ID: 1101887204

View in Genome Browser
Species Human (GRCh38)
Location 12:108675746-108675768
Sequence CAGAATACACAAATGGAAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 794
Summary {0: 1, 1: 0, 2: 5, 3: 79, 4: 709}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101887199_1101887204 4 Left 1101887199 12:108675719-108675741 CCCCTAGTGAATGACTGGATATA 0: 1
1: 0
2: 1
3: 37
4: 459
Right 1101887204 12:108675746-108675768 CAGAATACACAAATGGAAAAAGG 0: 1
1: 0
2: 5
3: 79
4: 709
1101887200_1101887204 3 Left 1101887200 12:108675720-108675742 CCCTAGTGAATGACTGGATATAG 0: 1
1: 0
2: 0
3: 18
4: 187
Right 1101887204 12:108675746-108675768 CAGAATACACAAATGGAAAAAGG 0: 1
1: 0
2: 5
3: 79
4: 709
1101887201_1101887204 2 Left 1101887201 12:108675721-108675743 CCTAGTGAATGACTGGATATAGG 0: 1
1: 0
2: 0
3: 21
4: 163
Right 1101887204 12:108675746-108675768 CAGAATACACAAATGGAAAAAGG 0: 1
1: 0
2: 5
3: 79
4: 709
1101887197_1101887204 15 Left 1101887197 12:108675708-108675730 CCATATTGCAACCCCTAGTGAAT 0: 1
1: 0
2: 3
3: 33
4: 147
Right 1101887204 12:108675746-108675768 CAGAATACACAAATGGAAAAAGG 0: 1
1: 0
2: 5
3: 79
4: 709

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101887204 Original CRISPR CAGAATACACAAATGGAAAA AGG Intronic
900492433 1:2958940-2958962 CAGGATAGACACATGGACAAAGG + Intergenic
901266834 1:7917337-7917359 CAGGATAGACAAATTGACAATGG + Exonic
901881539 1:12196931-12196953 AAGAAAAAAAAAATGGAAAAGGG - Intronic
902794479 1:18792285-18792307 CTGAATATACAAATGGACAATGG + Intergenic
902999213 1:20252902-20252924 CAAATTACACAAATGGAGAGTGG - Intergenic
903474732 1:23611781-23611803 CAGTTTCCACAACTGGAAAATGG - Intronic
903589513 1:24443821-24443843 CAGAACACAAATATAGAAAATGG - Intronic
904318900 1:29683842-29683864 CAGAAGACAAAAATGCACAAAGG - Intergenic
904346518 1:29875543-29875565 CTGAATATACAAATGGACAATGG + Intergenic
905737730 1:40341792-40341814 CAGAAGACAGAAATAGAAACGGG - Intergenic
906549176 1:46647953-46647975 GAGGATAGACAAATGGACAAAGG - Intronic
907494674 1:54835993-54836015 CAGCATGCACAAAGGGTAAAAGG - Intronic
907531062 1:55097511-55097533 CAGAATATGAAAATTGAAAAAGG + Intronic
907585541 1:55614214-55614236 CAGAAAGCACAAAAGCAAAAAGG + Intergenic
907852807 1:58272762-58272784 CAAAAGAGACAAATGGTAAAGGG - Intronic
907885121 1:58585718-58585740 AAGAATACACAAATAGTAAATGG + Intergenic
908129448 1:61059982-61060004 CAGAAGAGACAAATGGAAGTAGG + Intronic
908158675 1:61384483-61384505 CATAATACACAAATGAAAGAAGG - Intronic
908790823 1:67779524-67779546 CAGAATCCACAAAGGCATAAGGG - Intronic
908932686 1:69336502-69336524 AAAAATACAGAAAAGGAAAAAGG + Intergenic
909587363 1:77305113-77305135 GACAATATACAAATGGCAAACGG - Intronic
909656416 1:78038429-78038451 GGAAATACAGAAATGGAAAATGG - Intronic
909833207 1:80220614-80220636 TACAATAAACAAATTGAAAATGG + Intergenic
910006330 1:82401412-82401434 GAGAAGCCACAAATGGAAAGAGG - Intergenic
910274949 1:85439269-85439291 CAGAATGCAGAAAAGGTAAAGGG - Intronic
910294655 1:85632327-85632349 AAGAAGACAGAAATGGAAAGGGG + Intergenic
910610544 1:89136947-89136969 CACAATAAAAAAATGGCAAAAGG + Intronic
910683981 1:89897370-89897392 CAGAAGACAAAAATGGCAACAGG - Intronic
910863894 1:91769683-91769705 TAAAATACACACATGGAAACAGG - Intronic
911096338 1:94058128-94058150 CAGATAAAACAAATGGCAAAGGG + Intronic
911586016 1:99691921-99691943 AAGAAGAAAGAAATGGAAAAAGG + Intronic
911753502 1:101525943-101525965 CAAAATGCAGAGATGGAAAAGGG - Intergenic
912138089 1:106685654-106685676 CAGAACACAGAAAGGCAAAAAGG - Intergenic
912244070 1:107942540-107942562 CAGGATACACAGATATAAAAAGG - Intronic
912247299 1:107973185-107973207 TTGCACACACAAATGGAAAAAGG + Intergenic
913024204 1:114819659-114819681 CAGAATATAGAGTTGGAAAAAGG - Intergenic
913271511 1:117098317-117098339 CAGAATATTCAAGTTGAAAAAGG + Intronic
913405118 1:118482400-118482422 CACAATTCACAATTGCAAAATGG - Intergenic
914346538 1:146804760-146804782 CACAATTCACAATTGCAAAATGG + Intergenic
915772310 1:158440274-158440296 AAGAATACACAATGGGGAAAGGG + Intergenic
915848172 1:159290871-159290893 TAGAATACAAAAATGCAGAAGGG - Intronic
916090445 1:161304864-161304886 CAGGAAAAACAAATGGGAAATGG - Exonic
916220311 1:162437557-162437579 CAGAAAACACAAATTAAATAAGG + Intergenic
916428956 1:164709395-164709417 AAGAAAACAAAAATAGAAAAAGG + Intronic
917078594 1:171233324-171233346 CAGTATTTACAGATGGAAAAAGG + Intergenic
917218386 1:172701763-172701785 CAGAAAAGACAAATCCAAAAGGG - Intergenic
917393399 1:174564466-174564488 CACTATACACAACTGTAAAATGG - Intronic
917636305 1:176940156-176940178 CTGAATATACAAATGGACAATGG + Intronic
917954995 1:180086138-180086160 CACAATACAGAGATGGAATAGGG + Intronic
918657235 1:187043308-187043330 CTGAATATATAAATGGACAATGG + Intergenic
919102214 1:193108744-193108766 CTGAATATATAAATGGATAATGG - Intergenic
919102431 1:193111001-193111023 GACAATATACAAATGGGAAATGG - Intergenic
919550404 1:198978414-198978436 CATAAGAAACAAATGAAAAAGGG + Intergenic
920967372 1:210712180-210712202 CAGAATCCATAAAAGGAACATGG + Intronic
921360448 1:214326711-214326733 GAGAATACAAAAAGGGAAAGGGG - Intronic
921549089 1:216511226-216511248 AAGAATAGAGAAGTGGAAAAAGG + Intronic
921757087 1:218870578-218870600 AAGAATACACAATGGGGAAAGGG - Intergenic
922310781 1:224388200-224388222 CAGAATCCACAAAGAGAAGAGGG - Exonic
922369836 1:224898273-224898295 CTGAATAGACAAATGGACAATGG - Intronic
922771453 1:228186020-228186042 CAGAATGCACAAATGACAATGGG + Intergenic
923438486 1:233992853-233992875 GAGAAAACAGAAATGGAAAGTGG + Intronic
924049035 1:240061787-240061809 CAGAATAAACAAACAGACAATGG + Intronic
924170694 1:241337051-241337073 AAGATCACACAGATGGAAAATGG - Intronic
924272033 1:242343919-242343941 CTGAATAAACAAATGGACAATGG + Intronic
924319428 1:242832932-242832954 AAAAATTCACAAATGGAAAGAGG + Intergenic
924646559 1:245883103-245883125 CAGAAAAGACAAATGTGAAAAGG + Intronic
924916649 1:248576532-248576554 CAGAAAAAAAAAAGGGAAAACGG - Intergenic
1063314668 10:4990876-4990898 CAGAAAATACAAAATGAAAATGG - Intronic
1063733014 10:8721025-8721047 GAGAATACACAAAGGTAAAGAGG + Intergenic
1064165068 10:12978747-12978769 CAGAATAAGGAAATGGAAAGAGG + Intronic
1065228502 10:23572147-23572169 CAGAAGAGAAAAAAGGAAAAAGG + Intergenic
1065615241 10:27514542-27514564 CAGAGTCTAGAAATGGAAAAAGG + Intronic
1066046479 10:31599868-31599890 CAGAGAACACACATGGTAAAGGG + Intergenic
1066712636 10:38252211-38252233 CTGAATAAACAAATGGACAATGG - Intergenic
1067760815 10:49045340-49045362 AACAATAAACAAATGAAAAAAGG + Intronic
1068286326 10:54941044-54941066 CAGAAAACACAAAAATAAAATGG - Intronic
1068438948 10:57026789-57026811 CATAATTTACAAATGGCAAAGGG + Intergenic
1068869597 10:61928865-61928887 CAGAATACACTAATGTGTAATGG + Intronic
1069144727 10:64876600-64876622 CTGAATATACAAATGGGCAATGG + Intergenic
1069348167 10:67494613-67494635 TAGAACACACAAATAGTAAATGG - Intronic
1069356358 10:67590707-67590729 CAAAATGAACAAAAGGAAAATGG - Intronic
1069434163 10:68366015-68366037 CAAAAACCACAAAAGGAAAAAGG + Intronic
1069647773 10:70016737-70016759 CCCAATTCACAAATGGACAAAGG + Intergenic
1069830800 10:71281318-71281340 CAAAATATAAAAATGGAAAAAGG + Intronic
