intronic
1186580243 X:10809765-10809787 CCTGTTGTGGGGTAGGGGGAGGG + Intronic
1186743685 X:12544079-12544101 CCTGTTGTGGGGTAGGGGGAGGG + Intronic
1187496561 X:19800988-19801010 GCTCTGCTGGGGAAGGAGGAAGG - Intronic
1187887962 X:23907279-23907301 CCTGATGTGTGGATGGGGGAGGG - Intronic
1188058920 X:25576632-25576654 CCTTATTTGGCAAAGGGGGAAGG + Intergenic
1188390760 X:29616477-29616499 CCTGTTGTGGGGTAGGGGGAGGG - Intronic
1188391785 X:29630157-29630179 CCTCACATGGTGAAGGGAGAAGG + Intronic
1188534470 X:31181265-31181287 TCACATATGGGGAAGTGGGAAGG + Intronic
1189407966 X:40742927-40742949 CCTCACCTCTGGAAGGGGCAAGG + Intergenic
1189510483 X:41656716-41656738 ATTGATCTGGGGAAGGGGGGTGG + Intronic
1189526031 X:41823027-41823049 CCTCAGCGGGGGTGGGGGGAGGG + Intronic
1190177916 X:48166920-48166942 CGTCATCTGGGGAACATGGAGGG + Intergenic
1190180235 X:48185503-48185525 CATCATCTGGGGAATGCAGAGGG - Intergenic
1190197043 X:48328707-48328729 CGTCATCTGGGGAATGTGGAGGG + Intergenic
1190424716 X:50323410-50323432 CCTGTTGTGGGGTAGGGGGAGGG + Intronic
1190446167 X:50526477-50526499 CCTGTTGTGGGGTAGGGGGAGGG + Intergenic
1190663777 X:52679086-52679108 CGTCATCTGGGGAACGCAGAGGG + Intronic
1190675646 X:52779336-52779358 CGTCATCTGGGGAACGCAGAGGG - Intronic
1190923945 X:54884624-54884646 CCTGTTGTGGGGTAGGGGGAGGG - Intergenic
1190926431 X:54909750-54909772 CCTGTTGTGGGGTAGGGGGAGGG + Intergenic
1191131070 X:57011447-57011469 CCTGTTGTGGGGTAGGGGGAGGG - Intergenic
1191216726 X:57940186-57940208 CCTGTTGTGGGGTAGGGGGAGGG - Intergenic
1191614335 X:63151996-63152018 CCTGTTGTGGGGAGGGGGGAGGG + Intergenic
1191621961 X:63226931-63226953 CCTGTTGTGGGGAGGGGGGAGGG - Intergenic
1192157936 X:68760283-68760305 CCTCATCTGTAAAATGGGGATGG + Intergenic
1192183494 X:68930681-68930703 CCACATCTGGGGAAGGGCTCTGG - Intergenic
1192238263 X:69309892-69309914 CCTCATCTGGAAAACAGGGATGG + Intergenic
1192733135 X:73821080-73821102 CTTCAGCTGGGGATGGGGAATGG - Intergenic
1192849813 X:74942829-74942851 CCCCATCTGGTGAGGGGGGATGG + Intergenic
1192883534 X:75313669-75313691 CCTGTTGTGGGGTAGGGGGAGGG - Intergenic
1193164324 X:78264074-78264096 CCCCACCTGGTGAAGAGGGATGG + Intergenic
1193324695 X:80166351-80166373 CCTTTTCTGGGGAAAGGGAATGG - Intergenic
1193488447 X:82116244-82116266 CCACTTCTGGGGCTGGGGGAGGG + Intergenic
1193632590 X:83908571-83908593 CCTGTTGTGGGGTAGGGGGAGGG - Intergenic
1193632845 X:83911006-83911028 CCTGTTGTGGGGTAGGGGGAGGG + Intergenic
1193664464 X:84299297-84299319 CCACAGCTGGGGGTGGGGGAGGG - Intergenic
1194020235 X:88680712-88680734 CCTGTTGTGGGGTAGGGGGAGGG + Intergenic
1194526357 X:94982787-94982809 CCTCTGCTGGGGCATGGGGAGGG - Intergenic
1195103289 X:101577288-101577310 CCTGTTGTGGGGAGGGGGGAGGG - Intergenic
1195106179 X:101603526-101603548 CCTCACCTTGGGATGGGGCATGG + Intergenic
1195332877 X:103820044-103820066 CCAGCTCTGTGGAAGGGGGAAGG - Intergenic
1195414045 X:104601274-104601296 CCTGTTGTGGGGTAGGGGGAGGG - Intronic
1196375372 X:115027255-115027277 CCTCATCCAGGGAAGGGAGAGGG - Intergenic
1196722196 X:118864847-118864869 CCTCATCTGCTGGAGGGGCAAGG + Intergenic
1196794295 X:119489877-119489899 CCTCATCTGTAAAATGGGGAGGG + Intergenic
1197494558 X:127161462-127161484 CCTGTTGTGGGGTAGGGGGAGGG + Intergenic
1197588429 X:128378193-128378215 CCTCTTGTGGGGTGGGGGGAGGG + Intergenic
1197873664 X:131083071-131083093 CCTGATCTGCAGCAGGGGGAGGG - Intronic
1198439506 X:136648661-136648683 CCACATCTGAGAAATGGGGATGG + Intronic
1198553106 X:137765079-137765101 CCTGTTGTGGGGTAGGGGGAAGG - Intergenic
1199139014 X:144288013-144288035 CCTCTTCTGGGGGATGGGGGAGG + Intergenic
1199278328 X:145971544-145971566 CCTCCTCTAGGGAAAGGTGAAGG + Intergenic
1199438541 X:147841991-147842013 CTTCATCTGGGGAATGGGGGAGG - Intergenic
1199457527 X:148045092-148045114 CCACTGCCGGGGAAGGGGGAGGG + Intergenic
1199574149 X:149297166-149297188 ACTCATCTTGTGAAGGGGAAGGG + Intergenic
1199637513 X:149827161-149827183 CCTCCCCTAGGGAAAGGGGAAGG + Intergenic
1199722850 X:150555015-150555037 CCTCATCTGCAAAAGAGGGATGG + Intergenic
1200039692 X:153356060-153356082 CCCCACCTGAGGAAGGTGGAGGG + Intronic
1200149079 X:153942726-153942748 CCCCACCTGGGGAAGGTGGAGGG - Intronic
1200268266 X:154658294-154658316 CCTCATATGGCCCAGGGGGAGGG + Intergenic
1201597585 Y:15689043-15689065 CCTCATTTGGGGAGGGCAGAGGG - Intergenic
1201932461 Y:19366429-19366451 CCTGTTGTGGGGTAGGGGGAGGG + Intergenic
1201987748 Y:19988023-19988045 ACTGTTGTGGGGAAGGGGGAGGG - Intergenic
1202058834 Y:20864786-20864808 CCTCATGTGGGGTTGGGGGCAGG - Intergenic
1202390892 Y:24369440-24369462 CCTTAGCAGGGGTAGGGGGACGG + Intergenic
1202479892 Y:25300676-25300698 CCTTAGCAGGGGTAGGGGGACGG - Intergenic