ID: 1101889500

View in Genome Browser
Species Human (GRCh38)
Location 12:108700119-108700141
Sequence AGATGTACCCTGAATATAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 153}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101889496_1101889500 9 Left 1101889496 12:108700087-108700109 CCACTCTCAGAATCACATGATCC 0: 1
1: 1
2: 1
3: 16
4: 182
Right 1101889500 12:108700119-108700141 AGATGTACCCTGAATATAAGGGG 0: 1
1: 0
2: 2
3: 10
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101889500 Original CRISPR AGATGTACCCTGAATATAAG GGG Intronic
906871863 1:49491817-49491839 ACATATTCCCTGAAGATAAGAGG - Intronic
908957033 1:69644517-69644539 AGAAGTACACTGAAAATAAAAGG - Intronic
909414436 1:75388813-75388835 ATATTAACCTTGAATATAAGTGG + Intronic
911210090 1:95129835-95129857 AGCAGTACCATGAATATTAGAGG + Intronic
911883878 1:103272869-103272891 AGATGCACCCTTAATATGGGTGG + Intergenic
912129604 1:106585545-106585567 AGATGTACCCTTAATCTTGGTGG - Intergenic
913031389 1:114907220-114907242 ATATGTAGCCTGCATATAATTGG + Intronic
914864709 1:151416980-151417002 AGTTGTCCCCAGAATATCAGTGG - Intronic
916033770 1:160902727-160902749 ACATATACCCTGAAGATAAGAGG - Intergenic
918947669 1:191090541-191090563 ATATGTACGGTGAAAATAAGGGG - Intergenic
919762257 1:201105682-201105704 GGATCTTCCCTGAATAGAAGAGG - Intronic
921300804 1:213749750-213749772 AGTTGTCCCCTGAATAGAAAAGG - Intergenic
921438644 1:215157764-215157786 AGATGTCCATTGACTATAAGCGG - Intronic
922168043 1:223131903-223131925 AAATGTACCCAGAATACCAGGGG - Intronic
1064990207 10:21250221-21250243 AGATGCACCCTTAATCTGAGTGG + Intergenic
1065135369 10:22662552-22662574 TGATGTACCCTGTATATTAAAGG - Intronic
1068847036 10:61688644-61688666 AGGTGTACACTCAATATAAGAGG + Intronic
1070874434 10:79789474-79789496 AGAAGTGCCCTGAATCAAAGAGG + Intergenic
1071641358 10:87311632-87311654 AGAAGTGCCCTGAATCAAAGAGG + Intergenic
1075464522 10:122641789-122641811 AGATGTACCCTGGCTATACCTGG + Intronic
1075542608 10:123328205-123328227 AAATGTATCCTGCAAATAAGAGG + Intergenic
1075690690 10:124392105-124392127 TGATGTACCCAGAATAACAGAGG - Intergenic
1076337190 10:129714959-129714981 AGTTTTATCCTGAATGTAAGAGG + Intronic
1079146312 11:17855429-17855451 ACATGTCCCCTGAAGATAAGGGG - Intronic
1081957333 11:47104872-47104894 AGATGTAAACTGAACACAAGAGG - Intronic
1095217179 12:39563469-39563491 AGTAGTACACTGAATGTAAGTGG - Intronic
1095932818 12:47646212-47646234 AGATGTAACATGCATATAATGGG + Intergenic
1101787834 12:107901185-107901207 AGATGTACCCTTAATATATGGGG - Intergenic
1101889500 12:108700119-108700141 AGATGTACCCTGAATATAAGGGG + Intronic
1104227826 12:126853434-126853456 CGATATTCCTTGAATATAAGTGG - Intergenic
1106611736 13:31289759-31289781 AGATTAACCTTGAATATAACTGG + Intronic
1107197141 13:37666299-37666321 AGATGTACCCTGTGTATACAGGG - Intronic
1108245715 13:48511133-48511155 AAAAGTACTCTGAATATCAGAGG + Intronic
1108602560 13:52007338-52007360 CGATGTACCTTGCTTATAAGAGG - Intronic
1109519341 13:63487273-63487295 AGATGCACCCTTAATCTAGGGGG + Intergenic
1110799778 13:79681436-79681458 ATATATACCCTGCAGATAAGAGG - Intergenic
1117880053 14:60304523-60304545 AGAAATTCTCTGAATATAAGTGG + Intergenic