1070033151 10:72696520-72696542 CAGAAGACAACAATAGAAAAGGG - Intronic
1070620540 10:78006536-78006558 TAGAATAAAGAAATGGCAAATGG + Intronic
1071001721 10:80838600-80838622 CACAATAAAAAAATGGTAAAAGG - Intergenic
1071381726 10:85071152-85071174 AAGAATACACAATGGAAAAAAGG + Intergenic
1071700549 10:87928599-87928621 AAAGATACACAAATGGCAAATGG - Intronic
1072129666 10:92481815-92481837 GAGAACACAAAAATGTAAAATGG + Intronic
1072808458 10:98441493-98441515 CATAATCCATAAATGCAAAATGG + Intronic
1073319579 10:102606635-102606657 CAGAAAACATAACTGGAAACAGG + Intronic
1073508390 10:104023603-104023625 CATAACACCCAGATGGAAAATGG - Intronic
1074363434 10:112840018-112840040 CTGGATACACAAATGGAGGAGGG + Intergenic
1074687514 10:115974154-115974176 CCGAATATACAAATGGACAGTGG + Intergenic
1075000379 10:118792565-118792587 CTGAATATACAAATGGACAGTGG + Intergenic
1076408927 10:130232158-130232180 CAGAACAGAGAAATGAAAAAAGG - Intergenic
1076476192 10:130753662-130753684 CAGAAAACTTAAAAGGAAAAGGG - Intergenic
1077280561 11:1743180-1743202 AAGAATGGACAAATGGAAGATGG + Intronic
1077280566 11:1743218-1743240 AAGAATGGACAAATGGAAGATGG + Intronic
1077931849 11:6741056-6741078 AAGGATAAAGAAATGGAAAAAGG + Intergenic
1078018985 11:7639956-7639978 CACAATCCACAATTGGAGAATGG + Intronic
1078979030 11:16510846-16510868 CAGTTTACCCACATGGAAAATGG - Intronic
1079169843 11:18082560-18082582 GAAAATACAAATATGGAAAAGGG + Intronic
1080319953 11:30996578-30996600 CAGAATACAGAAAGGGCAAAAGG - Intronic
1080438772 11:32271090-32271112 AAGACTACAAAGATGGAAAATGG + Intergenic
1080672060 11:34389437-34389459 CACAATTCACAATTGCAAAATGG - Intergenic
1080680390 11:34470268-34470290 AGGAATAGACAAATGGAAGAGGG + Intronic
1080945121 11:36964139-36964161 AAGAAGACACAAAAGGAGAATGG + Intergenic
1081473177 11:43396227-43396249 CAGAAAAAAAAAAAGGAAAAAGG - Intronic
1082014652 11:47475782-47475804 CAGAATAGCCAGATAGAAAATGG - Intronic
1082645727 11:55721863-55721885 AAGAATACATAATGGGAAAAAGG - Intergenic
1082837556 11:57662732-57662754 TAGAATAAACAAATTTAAAAAGG + Intergenic
1084057132 11:66642163-66642185 CAGAAAACACAATAGGGAAACGG - Intronic
1085163270 11:74369278-74369300 CAGTGTACAAAAATGGATAATGG + Intronic
1085980853 11:81722935-81722957 AAGGATATCCAAATGGAAAAGGG + Intergenic
1086085245 11:82946386-82946408 AAGAACATACAATTGGAAAAGGG + Intronic
1086344014 11:85876910-85876932 CACATTATAAAAATGGAAAAAGG - Intronic
1086515133 11:87603071-87603093 CTGAATATACAAATAGACAATGG - Intergenic
1086802774 11:91197637-91197659 CAGAATGCACAAGAGGAAAGTGG - Intergenic
1087482916 11:98723724-98723746 CATAATACAAAAATGTTAAAGGG - Intergenic
1087501996 11:98968178-98968200 CATAAAAAACAAATAGAAAAAGG - Intergenic
1087968881 11:104454509-104454531 CAGAAATCACACATTGAAAAAGG + Intergenic
1088034878 11:105299142-105299164 GAGAATACTTATATGGAAAATGG + Intergenic
1088107956 11:106227049-106227071 AAGAAAACACATAAGGAAAATGG + Intergenic
1089275801 11:117335295-117335317 AAGAAAACACCAAAGGAAAAGGG - Intronic
1089812115 11:121140757-121140779 CAGAAGACACAGAGGGAAAGAGG - Intronic
1090081107 11:123613367-123613389 CAGAATACAGAATAGGAAAATGG + Intronic
1090317830 11:125811593-125811615 AAGAAGACAGAAATGGTAAACGG - Intergenic
1090521317 11:127482624-127482646 AAGAGTACACAGATGGAAAGAGG - Intergenic
1090622788 11:128576252-128576274 CACAATCTACAAGTGGAAAAAGG - Intronic
1091352605 11:134909120-134909142 CAGGAAACACAAATGAAAGATGG - Intergenic
1091674171 12:2476370-2476392 CAGATTACACACTTGGTAAATGG - Intronic
1091968528 12:4765776-4765798 AAGAACACAAAAATTGAAAAGGG + Intronic
1091971618 12:4792298-4792320 CTGAAGACACAAGTGTAAAAGGG + Intronic
1092250219 12:6890948-6890970 GAGACTACAGAACTGGAAAATGG + Intronic
1092388581 12:8054950-8054972 CAGAAGACACAGATGAACAAGGG - Exonic
1092611003 12:10173324-10173346 AAGAATACACAAAGGAAGAATGG + Intronic
1092740495 12:11624065-11624087 CAGACTAAACAAAGGGAAAGGGG - Intergenic
1092822793 12:12368819-12368841 CATAATACACAAGTGGAAGATGG - Intronic
1093064504 12:14642518-14642540 CACAAGACACAAATTCAAAAAGG - Intronic
1093327445 12:17795203-17795225 CAAAATACGCAAATGAAAGATGG + Intergenic
1093512823 12:19949174-19949196 CTGAATATACAAATGGACAATGG + Intergenic
1093858924 12:24139411-24139433 CAGGATGGAAAAATGGAAAAAGG + Intergenic
1094262579 12:28518060-28518082 CACAATTCACAATTGCAAAAAGG - Intronic
1094813005 12:34160178-34160200 CCAAATTCACAAATGGACAAGGG - Intergenic
1095527384 12:43143511-43143533 CATAATATAAAAATAGAAAAAGG + Intergenic
1095535273 12:43238557-43238579 CTGAATACACAAACAGATAATGG - Intergenic
1095641516 12:44491171-44491193 CAGAAGAGAAAACTGGAAAATGG - Intergenic
1095724389 12:45435891-45435913 CTGAATATACAAATGGACAATGG + Intronic
1096208977 12:49747607-49747629 CAAAAAACAAAAAAGGAAAAAGG - Intronic
1096588987 12:52644709-52644731 CAGAATACACATCTGGAAAATGG + Exonic
1096843779 12:54394192-54394214 CAGAACCCACAAATGAAAAGGGG - Intergenic
1097124076 12:56759472-56759494 CATAATAAACAAAAGGAGAATGG + Intronic
1097407393 12:59206961-59206983 AATAATACACAAATGTAAAAAGG + Intergenic
1098024952 12:66191474-66191496 ATGAATACACAAAGGGACAATGG - Intronic
1098079306 12:66766918-66766940 GAGAATGAACAAATGGATAAGGG + Intronic
1098678710 12:73322674-73322696 CAGAATAGATAAATGAAGAAAGG + Intergenic
1098757330 12:74382299-74382321 CATAATGAACAAATAGAAAATGG - Intergenic
1099054490 12:77822003-77822025 AAAAATACACATCTGGAAAAAGG - Intergenic
1099889709 12:88576153-88576175 TAGAAAATAGAAATGGAAAATGG - Intronic
1100400864 12:94228023-94228045 CAGATTAGAGAAATGGAAAATGG - Intronic
1100925563 12:99543794-99543816 CAGAATAGACAAATTGATAAAGG + Intronic
1101261731 12:103039144-103039166 CAGAATAAACACAAGGAAAGAGG - Intergenic
1101619888 12:106375089-106375111 CAGAATACACAAATCGAGGTTGG + Intronic
1101887204 12:108675746-108675768 CAGAATACACAAATGGAAAAAGG + Intronic
1102194174 12:111012619-111012641 GAGAATACAGAAATGGAACCAGG + Intergenic
1103082403 12:118035667-118035689 CAACAGACACAAAAGGAAAAAGG + Intronic
1103742150 12:123098171-123098193 CAGAGGACAGAAATGGGAAATGG - Intronic
1104072200 12:125355585-125355607 CTGAATATACAAATGGACAACGG - Intronic
1104356623 12:128092456-128092478 CTGAATATAAAAATGGACAATGG + Intergenic
1105461224 13:20590077-20590099 CAGGGTTTACAAATGGAAAAAGG - Intronic
1105796069 13:23854325-23854347 CAAAATAAACAAATAGGAAATGG - Intronic
1106871715 13:34029087-34029109 CTGAATATACAGATGGACAATGG + Intergenic
1107705830 13:43103786-43103808 CAAAATATACAAAGGAAAAAAGG - Intronic
1107778636 13:43875481-43875503 CTGAATATGCAAATGGACAATGG + Intronic
1108115890 13:47127611-47127633 CAGACAACCCAAATGCAAAATGG - Intergenic
1108440514 13:50448461-50448483 CTGAATATACAAATGGATGACGG + Intronic
1108463904 13:50695273-50695295 GAAAATACACAAATGGACAATGG + Intronic
1108500059 13:51061612-51061634 TAAATTACACAAATGAAAAAGGG - Intergenic
1108616850 13:52141665-52141687 CAGAATAATGAAATGGAACAGGG - Intronic
1108974953 13:56429305-56429327 CAGACTCCACCTATGGAAAATGG - Intergenic
1109037070 13:57277469-57277491 CAGAAAACTCAAATAGAGAATGG + Intergenic
1109636418 13:65123714-65123736 CAGAATACACACAGGGAAGAAGG + Intergenic
1109684462 13:65797717-65797739 CTGATTATACAAATGGACAATGG + Intergenic
1109893878 13:68656430-68656452 CAGAATACAAAAATGAGAGAAGG + Intergenic
1109964220 13:69670567-69670589 CAAAATACACAAATCAATAAAGG + Intergenic
1110357964 13:74590312-74590334 CTGAATGCATAAATGAAAAAAGG + Intergenic
1110427673 13:75387273-75387295 AAGTATATATAAATGGAAAAGGG + Intronic
1111093328 13:83475809-83475831 CAAAGTACACAAATGTTAAAAGG + Intergenic
1111951100 13:94710340-94710362 CAGTTTACAAAAAAGGAAAAAGG - Exonic
1112798128 13:103079772-103079794 CATTCTATACAAATGGAAAATGG + Intergenic
1112948846 13:104964526-104964548 TAGAAAAGATAAATGGAAAATGG - Intergenic
1112989460 13:105494586-105494608 CATAATACACAAAGGGACACAGG - Intergenic
1113330530 13:109322745-109322767 CACAATTCACAATTGCAAAATGG + Intergenic
1113416756 13:110134443-110134465 TAGAATACAAAAGTGGAAGAAGG + Intergenic
1114346668 14:21803464-21803486 AAGAAGACAAAAATGGAAACAGG + Intergenic
1114662902 14:24360021-24360043 CTGAATATACAGATGGAAAATGG + Intergenic
1114671058 14:24411317-24411339 CAGAAGACAGAAATGGTCAAGGG - Intronic
1115095066 14:29625007-29625029 CAGAAAATAGAAATGGAAAATGG + Intronic
1115155191 14:30331079-30331101 CTGAATATACAAATGGACAGTGG + Intergenic
1115344193 14:32324794-32324816 GAGAATGCAGAGATGGAAAAAGG + Intergenic
1115380662 14:32735035-32735057 CAGCATCCAGAAATGCAAAATGG + Intronic
1115705488 14:35993992-35994014 CAGAAAACACAATAGGATAATGG - Intergenic
1115752669 14:36506989-36507011 TGGAATAAAGAAATGGAAAATGG + Intronic
1116132679 14:40877549-40877571 AAGAAGTCACAAATAGAAAATGG + Intergenic
1116146083 14:41070788-41070810 CTGAATATACAGATAGAAAATGG - Intergenic
1116254235 14:42529874-42529896 CAGAATACCCAATAGGATAATGG - Intergenic
1116344886 14:43780227-43780249 GAGAATACAGAAAGGGCAAAGGG + Intergenic
1116451166 14:45067035-45067057 CAAATTACACAAATTTAAAATGG + Intronic
1116474939 14:45328899-45328921 TAGAATACATAAGTGCAAAATGG - Intergenic
1116504466 14:45661805-45661827 CAGCATACACAAATCAATAAAGG - Intergenic
1116713974 14:48405400-48405422 CAAGATACACAAATGGCCAATGG - Intergenic
1117129558 14:52671865-52671887 CAGAATACTAAAATGAAAAAGGG + Exonic
1117199297 14:53372007-53372029 AAGAATATAAAGATGGAAAAAGG + Intergenic
1117469952 14:56033518-56033540 CAGAATAGAAAAATTGATAATGG + Intergenic
1119084958 14:71731081-71731103 CAGAGTTCACCAAAGGAAAAAGG - Intronic
1119584411 14:75819344-75819366 TAGTATCCACAAATGGCAAAGGG - Intronic
1120073503 14:80129738-80129760 CTGATTAAAAAAATGGAAAAGGG + Intergenic
1120165083 14:81189285-81189307 CAAAATACAAAAAGGAAAAATGG + Intronic
1120296555 14:82648731-82648753 CAAAATACCCAAAAGGAAATGGG - Intergenic
1120582765 14:86273431-86273453 CAGAAAACACAAAAGAGAAAGGG - Intergenic
1121596616 14:95168208-95168230 CAGAATAAACAGAGGGAGAAGGG - Intergenic
1122024124 14:98862463-98862485 CACACTACATAAACGGAAAAAGG + Intergenic
1122172023 14:99884549-99884571 CGGAATAGAAAAATGGTAAAGGG + Intronic
1123166917 14:106334475-106334497 CAGGAAAAACAAATGGAAAAAGG + Intergenic
1123169532 14:106359186-106359208 CAGGAAAAACAAATGGAAAAAGG + Intergenic
1123501459 15:20887002-20887024 GAGAATACACATCTGGGAAAAGG - Intergenic
1123558712 15:21460701-21460723 GAGAATACACATCTGGGAAAAGG - Intergenic
1123594941 15:21897982-21898004 GAGAATACACATCTGGGAAAAGG - Intergenic
1124217626 15:27821173-27821195 CAAAACAAACAAATGGAAACTGG - Intronic
1124716120 15:32063892-32063914 CTGGATCCACAAATGGAGAATGG - Intronic
1125997827 15:44181341-44181363 CATAATAAAAAAATGTAAAAAGG - Intronic
1126084476 15:44998962-44998984 CTGAACACACAATTTGAAAAAGG - Intergenic
1126491583 15:49242967-49242989 CAAAATACAAAGATGGAAAGTGG + Intronic
1127173737 15:56330946-56330968 GAAAATAAAGAAATGGAAAAAGG + Intronic
1128461672 15:67873498-67873520 CAAAACACACAAATGATAAAGGG + Intergenic
1129834632 15:78694401-78694423 TAGAATCCGCAAAGGGAAAAGGG - Intronic
1130176676 15:81579132-81579154 CAAGATACACAACAGGAAAATGG - Intergenic
1130619286 15:85444842-85444864 CAGAATACCCAAAGGCAAAGGGG - Intronic
1131065796 15:89434252-89434274 CAGACCACACAGATGGGAAACGG - Intergenic
1131101867 15:89697787-89697809 CAAAATACACAAAGTAAAAATGG - Intronic
1131713115 15:95077541-95077563 CAGAATACAAAATTGAAAACTGG - Intergenic
1202967060 15_KI270727v1_random:187860-187882 GAGAATACACATCTGGGAAAAGG - Intergenic
1133264381 16:4574747-4574769 CAAAATACAGAACTGGAAGATGG + Exonic
1133512586 16:6474106-6474128 CTGCATACACAAATGGACACTGG - Intronic
1134157386 16:11854566-11854588 TAGAATACACAAAGGGAAGCAGG - Intergenic
1135277420 16:21125587-21125609 GAGAATACCCAAATGGAAAGGGG + Intronic
1135824265 16:25712690-25712712 CAGAAGCCATAAAGGGAAAAGGG + Intronic
1135832898 16:25793811-25793833 AAGAATACAAAACTGTAAAAAGG - Intronic
1137494079 16:48956177-48956199 CAGATTAAAAAAATGGAAGAGGG + Intergenic
1137669712 16:50272056-50272078 CAGGAAACACAACTGGAAACGGG - Intronic
1137857321 16:51807765-51807787 CAGAAGCCAGAAATAGAAAAGGG - Intergenic
1138858301 16:60722368-60722390 GAGGATACAAAAAGGGAAAACGG - Intergenic
1139108491 16:63858960-63858982 CAGAATAAACAAATAATAAATGG - Intergenic
1139363124 16:66415767-66415789 CAGAAAGCAAAAATGCAAAAAGG + Intergenic
1139987442 16:70910508-70910530 CACAATTCACAATTGCAAAATGG - Intronic
1140350964 16:74261578-74261600 GAGAATACTTAAAAGGAAAAGGG + Intergenic
1140587491 16:76310129-76310151 CTGAATACACAAATGGCAAATGG - Intronic
1140637934 16:76938596-76938618 AGGAACACACAAATGGACAATGG + Intergenic
1141407057 16:83804050-83804072 CACAAAAAACAAATAGAAAATGG - Intergenic
1141601795 16:85131172-85131194 CAGAAGACACATGTGGAAACAGG + Intergenic
1143714097 17:8754829-8754851 CAGAAAACACAAAATCAAAATGG + Intronic
1143970894 17:10794833-10794855 CAGGTTAAACAAATGGGAAAAGG + Intergenic
1144061611 17:11587940-11587962 CAAAATAGACAAATGAACAATGG + Intergenic
1144095388 17:11895725-11895747 CAAATTATACAAATGGAGAATGG - Intronic
1144146236 17:12401246-12401268 CAGGATAAACAAAAGGAGAAAGG + Intergenic
1144401848 17:14912210-14912232 TAAATTACACAAATGCAAAAAGG - Intergenic
1145049298 17:19647419-19647441 CACATTGCACAAATAGAAAAAGG + Intergenic
1145068234 17:19779182-19779204 CACAGTAGACAAATAGAAAATGG + Intronic
1146087443 17:29842981-29843003 CAACATACACAAATAGAAAAAGG - Intronic
1146135251 17:30314436-30314458 TAGAAAAGACATATGGAAAAAGG + Intergenic
1146445498 17:32929508-32929530 CAGAAAACACAAAGGCCAAAAGG + Intronic
1146817806 17:35957729-35957751 AAGAATACACAAATGGATTAAGG - Intergenic
1147268776 17:39251876-39251898 CAGAATAAACAGATGTAAAGTGG + Intergenic
1148324516 17:46775473-46775495 CAAAATAAACAAATGGAAAAAGG - Intronic
1150146305 17:62772453-62772475 TACAATGCACAAAAGGAAAAAGG + Intronic
1151113473 17:71705815-71705837 CAGAAGACAGAAAGGGAAAGTGG + Intergenic
1152435040 17:80271350-80271372 CTGAGTACTCAAAGGGAAAAAGG + Intronic
1153079455 18:1205211-1205233 CACAATTCACAATTGCAAAAGGG - Intergenic
1153461770 18:5342514-5342536 CATAATACAGAAAAGGAAGATGG - Intergenic
1153783988 18:8517962-8517984 CAGAACAAAAAAATGGACAAAGG + Intergenic
1153815332 18:8785812-8785834 AAGAAAACAAAAATGGACAAGGG - Intronic
1154053379 18:10985443-10985465 AAGAATACACAATGGGGAAAGGG - Intronic
1154280043 18:12994541-12994563 AAGAATAAAAACATGGAAAAGGG + Intronic
1155575922 18:27246809-27246831 TAAATTACACAAATGCAAAAAGG + Intergenic
1155615217 18:27714348-27714370 CTGAATATACAAATGAACAATGG + Intergenic
1156713794 18:39981824-39981846 CATAAACCACAAATGGAACAGGG - Intergenic
1156977926 18:43247585-43247607 CAGAATAGAATAAAGGAAAATGG + Intergenic
1157139117 18:45088106-45088128 CTGAATATACAAATGGACAATGG + Intergenic
1157254821 18:46129497-46129519 GCTAATACACAAATGGCAAAAGG - Intergenic
1157889173 18:51398238-51398260 AAGATTACACAGATGGAAACTGG - Intergenic
1157902204 18:51529450-51529472 GAGGAAACACAAATGGCAAATGG + Intergenic
1157942419 18:51943594-51943616 AAGTACACAAAAATGGAAAATGG - Intergenic
1158090302 18:53703401-53703423 CAGAGTACCCAATTGAAAAATGG - Intergenic
1158148251 18:54340974-54340996 CCAAATACATAAAGGGAAAATGG + Intronic
1158620564 18:59029122-59029144 ACTAATACACACATGGAAAAGGG - Intergenic
1158789128 18:60754447-60754469 CTGAATATACAAATGGACAAGGG + Intergenic
1159017361 18:63112209-63112231 CTGAATATACAAATGGGCAATGG + Intergenic
1159032028 18:63241268-63241290 CAGAAAACATAAATGTTAAAGGG + Intronic
1159254154 18:65924034-65924056 CAGGATACACATATGAACAATGG + Intergenic
1159637737 18:70825914-70825936 CTGAATACGCAAATGGATAATGG - Intergenic
1159638185 18:70831426-70831448 CTGAATACACAAATGGACAATGG + Intergenic
1161625114 19:5322016-5322038 CAGTTTACCCAAATGGAAATGGG - Intronic
1163481111 19:17556607-17556629 CAGTTTTCTCAAATGGAAAATGG + Intronic
1163884186 19:19951324-19951346 CAAAATACAAAAATAGAAATTGG + Intergenic
1164091517 19:21957035-21957057 AAGAAAACAAAAATAGAAAATGG - Intronic
1164190048 19:22906153-22906175 CAGAATAAAAATGTGGAAAATGG - Intergenic
1164194314 19:22941934-22941956 CAGAAAAGACTAATGGAAATAGG - Intergenic
1164633235 19:29775187-29775209 AACAAGACACAAATGGAACAAGG + Intergenic
1164781063 19:30893253-30893275 CTGAAAACACAGATGGAGAATGG + Intergenic
1166352996 19:42209437-42209459 CTGAATACACAAATGAAACTAGG + Intronic
1168456663 19:56516791-56516813 CTGAAGACACAAACTGAAAATGG + Intronic
1168489214 19:56794036-56794058 CAAAATATACATATGGAAAAGGG - Intronic
1168594651 19:57665380-57665402 CAGCCTACACAAATGGTAAGGGG - Intergenic
925085474 2:1104574-1104596 GGGAAAACACAAATGGAGAAAGG + Intronic
925566267 2:5257790-5257812 GAGAATAAACCAATGCAAAAAGG - Intergenic
925608427 2:5682959-5682981 CACAATATAAAAATGGGAAATGG - Intergenic
926081454 2:9989889-9989911 CAGAATTCACAAAGTGAAGATGG - Intronic
926713352 2:15902027-15902049 CAGAAAACAAAAAGTGAAAATGG + Intergenic
926719307 2:15947518-15947540 CAGAATAAACAGATGGAAATGGG + Intergenic
927209761 2:20631861-20631883 CTGAATACACAAAGGGACAATGG + Intronic
927441134 2:23118744-23118766 GAAATTACACAACTGGAAAATGG - Intergenic
927535019 2:23849079-23849101 CAGCAGACACAAATAGAAAATGG + Intronic
928109838 2:28497698-28497720 GAGAATATACAAATGGACAACGG - Intronic
928239235 2:29572197-29572219 CAGGATAAACAAATCCAAAATGG - Intronic
928415352 2:31087160-31087182 CAGAAGACACAACTTGACAAAGG + Intronic
929011747 2:37451854-37451876 CTGAATATACAAAGGGACAATGG - Intergenic
929379530 2:41334095-41334117 CACAATAGACAAATGGGTAAAGG + Intergenic
930273614 2:49285158-49285180 CAGAATACATAAAGGAAAAATGG + Intergenic
930293485 2:49525342-49525364 CAGATAAAACAAATTGAAAAGGG + Intergenic
930734260 2:54759114-54759136 CACATTTCACAAATGGAAAATGG - Intronic
930951729 2:57150723-57150745 CAAAATACACAAATCAATAAAGG + Intergenic
931121375 2:59223966-59223988 CAGAATTCACAGATGGTAAGTGG - Intergenic
931341915 2:61409858-61409880 CAAAATACACAAGTTCAAAAAGG + Intronic
932865351 2:75335675-75335697 CTGAATATACAAATGGACAATGG - Intergenic
932975372 2:76593685-76593707 CAGGATTCACAAATGAAAAATGG - Intergenic
933132164 2:78685170-78685192 CACAATTCACAATTGCAAAAAGG + Intergenic
933174082 2:79157303-79157325 CAGAAGACATAAATGGAATGGGG + Intronic
933178002 2:79197546-79197568 TTGAATATACAAATGGACAATGG - Intronic
933327531 2:80857666-80857688 CAAAATACACAATTGAGAAATGG + Intergenic
934862043 2:97772405-97772427 CAGGATACAGAAAAGCAAAAGGG - Exonic
935020881 2:99230165-99230187 CAAAATAAAGGAATGGAAAAAGG + Intronic
935199683 2:100845417-100845439 CTGAATGTACAAATGGACAATGG - Intronic
935254470 2:101297213-101297235 CAAAATACAAAAAGGGCAAATGG + Intronic
935514191 2:104015435-104015457 CAAAATCCACAAATGACAAAAGG - Intergenic
935738634 2:106126978-106127000 GATGATACACAAATGGAACACGG + Intronic
937356899 2:121203376-121203398 TGTAATACACATATGGAAAAGGG + Intergenic
937804777 2:126126570-126126592 CTGAATACACACAGGAAAAAAGG - Intergenic
937813198 2:126221587-126221609 CTGAATATACAGATGGACAATGG + Intergenic
938839440 2:135144726-135144748 CACAAAACACAAATGGCAAATGG - Intronic
938977843 2:136496166-136496188 CTGAATATACAAATGGACAGTGG - Intergenic
939088083 2:137745595-137745617 CAGAACACAGAAATGGACAGAGG + Intergenic
939133981 2:138272857-138272879 TTGTATAAACAAATGGAAAAAGG - Intergenic
939142051 2:138366060-138366082 TTAAATACACAAATGAAAAAAGG + Intergenic
939331982 2:140775582-140775604 CACACTACCCAAATGGCAAATGG - Intronic
939762890 2:146206262-146206284 AAGAATACAAAAAAGGTAAAAGG - Intergenic
939820939 2:146956047-146956069 CAGAATACAAAGCTGGAAAAGGG + Intergenic
940334848 2:152515247-152515269 ATGAATACACAAATATAAAACGG - Intronic
940506641 2:154563363-154563385 CAGAAAAAACAGATGTAAAAGGG - Intergenic
941268571 2:163395875-163395897 CAGAATATAAAAATTGAAAAGGG + Intergenic
941318852 2:164029905-164029927 CAGAATACTTAAATGGAACTGGG - Intergenic
941515720 2:166473867-166473889 TAGAATAAACAGTTGGAAAAAGG + Exonic
941926655 2:170902329-170902351 CTGAATATGCAAATGGAATAAGG + Intergenic
942479897 2:176373806-176373828 CAGACTACAGAAAAGGAAATAGG - Intergenic
942909244 2:181221971-181221993 AAGAATACACAATGGGGAAATGG - Intergenic
942921170 2:181375217-181375239 CAGAATAGAGAAATGAGAAAGGG + Intergenic
944035781 2:195293076-195293098 CAGAATACAAAAATGATAAAGGG + Intergenic
944189566 2:196987402-196987424 CAGAATATACAAATATAAAAAGG + Intronic
944248719 2:197559719-197559741 AAGAATCCACAAAAGGGAAAAGG - Intergenic
945052158 2:205834391-205834413 CCGAAAACACAGAGGGAAAAGGG - Intergenic
945237613 2:207646302-207646324 AAGAAGACCCAAATGAAAAAGGG + Intergenic
945567281 2:211416451-211416473 CTGAATATACAAAGGGACAATGG + Intronic
945592457 2:211750708-211750730 CAGAACACGAAAAGGGAAAAAGG + Intronic
945692994 2:213065224-213065246 CAGAAAACACTCATGAAAAAAGG - Intronic
945918024 2:215725214-215725236 CACAATTCACAATTGCAAAATGG - Intergenic
946746281 2:222848935-222848957 CAGAATCCATAAATGTAACAAGG - Intergenic
947421901 2:229948761-229948783 CGGAAAACCCAAATGGAAAGGGG + Intronic
947577385 2:231286838-231286860 AAGAATACCTAAAGGGAAAAAGG + Intronic
947922677 2:233891900-233891922 CAGATAACACAAAAGAAAAATGG + Intergenic
948871494 2:240801260-240801282 CAGAGAATATAAATGGAAAATGG + Intronic
1169443765 20:5654475-5654497 GAGAAGACACAACTGGAAAGGGG - Intergenic
1169575196 20:6952062-6952084 CAAAATACACACAAGGAAAGAGG + Intergenic
1170079766 20:12461250-12461272 GAGAATACACAATGGGGAAAGGG - Intergenic
1170139093 20:13107310-13107332 GAGAAAACATAAAAGGAAAATGG + Intronic
1170355628 20:15489272-15489294 CATAATATAAAAAGGGAAAAGGG - Intronic
1170576595 20:17667392-17667414 CAGAATAAACCAGTGGAAGATGG - Intronic
1170714434 20:18819763-18819785 CAGAACACAGAGCTGGAAAAAGG - Intronic
1170912560 20:20588597-20588619 CAGAATATACAAATGTAAACTGG + Intronic
1171094058 20:22314803-22314825 TATAATACAAATATGGAAAAGGG + Intergenic
1171723354 20:28589616-28589638 CTGAATAGAAAAATGGACAAGGG - Intergenic
1171754702 20:29093468-29093490 CTGAATAGAAAAATGGACAAGGG + Intergenic
1171859988 20:30390330-30390352 CTGAATAGAAAAATGGACAAGGG + Intronic
1172017332 20:31885470-31885492 CTGGATAAACATATGGAAAATGG + Intronic
1173334246 20:42100098-42100120 GAGAATACCCACATGCAAAATGG + Intronic
1173356997 20:42302817-42302839 CAGAGTAAACAAATGCAAATGGG + Intronic
1173400297 20:42720299-42720321 CAGTATTCACATATGTAAAATGG - Intronic
1173409865 20:42800729-42800751 GAAAAGACACAAATGGAAAGGGG + Intronic
1173916679 20:46713285-46713307 CAGAAAAAACAAGTGGAGAAGGG + Intronic
1174127742 20:48319741-48319763 AAGATTACAAAAATGGCAAAGGG + Intergenic
1175391857 20:58632494-58632516 CAGAAGACACATAGGGAAGAGGG + Intergenic
1175452552 20:59082103-59082125 AAGAATACATAAACGGACAAAGG + Intergenic
1175504788 20:59473953-59473975 CTGAATATACAAATGGACCATGG - Intergenic
1176524285 21:7853688-7853710 CTAAATATACAAATGGACAATGG - Intergenic
1176975653 21:15318011-15318033 AAGAAAAAAGAAATGGAAAATGG + Intergenic
1177221957 21:18206490-18206512 AAAAATAAAGAAATGGAAAAAGG - Intronic
1177289018 21:19086079-19086101 CCAAGTCCACAAATGGAAAAAGG + Intergenic
1177374897 21:20257507-20257529 CAGAAGACACAAGTGCAAAAAGG + Intergenic
1177650889 21:23961010-23961032 CTGAATATACAAAGGGACAATGG - Intergenic
1177830081 21:26128670-26128692 CATAAAACACATATGGGAAATGG + Intronic
1178037665 21:28602916-28602938 CAAAGTACAGAAATGGCAAAAGG - Intergenic
1178368927 21:32010979-32011001 CTGAATACATAAATGGACGACGG - Intronic
1178604655 21:34025298-34025320 CAGAAGACACTAATGGCAGAAGG + Intergenic
1178658305 21:34483701-34483723 CTAAATATACAAATGGACAATGG - Intergenic
1178751758 21:35311328-35311350 ACAAATACACAAATGGGAAACGG - Intronic
1178802277 21:35807267-35807289 CAGAAAACACAAAGTGAAGATGG + Intronic
1179010414 21:37552028-37552050 CTGAACATACAAATGGACAATGG + Intergenic
1179334236 21:40435129-40435151 CAGACTTCAGAACTGGAAAAGGG - Intronic
1179423724 21:41255999-41256021 AAGAATAAAAAAAGGGAAAAGGG - Intronic
1179425217 21:41272403-41272425 CAGAGTACTCAAAAGGAAGAAGG - Intronic
1179650809 21:42807359-42807381 CTGAATATACAAATGAACAATGG - Intergenic
1179730940 21:43367057-43367079 CAGAGGACACAAAGGGCAAATGG + Intergenic
1179984298 21:44912492-44912514 CAGAATACAAAAATGTCAAAAGG + Intronic
1180239704 21:46493427-46493449 CTGAAAACACTCATGGAAAAAGG - Intronic
1180296907 22:10948273-10948295 CTGAATAGAAAAATGGACAAGGG - Intergenic
1181729801 22:24836754-24836776 CTGAATTCAAAAATGGACAAAGG - Intronic
1182831826 22:33310411-33310433 CAGAAGACACCAATGGCAAAGGG - Intronic
1184354145 22:43967336-43967358 CAGAGCAGACAGATGGAAAAGGG - Intronic
1184738548 22:46413268-46413290 CAGGACACACAACTGGAAACAGG + Intronic
949142250 3:648857-648879 CTGAATTCAAAAGTGGAAAAAGG + Intergenic
949221599 3:1640730-1640752 CATTTTACAGAAATGGAAAAAGG + Intergenic
949473035 3:4416648-4416670 CAGAATGCTCACCTGGAAAATGG + Intronic
950295391 3:11825179-11825201 CAGTATCCTCAAATGAAAAAGGG + Intronic
950470857 3:13185405-13185427 CAGAATAAACAAGTAGACAAAGG - Intergenic
950581077 3:13862513-13862535 GAAAATATACAGATGGAAAAAGG + Intronic
950971065 3:17188387-17188409 CAATATAAACACATGGAAAAAGG + Intronic
953075344 3:39564866-39564888 AAGAAAAAATAAATGGAAAAGGG - Intergenic
953097503 3:39792979-39793001 CTGAATTTACAAATGGACAATGG - Intergenic
953202178 3:40787436-40787458 CAGAATACAAGAATGAAATAGGG + Intergenic
953250316 3:41240176-41240198 TAAAATAGACAAATAGAAAATGG + Exonic
953375449 3:42424383-42424405 CTGAATATATAAATGGATAATGG - Intergenic
953762569 3:45701633-45701655 TAAACTACACACATGGAAAAGGG + Intronic
954944576 3:54409025-54409047 AAGAATACATAAATGAATAAAGG - Intronic
954960073 3:54556705-54556727 CAGAACACAAACAAGGAAAATGG + Intronic
955543988 3:60007900-60007922 GAGGGTAGACAAATGGAAAAAGG + Intronic
955723066 3:61903913-61903935 CAGAACAGACATATGTAAAAAGG - Intronic
955895011 3:63689558-63689580 CTGAATATACAAATGAACAATGG - Intergenic
956237061 3:67084078-67084100 CTGAAAATACAAATGGACAATGG - Intergenic
956302640 3:67789208-67789230 CAGAATAAAAGACTGGAAAAAGG - Intergenic
957236638 3:77601448-77601470 CAGCATACCAAAATGAAAAATGG + Intronic
957428681 3:80072732-80072754 CAGAAGACAGTGATGGAAAATGG - Intergenic
957632499 3:82735331-82735353 AAAAATACACAAATGCATAAAGG - Intergenic
957673588 3:83338485-83338507 TAGAGTACACATATGGCAAATGG - Intergenic
957890187 3:86346598-86346620 CAGAAAACTAAAATGGAGAAAGG + Intergenic
958542604 3:95498762-95498784 GACATTACACAAAAGGAAAAAGG + Intergenic
959178872 3:102953510-102953532 GACAATATACAAATGGACAATGG + Intergenic
959219143 3:103493456-103493478 CAGAATACACTAGTGAGAAAGGG + Intergenic
959366843 3:105471397-105471419 AAAAGTGCACAAATGGAAAATGG + Intronic
959710574 3:109381921-109381943 CTGAATGTACAAATGAAAAATGG + Intergenic
959840369 3:110968023-110968045 AAGAGAACACAAAAGGAAAATGG - Intergenic
960096237 3:113692631-113692653 GAGAATACAGAAATAGTAAATGG - Intronic
960266653 3:115627796-115627818 CACACTTCACAAATTGAAAAGGG - Intronic
960450171 3:117797044-117797066 AAGAATAAACAACTGGTAAATGG + Intergenic
960622399 3:119649336-119649358 ATGAATAAACAAATGGAGAATGG - Intronic
961101619 3:124203726-124203748 CAGAATCCTCAACTGTAAAATGG - Intronic
962228790 3:133641264-133641286 CAGGAGACCCAAATGTAAAAAGG - Intronic
962277664 3:134028616-134028638 CAGATTACACAAAGGGATGATGG - Intronic
962353508 3:134673617-134673639 CAGGGTACACAAAAGGACAAAGG - Intronic
962544811 3:136422256-136422278 TAGAATACACAATTGTAATAAGG + Intronic
962817491 3:139015563-139015585 CAAAGAACACAAATGGAGAAAGG - Intronic
962842035 3:139242698-139242720 AAGGACACACAAATGGACAATGG - Intronic
962938248 3:140101504-140101526 CAAAAGACACAAATGAACAAAGG - Intronic
963708850 3:148722742-148722764 CAGAAAACAGAGACGGAAAATGG - Intronic
963927504 3:150966506-150966528 GAGAAAGCACAAATGGAAGAAGG - Intronic
964615744 3:158662969-158662991 GATCATACACAATTGGAAAAGGG + Intronic
965006841 3:163038133-163038155 AGGAAAACAAAAATGGAAAAAGG - Intergenic
965370173 3:167852334-167852356 CTGAGTACACAAAGGGAAATAGG + Intergenic
966052896 3:175642853-175642875 CAAAGTACACAAATGTAAAATGG + Intronic
966403583 3:179571573-179571595 CAAAATCGACAAAGGGAAAAGGG + Intronic
966457830 3:180137815-180137837 CAGAAATAACAAGTGGAAAAAGG + Intergenic
966556656 3:181269334-181269356 TAGACTACACAAATAGTAAATGG - Intergenic
966946683 3:184781755-184781777 CAAGAGACACAACTGGAAAATGG + Intergenic
967106410 3:186258168-186258190 CATTCGACACAAATGGAAAATGG + Intronic
967558480 3:190888911-190888933 CAGAATAAATAAGTTGAAAAAGG + Intronic
970541473 4:17084638-17084660 CAAAATACCCTAATGAAAAATGG + Intergenic
970825521 4:20268529-20268551 CAGAATACACACAATGATAAAGG - Intronic
971267430 4:25107796-25107818 CAGAAAAGAATAATGGAAAATGG - Intergenic
971272455 4:25163343-25163365 CTGACTATACAAATGGACAATGG + Intronic
971299485 4:25430001-25430023 CTGAGTATACAAATGGACAATGG - Intergenic
971415486 4:26423847-26423869 CAGAATACATGCATAGAAAAGGG - Intronic
972224808 4:37000488-37000510 CAGGATACAGATAAGGAAAAGGG + Intergenic
972634952 4:40875447-40875469 CACATTAAACAACTGGAAAATGG + Intronic
972665309 4:41159487-41159509 GAGAAAACTGAAATGGAAAAAGG + Intronic
972694125 4:41427978-41428000 CTGAATACACAGAGGTAAAAAGG - Intronic
972812616 4:42607224-42607246 CAGAATACAGAAATGAAGAAAGG + Intronic
972904972 4:43734565-43734587 AAGAGTATACAAATTGAAAAGGG + Intergenic
973982643 4:56319065-56319087 CACAATAGACAAATGGCATATGG - Intronic
974111158 4:57527347-57527369 AAGAATACACAATGGGAAAGGGG + Intergenic
974188186 4:58466935-58466957 AAGACTACAGAAAAGGAAAAAGG - Intergenic
975249123 4:72156893-72156915 CAGAAGCCAAAAATGGAAATGGG + Intergenic
975764988 4:77657996-77658018 CACAATACAAAAATGATAAAGGG + Intergenic
976357448 4:84135689-84135711 GAGAAAACCCAAAGGGAAAATGG + Intergenic
977733695 4:100384643-100384665 CAGAATACATAAATGAAATGGGG + Intergenic
978258782 4:106725545-106725567 AAGAACACACAATAGGAAAATGG + Intergenic
978662607 4:111146904-111146926 CACAATTTAGAAATGGAAAAAGG - Intergenic
981340875 4:143619977-143619999 CTGAATATACAGATGGAAAATGG + Intronic
981916572 4:150040413-150040435 CAGTATATACAGATTGAAAAGGG + Intergenic
982186529 4:152807592-152807614 AAGAAAACACAAATGAAAAATGG - Intronic
982494728 4:156076758-156076780 AAGAATAGACAAATAGATAAAGG - Intergenic
983068637 4:163242412-163242434 CAGAATGCACAACAGCAAAAGGG - Intergenic
983143813 4:164187976-164187998 CAGAATACTCAGATTGAACATGG + Intronic
983399316 4:167243729-167243751 CAGAATATCCAAATTGAGAAAGG - Intergenic
983625730 4:169800201-169800223 CAGAATGCAGAAATTAAAAATGG + Intergenic
984421981 4:179535252-179535274 AAGAAAACACAAGTGAAAAATGG + Intergenic
984429675 4:179632632-179632654 CAGAATACACAATGGGAAATAGG - Intergenic
984467962 4:180125493-180125515 AAGAAATCTCAAATGGAAAAAGG + Intergenic
984546372 4:181109042-181109064 CCAAATACACATAGGGAAAAGGG + Intergenic
984641462 4:182168847-182168869 CAGAAGATATAAATGAAAAATGG - Intronic
985818271 5:2142779-2142801 CAGAAAACACACAGGGAAGAAGG - Intergenic
985989214 5:3541450-3541472 CAGGATAATCAAATGAAAAAAGG + Intergenic
986481166 5:8189639-8189661 CAGAATCCACAAATAGCAAAAGG + Intergenic
986503297 5:8424445-8424467 CAGAAAAAACAAACGAAAAAAGG - Intergenic
986779418 5:11050575-11050597 CTGAATATGCAAATGGACAATGG + Intronic
986888481 5:12270304-12270326 TATAATACACAAATAGATAATGG + Intergenic
986988214 5:13522779-13522801 CAGAACACACACATGTAGAAAGG - Intergenic
987010815 5:13762249-13762271 GACAAAACAAAAATGGAAAAGGG + Intronic
987394007 5:17403897-17403919 CAGACTGCACAGATGGAACATGG + Intergenic
987588289 5:19888059-19888081 CAGAAGAGACAAATAGAATAAGG - Intronic
987616715 5:20283464-20283486 GAAGACACACAAATGGAAAACGG + Intronic
987777899 5:22393217-22393239 GAGAATACACAAAGGAGAAAAGG + Intronic
987798091 5:22655528-22655550 CAACATATACAAATGCAAAATGG - Intronic
987949032 5:24652379-24652401 CTGAAAAAACAGATGGAAAAGGG + Intergenic
988112233 5:26836865-26836887 CAAAAATAACAAATGGAAAATGG + Intergenic
988352519 5:30129881-30129903 AAGAAAACACAATGGGAAAAAGG - Intergenic
988684076 5:33511330-33511352 ATGAATACACAAATAGACAATGG + Intergenic
989084325 5:37658824-37658846 CAGAAACCACAACTGGCAAATGG - Intronic
990077209 5:51863522-51863544 GAGGAAACACAAATGAAAAATGG - Intergenic
990311714 5:54546342-54546364 ATGAAGACATAAATGGAAAATGG - Intronic
990504196 5:56428469-56428491 CATAATAAAAAAATGTAAAAAGG - Intergenic
990627396 5:57630118-57630140 GAGAATATACAAATGGATAATGG + Intergenic
991329243 5:65475404-65475426 CAGAATACAGAAAAGGATTAAGG + Intronic
991502460 5:67290419-67290441 CTGAATAGAGAAAGGGAAAAGGG + Intergenic
991658382 5:68926207-68926229 TAGAAAACACAATTGGACAAAGG + Intergenic
992151438 5:73908466-73908488 CAGAAGGGACAAATTGAAAATGG - Intronic
992368549 5:76118457-76118479 CTCAATACAAAAATGGGAAAAGG + Intronic
993147437 5:84113172-84113194 CTGAATACAAAAATAGAATACGG + Intronic
993461900 5:88192349-88192371 CAGAAGACATATATGTAAAAAGG + Intronic
993650717 5:90518916-90518938 CAGCAGAGAGAAATGGAAAATGG - Exonic
993860916 5:93135958-93135980 CAGAAAAGATAAATGCAAAAAGG + Intergenic
994057829 5:95439431-95439453 CAGAATATTCAAATAGTAAAAGG - Intronic
994588617 5:101744663-101744685 GAGACGATACAAATGGAAAAAGG + Intergenic
994658516 5:102624738-102624760 CAGACTAAACAACAGGAAAATGG - Intergenic
994813488 5:104554405-104554427 CAAGACACACAAATGGCAAACGG + Intergenic
994875873 5:105420112-105420134 CACAATTCACAATTGCAAAATGG + Intergenic
995017784 5:107331273-107331295 CAGAATACAAAAACCAAAAACGG + Intergenic
995033382 5:107505891-107505913 CAGTTTTCTCAAATGGAAAATGG - Intronic
995101232 5:108308834-108308856 TAGAATAGACACAAGGAAAAGGG + Intronic
995296177 5:110525231-110525253 TAAAATACATAAAAGGAAAAGGG + Intronic
995360373 5:111290023-111290045 CAAATTACACACATGGAAGATGG + Intronic
995781652 5:115782601-115782623 CATAATACATAAAGGAAAAATGG - Intergenic
995971762 5:117980871-117980893 CAGAATATTCAAATTTAAAAAGG + Intergenic
996186719 5:120486658-120486680 CAAAAGACAAAAATGGCAAATGG - Intronic
996662714 5:126023004-126023026 CTGAATATACAAATGAAAAATGG - Intergenic
996670892 5:126115572-126115594 CTGAATATACAAATGGACAGTGG - Intergenic
997915666 5:137922345-137922367 CAGATAACACAAATGTAGAAAGG - Intronic
998091643 5:139374459-139374481 CAAAAAAAACAAATGCAAAATGG + Intronic
999475973 5:151899371-151899393 CTGAATACACAATTTGAAAATGG - Intronic
999554594 5:152726834-152726856 CAGAAAACACAGACTGAAAATGG - Intergenic
999927543 5:156395587-156395609 CTGAATATACAAATGGATGATGG - Intronic
999931617 5:156439212-156439234 CAGTTTCCTCAAATGGAAAAAGG - Intronic
1002547529 5:179959952-179959974 CAGAATCCAGCAATGGGAAAAGG + Intronic
1003366945 6:5483923-5483945 CAGAATACTCCAGGGGAAAAAGG + Intronic
1003478466 6:6507669-6507691 GTGAAAACACAAAAGGAAAAAGG - Intergenic
1003833764 6:10044249-10044271 CAGAAAACACACAGGGAAGAAGG - Intronic
1004332419 6:14734069-14734091 CTGAATATACAAATGGACAACGG + Intergenic
1004950716 6:20668107-20668129 CAGGATACACAATTGGAGGAAGG - Intronic
1004958762 6:20760997-20761019 CAAAATACACATATGATAAAGGG + Intronic
1005583878 6:27257743-27257765 TTGAATATACAAATGGATAATGG - Intergenic
1008747323 6:54688091-54688113 CTGAATACACAACTTGAAAGGGG + Intergenic
1008811954 6:55513102-55513124 TAGAAAGCAGAAATGGAAAAAGG - Intronic
1008876481 6:56335238-56335260 CTAAATATACAAATGGACAATGG + Intronic
1008917588 6:56806276-56806298 CAAAATACTCCAGTGGAAAATGG + Intronic
1009437902 6:63638480-63638502 CAGAAAAAACATATGTAAAAAGG - Intronic
1009489283 6:64267769-64267791 CAGAACACAGAAAAGGAATATGG + Intronic
1009897257 6:69767854-69767876 TAAAATACACAAATTCAAAATGG - Intronic
1009923662 6:70094399-70094421 CAAAATACACATATGGAAACAGG + Intronic
1010025514 6:71211752-71211774 CAGAATAAAAAAATAGAAGAAGG + Intergenic
1010632282 6:78212444-78212466 AAGAATACACAATGGTAAAAGGG - Intergenic
1010861850 6:80922115-80922137 CATAAAACTCAAGTGGAAAATGG + Intergenic
1011147203 6:84231310-84231332 CAAAATACACAATTAGAAAATGG + Intergenic
1011447870 6:87462209-87462231 CTGAATATACAAATGGACAAAGG - Intronic
1012148945 6:95721245-95721267 CAGAAGCCACAATTGGCAAATGG + Intergenic
1012152980 6:95778819-95778841 CAAAGTAAACAAAAGGAAAATGG - Intergenic
1012180790 6:96150133-96150155 TAGAATACAAAAAGAGAAAATGG + Intronic
1012215604 6:96579594-96579616 CAAAATACACACATGGTACATGG - Intronic
1012225373 6:96697616-96697638 GAAGACACACAAATGGAAAATGG + Intergenic
1012293245 6:97485243-97485265 GAAAATACACAAATGGCCAAGGG - Intergenic
1012842122 6:104342574-104342596 AAGAAGACACAAATGACAAATGG + Intergenic
1012846067 6:104390735-104390757 AAAAATACACAATGGGAAAAAGG + Intergenic
1012960193 6:105614342-105614364 CAGAATCCACAAATGGTTGATGG + Intergenic
1012960452 6:105616368-105616390 CAGAATCCACAAATGGTTGATGG + Intergenic
1013462636 6:110389963-110389985 CTGAATGTACAAATGGACAATGG - Intergenic
1013718317 6:112990661-112990683 CAGAGAAAACAAACGGAAAATGG - Intergenic
1014476835 6:121883856-121883878 CAGAACACATATATAGAAAATGG - Intergenic
1014520503 6:122436852-122436874 AAGAAGACACAAATAGAGAATGG + Intergenic
1014767264 6:125421307-125421329 CTGAATATATAAATGGACAATGG - Intergenic
1014835727 6:126158356-126158378 CAGAAAATACAAAAGGACAAAGG - Intergenic
1014932925 6:127355250-127355272 AAGAAGACACAATGGGAAAAGGG + Intergenic
1014994047 6:128118737-128118759 CAGATTTCTCAAGTGGAAAAAGG - Intronic
1016219455 6:141648641-141648663 TAAAATACAAAAATTGAAAATGG - Intergenic
1016542852 6:145185700-145185722 GAAGATATACAAATGGAAAATGG + Intergenic
1016861572 6:148724310-148724332 CAGAAAACCCAAATAGAAAAGGG + Intergenic
1016964986 6:149710499-149710521 CTGAATATACAGATGGACAATGG - Intronic
1017852791 6:158319779-158319801 CAGAATACACAATGTGAGAAAGG - Intronic
1018017132 6:159722669-159722691 CTGAAAATACAAATGGTAAATGG + Intronic
1018082741 6:160272347-160272369 CTGAATATACACATGGACAATGG - Intronic
1019840921 7:3442756-3442778 AAGAACACACAAAAGGAAAAAGG - Intronic
1020183662 7:5942248-5942270 CAAAAAACAAAAAAGGAAAATGG - Intronic
1020258746 7:6518292-6518314 AAGAAAACAAAAATGGACAAAGG + Intronic
1020299254 7:6782523-6782545 CAAAAAACAAAAAAGGAAAATGG + Intronic
1020506821 7:9000955-9000977 AAAAATACACAAATGGAGAAAGG + Intergenic
1020830721 7:13091508-13091530 CTGAAGACACAAATAGACAATGG - Intergenic
1020912160 7:14144548-14144570 CATATTACACAATTGGATAAGGG - Intergenic
1020978241 7:15034883-15034905 CACAATAAACAAATGAATAATGG + Intergenic
1021045996 7:15924134-15924156 AAGAATACACAATGAGAAAAGGG + Intergenic
1021383567 7:19999975-19999997 CAGAACACACAATGGGGAAAGGG + Intergenic
1021598112 7:22338531-22338553 GAGAATACACAAATGACTAAAGG - Intronic
1021605422 7:22404934-22404956 CAGGATAAATAAATGGTAAATGG + Intergenic
1021910934 7:25385545-25385567 CAGTTTACAAAAATGGAGAAGGG - Intergenic
1022112700 7:27241130-27241152 AAGAATACAGAAAGAGAAAAAGG + Intergenic
1022825674 7:34010436-34010458 CAAAATATAAGAATGGAAAATGG - Intronic
1023971584 7:44995207-44995229 CTGAATATACAAATAGACAATGG + Intergenic
1024133490 7:46382336-46382358 CATAATAGACAAATAGACAATGG + Intergenic
1024410147 7:49031059-49031081 CAGAAGCCACAAAGGTAAAACGG + Intergenic
1024577223 7:50774496-50774518 CAGAATGCAGAAGTGCAAAAAGG + Intronic
1024961484 7:54981381-54981403 CTGAGTACACAAATGGACAATGG + Intergenic
1024995305 7:55269656-55269678 CTGAGTACACAAATGGACAATGG + Intergenic
1025264130 7:57441292-57441314 CAGAAAACACACTGGGAAAAAGG - Intergenic
1026264010 7:68780629-68780651 CAGAATAGCCATTTGGAAAAAGG + Intergenic
1026327136 7:69320504-69320526 GAAAACACACAAATGCAAAAAGG + Intergenic
1027048411 7:75006539-75006561 CAAAAGATGCAAATGGAAAAGGG - Intronic
1027545500 7:79522780-79522802 CATTATACACACAAGGAAAATGG - Intergenic
1027591704 7:80126813-80126835 CAGTTAACACAAATGAAAAATGG + Intergenic
1027644408 7:80779202-80779224 CAGTTTACACAACTGTAAAATGG + Intronic
1027651958 7:80879242-80879264 GAGCATACATTAATGGAAAATGG + Intronic
1028266412 7:88732201-88732223 CAGAAGACACAAAAGAAAAAAGG - Intergenic
1028270825 7:88786885-88786907 CTAAATATACAAATGAAAAAAGG + Intronic
1028310317 7:89324235-89324257 TAAAATACACAAAGTGAAAATGG - Intronic
1028781899 7:94746754-94746776 CTGAATATACAAATGGACAATGG + Intergenic
1029013554 7:97289522-97289544 GGGAGTACACAAAAGGAAAATGG - Intergenic
1029749882 7:102537282-102537304 TAGAGTACACAAAAGGCAAAAGG - Intergenic
1029767832 7:102636388-102636410 TAGAGTACACAAAAGGCAAAAGG - Intronic
1029947698 7:104550504-104550526 CAGAATACATGAGAGGAAAAAGG + Intronic
1030131243 7:106202798-106202820 CAGAATACATGAAAGAAAAATGG - Intergenic
1030132832 7:106217679-106217701 CAGAATAGACAAAGCCAAAAAGG - Intergenic
1031079533 7:117244833-117244855 AAGAATACACAATGGGGAAAAGG + Intergenic
1031231382 7:119111954-119111976 GAGAATAAAGGAATGGAAAAGGG - Intergenic
1031395467 7:121268491-121268513 AAGAATAGAAAAAAGGAAAAGGG + Intronic
1031788118 7:126060448-126060470 CCGAATACACAAACATAAAAGGG - Intergenic
1032349419 7:131146530-131146552 CAGTATACCCAAGTGGCAAATGG - Intronic
1032371050 7:131352340-131352362 CAGAGTGCATAATTGGAAAATGG + Intronic
1032375183 7:131407721-131407743 CAGCATACACAAAGGCACAAAGG - Intronic
1032546087 7:132744168-132744190 CAGAATATGCAAATAGGAAAAGG + Intergenic
1032887507 7:136157184-136157206 CAAAATACAAAAATGTTAAATGG + Intergenic
1032890970 7:136194030-136194052 CATAATAAACAAAATGAAAAGGG - Intergenic
1033290669 7:140080195-140080217 CAGAATCCTCAAATTGTAAAGGG + Intergenic
1033363455 7:140654143-140654165 CTGAATACGCAAAGGGACAATGG - Intronic
1033388178 7:140899674-140899696 CAGAACACCAAATTGGAAAAAGG - Intronic
1033449771 7:141452033-141452055 AAGAAAACAGAAAAGGAAAAAGG - Intronic
1034044849 7:147916971-147916993 CAGAATCCATGTATGGAAAATGG - Intronic
1034129954 7:148706547-148706569 CAAAACACACAAAGGGAAGAAGG + Intronic
1034672263 7:152867682-152867704 CTGAATACACAAATGGACAATGG - Intergenic
1035557667 8:578832-578854 CAGCAGACACTAATGGAAATGGG + Intergenic
1036095028 8:5714277-5714299 CAAAATATAAAAATTGAAAATGG - Intergenic
1036908187 8:12725940-12725962 CAACCGACACAAATGGAAAAAGG + Intronic
1037167096 8:15844099-15844121 CAGAAAACAAAAATGAAACAAGG - Intergenic
1037613259 8:20494618-20494640 CAGCACACCCAAATGGAGAAGGG + Intergenic
1037698984 8:21255215-21255237 CAGAATAAAGAAATAGAAAAAGG - Intergenic
1037700619 8:21270989-21271011 CAGAATAAACAAAGGGAGAGAGG + Intergenic
1038042059 8:23731746-23731768 CAGAATACATATCTGAAAAAAGG - Intergenic
1038813694 8:30879054-30879076 GAGAATACACTGATGGCAAATGG - Intronic
1039396532 8:37230222-37230244 CCCAATATGCAAATGGAAAAGGG + Intergenic
1039535184 8:38304148-38304170 CAGCATAAACAACTGAAAAATGG + Intronic
1039683741 8:39772592-39772614 CAGAAAACACAAAGGAATAATGG - Intronic
1039781372 8:40789442-40789464 CTGAATATGCAAATGGACAATGG + Intronic
1040958007 8:52999743-52999765 CTGACTATACAAATGGGAAATGG + Intergenic
1041443914 8:57929437-57929459 CTGAATATACCAATGGATAATGG - Intergenic
1041510587 8:58650986-58651008 CAGAGAACACAATTGGAAAGAGG - Intronic
1042359347 8:67864839-67864861 CAAAATATCCAAAAGGAAAATGG + Intergenic
1042568163 8:70133559-70133581 CTGAATACTAAAAGGGAAAATGG + Intronic
1043429974 8:80185240-80185262 CTGAATATACAAATGGACATTGG + Intronic
1043477588 8:80620217-80620239 CATAATAAACAAATGGAATTTGG - Intergenic
1043723580 8:83579538-83579560 CATAATACATAAATGCCAAAAGG - Intergenic
1044203500 8:89464088-89464110 GACAATATACAAATGGACAATGG - Intergenic
1044240671 8:89884869-89884891 CTGAATATGCAAATGGACAATGG + Intergenic
1044332371 8:90936253-90936275 AAGCATTCACTAATGGAAAAGGG - Intronic
1044511313 8:93082859-93082881 CAGATTACTCAAAGGGATAATGG + Intergenic
1044605892 8:94047102-94047124 CTGAATATGCAAATGGACAATGG + Intergenic
1044881946 8:96732100-96732122 TAGAATACACAAATCAAAAGTGG + Intronic
1045213354 8:100122031-100122053 CTGAATATACAAATGGACAGTGG + Intronic
1045586489 8:103543728-103543750 AAGAATACACAATGGGCAAAGGG + Intronic
1045598754 8:103689824-103689846 GAAAATAAAGAAATGGAAAAAGG - Intronic
1046205828 8:110995225-110995247 AATAATACACAAATAGAAAAGGG - Intergenic
1046361584 8:113165852-113165874 CACAACTCACAAATGCAAAATGG + Intronic
1046857778 8:119053618-119053640 CTGGAGACACAAATGGAGAATGG - Intronic
1047757684 8:127931266-127931288 CTGGAAACATAAATGGAAAAGGG - Intergenic
1047876263 8:129141145-129141167 GAGAAGACACAAATAGAAAAGGG - Intergenic
1047894283 8:129348749-129348771 AAGAAGTCACAAAAGGAAAAGGG + Intergenic
1047932440 8:129743541-129743563 CAGAATACAGAAATGACAGATGG - Intergenic
1047988560 8:130261934-130261956 CAGAATGAACAAAAGGAATATGG + Intronic
1048134951 8:131739555-131739577 CAGATTACAAATCTGGAAAACGG - Intergenic
1048707769 8:137173295-137173317 CTGGAGACACATATGGAAAAGGG - Intergenic
1048894256 8:138975278-138975300 CTGAATACACAGATGGACAATGG - Intergenic
1048912120 8:139145473-139145495 AAAAATACACAAAGGGGAAAGGG - Intergenic
1050012357 9:1197747-1197769 CAGATTACATAAATCCAAAAGGG - Intergenic
1050820942 9:9879191-9879213 TAGAATAAACAAAAGAAAAAAGG - Intronic
1051014454 9:12458720-12458742 CTGAATATACAAATAGACAATGG + Intergenic
1051224943 9:14889418-14889440 GAGAACACACAAATGGCTAAGGG - Intronic
1052302643 9:26971486-26971508 AAGAAAACACAGAAGGAAAATGG - Intronic
1052380779 9:27768478-27768500 CAGAATTTACAGATGGAAAGTGG - Intergenic
1052396627 9:27946786-27946808 CAGAAAAGTCAAATGAAAAATGG + Intergenic
1052459095 9:28740544-28740566 CAGAAAACAAAAAAGCAAAATGG - Intergenic
1052957514 9:34264885-34264907 CAGCATATACAACTGGAAAAAGG + Intronic
1053244414 9:36522877-36522899 GTGTATACACACATGGAAAATGG + Intergenic
1053306001 9:36985384-36985406 CTGAAAACAGAACTGGAAAAGGG + Intronic
1053726747 9:41010739-41010761 CTGAATAGAAAAATGGACAAGGG + Intergenic
1054967647 9:71047863-71047885 CACAACAAACAAATGAAAAACGG + Intronic
1055498923 9:76884087-76884109 CAGAATAGGCAAATGGAGAGAGG - Intronic
1055626082 9:78178749-78178771 AAGAATACACAAAAGCAACACGG + Intergenic
1055729660 9:79267458-79267480 GAGATTACAAAAAAGGAAAATGG - Intergenic
1055884289 9:81041139-81041161 CATAATACAGATATGCAAAAGGG - Intergenic
1057926953 9:99161077-99161099 GAGAATAAACAAATGAATAAAGG - Intergenic
1058170634 9:101676855-101676877 CAGAAAAAAAAAAAGGAAAAGGG - Intronic
1058207754 9:102129667-102129689 CACAATAAAAAAATGGTAAAGGG - Intergenic
1059175996 9:112170663-112170685 CTGAATATACAAATGGACAATGG + Intronic
1059403642 9:114086434-114086456 AAGAAGATAGAAATGGAAAAAGG + Intronic
1059935806 9:119309400-119309422 CATATTACACAACTGGAAAGTGG - Intronic
1059968209 9:119637227-119637249 TTGAATATATAAATGGAAAATGG - Intergenic
1060166525 9:121421712-121421734 CAGAAGAGACAAAAGAAAAAAGG - Intergenic
1060910511 9:127346244-127346266 CAGAATACATAAAAGTTAAATGG + Intronic
1061638030 9:131927788-131927810 CAGAGTATAAAAAGGGAAAAGGG - Intronic
1061718477 9:132536722-132536744 CGGAATATCCAAATGGACAATGG - Intronic
1186351314 X:8742459-8742481 CAGTGTTCTCAAATGGAAAATGG + Intergenic
1187296206 X:18003308-18003330 AAGAATACACAGACGGAAAATGG - Intergenic
1187436966 X:19279993-19280015 CATATTACTTAAATGGAAAAAGG + Intergenic
1187667139 X:21626725-21626747 CAGAAAACACAAATTTAGAATGG + Intronic
1187846731 X:23546327-23546349 GAAAATACACAAATGCAAACAGG + Intergenic
1188248483 X:27862431-27862453 AAGAACACACAACTGGGAAAAGG - Intergenic
1188377986 X:29456494-29456516 CAGAATACAAGAAAGAAAAAGGG + Intronic
1188728534 X:33615709-33615731 CAGAAATCACTAATGGAAAGAGG + Intergenic
1190097206 X:47491302-47491324 CAGAATTCAGCAATGGAAAAGGG + Intergenic
1190301708 X:49060839-49060861 CACAATACACAGATGGGGAAGGG + Intronic
1190430026 X:50370174-50370196 CAGAAAACAAAAATGCAAACAGG - Intronic
1190780254 X:53587046-53587068 TAGATTACACAACTGGTAAATGG - Intronic
1190798277 X:53764191-53764213 CATAATACACAACTCGAACAAGG + Intergenic
1190975301 X:55394134-55394156 CATAAAACAAAAATGGCAAAAGG - Intergenic
1191014539 X:55794393-55794415 CAGAATTCACAGATCCAAAAAGG - Intergenic
1191744571 X:64472253-64472275 CAGAATAAACAAATCTATAACGG - Intergenic
1192012119 X:67285684-67285706 CAGAGGAGACAAAAGGAAAAGGG - Intergenic
1192453609 X:71259284-71259306 CAGTGTCCACAAATGTAAAATGG + Intergenic
1192829586 X:74737325-74737347 CAGAATAGAGAAATAGAAGAAGG + Exonic
1193186294 X:78516907-78516929 CAGACTATTCAAATTGAAAATGG - Intergenic
1193455462 X:81726153-81726175 CAGAAGAGACAAAAGAAAAAAGG + Intergenic
1193584573 X:83305077-83305099 GAGAAAACTCAAATGGGAAAAGG - Intergenic
1193901940 X:87190890-87190912 CAGAAAACACAAAAGGTTAAGGG - Intergenic
1194001688 X:88437616-88437638 CTGAATACATAAATGGACAATGG + Intergenic
1194413352 X:93580908-93580930 CAGAACACACATAGAGAAAACGG + Intergenic
1194467541 X:94252412-94252434 CAAAGTTCACAAATGGTAAATGG - Intergenic
1194491832 X:94560603-94560625 AAGAATACACAAAGGGAATGGGG + Intergenic
1194681074 X:96853563-96853585 TTGAATACATTAATGGAAAATGG - Intronic
1194885920 X:99316101-99316123 AAAAATAGAAAAATGGAAAAAGG - Intergenic
1195092766 X:101478341-101478363 AGCAATACACAAATGGAAAATGG + Intronic
1195417659 X:104637611-104637633 CAGCATACACAAATCAATAAGGG - Intronic
1196374732 X:115020438-115020460 CAGAAGACACAAAGTGAAAGTGG + Intergenic
1196557786 X:117110596-117110618 AAGAAAACACAAAAAGAAAATGG + Intergenic
1196710343 X:118755662-118755684 CAGGGTACAGAAATGAAAAAGGG + Intronic
1197041454 X:121940655-121940677 AAGAATACACAATGGGGAAAGGG - Intergenic
1197295515 X:124714210-124714232 CAGGTTACACAATTGGTAAAAGG + Intronic
1197470145 X:126857054-126857076 CAGAGGACACAAAAGAAAAAAGG + Intergenic
1197700093 X:129593171-129593193 CAGAATCCACAAATTCATAATGG - Intergenic
1198487841 X:137106264-137106286 CAGAATACAGCAAAGGAAATAGG - Intergenic
1198585249 X:138113537-138113559 ATGAATACACAAATGAAAGAAGG + Intergenic
1198766934 X:140089996-140090018 CCAATTACACATATGGAAAAAGG + Intergenic
1198985472 X:142447553-142447575 TAGAGAACTCAAATGGAAAAAGG - Intergenic
1199106275 X:143873035-143873057 TAGAATAGACAAATTGAAGAGGG + Intergenic
1199287538 X:146070535-146070557 CAGAAGACACGAAGGGAAGAAGG - Intergenic
1200671048 Y:6091809-6091831 CTGAATACACAAAAGGTAAGTGG - Intergenic
1201315650 Y:12643070-12643092 CTGAATATACAAATGGACATTGG + Intergenic
1201339847 Y:12922859-12922881 CAGAATACACAGACGGCAACAGG - Intergenic
1202082662 Y:21100766-21100788 AACAAAACAAAAATGGAAAATGG + Intergenic
1202270962 Y:23073645-23073667 CAGAAGACAGAAAGGGAAGAAGG + Intergenic
1202295064 Y:23347037-23347059 CAGAAGACAGAAAGGGAAGAAGG - Intergenic
1202423957 Y:24707389-24707411 CAGAAGACAGAAAGGGAAGAAGG + Intergenic
1202446832 Y:24962696-24962718 CAGAAGACAGAAAGGGAAGAAGG - Intergenic