1118151300 14:63193914-63193936 AGAAGTACCCTGAAAAAAGGGGG - Intergenic
1118574746 14:67231094-67231116 AGATATCCCCTGAAGATGAGGGG + Intergenic
1120118037 14:80643057-80643079 TGAGGTACCCTTAATATATGTGG - Intronic
1125091793 15:35801610-35801632 ACATGTACATTGAATAAAAGTGG - Intergenic
1125436220 15:39647717-39647739 ACATGTACCATGAATAGGAGAGG + Intronic
1127026876 15:54816290-54816312 GTTTGTACCCTGAATAGAAGTGG + Intergenic
1127079115 15:55358336-55358358 ACATATATCCTGAAGATAAGGGG + Intronic
1130218251 15:81993833-81993855 ATAAGTACCTTGAATATAAATGG + Intergenic
1132223316 15:100121728-100121750 AGATGTAACCTGAATGCAGGAGG + Intronic
1134313438 16:13096958-13096980 AGATGTGCCCTGAAGAGAAATGG - Intronic
1135219281 16:20599555-20599577 AAATTTATCCTGAATGTAAGAGG - Intergenic
1139047453 16:63079392-63079414 ACATATACCCTGTAGATAAGGGG + Intergenic
1139179129 16:64725054-64725076 AGATCAACCCTGAATACAAGTGG - Intergenic
1140224616 16:73067482-73067504 AGAGGTTCCCTGAAGATGAGGGG - Intergenic
1141073308 16:80978407-80978429 AGATGGTCCCTGAATAAAAGGGG + Intronic
1146095436 17:29925975-29925997 AGATGTTTCCTGATTATTAGAGG - Intronic
1148133944 17:45279849-45279871 AGATGTCCAATGAATATTAGAGG + Intronic
1148582152 17:48751730-48751752 CGCTCTACCCTGAATATGAGGGG - Intergenic
1152306272 17:79522483-79522505 AAATGTACCCTGAAAATAGTTGG - Intergenic
1152456830 17:80421636-80421658 AGATGTACCCTGCAAATTGGTGG - Intronic
1154944028 18:21143159-21143181 AGATGTACCATGTATATTCGTGG - Intergenic
1158835030 18:61321946-61321968 AGATGTAGCCTGAAGAACAGGGG - Intergenic
1159087987 18:63816300-63816322 ATATTAACCCTGAATATAAATGG - Intergenic
1159441048 18:68480658-68480680 ACATATCCCCTGAGTATAAGGGG + Intergenic
925262534 2:2541060-2541082 AGATGTAGCCTGAATAGGTGTGG + Intergenic
925494008 2:4426078-4426100 AGATTTACCATGAAGATACGTGG + Intergenic
929573123 2:43035545-43035567 CCATGTCCCCTGAAGATAAGAGG + Intergenic
930179733 2:48341920-48341942 AGCTGTACTAAGAATATAAGAGG + Intronic
932881868 2:75509148-75509170 AAATTTACCTTGAATTTAAGGGG + Intronic
933095888 2:78180039-78180061 AGATCTAGCCTTATTATAAGGGG - Intergenic
935511845 2:103985375-103985397 AGATATTCCCTGTATATAAATGG - Intergenic
937020370 2:118645157-118645179 AAATATCCCCTGAATATAAGAGG + Intergenic
937739767 2:125336301-125336323 AGATGTAGACTGAAAATAAAGGG + Intergenic
941829727 2:169941762-169941784 ACGTGTTCCCTGAAGATAAGAGG + Intronic
942672049 2:178386574-178386596 AGATGTACACTAAAAATAATTGG - Intronic
942988164 2:182166270-182166292 AGACCTACCCTGAATATGGGCGG + Intronic
943363484 2:186947912-186947934 AATTATACCCTTAATATAAGTGG - Intergenic
943702498 2:191001808-191001830 AGATGTACCCTGCACATACTAGG + Intronic
943771944 2:191727537-191727559 AGATGTACCGTGAAAAAAATAGG - Intergenic
944416193 2:199482086-199482108 AGAGCTACTCTTAATATAAGTGG - Intergenic
945628910 2:212246597-212246619 AGATGTAGCTTAAAAATAAGTGG + Intronic
946265611 2:218538817-218538839 ACATGTACCCTGAAGATAAGGGG - Intronic
1170706935 20:18752311-18752333 AGATGTACCATATATATAATTGG - Intronic
1170878154 20:20270441-20270463 AGATGTACCCTAAAAGTAATGGG - Intronic
1177062157 21:16389237-16389259 AGATCCACCCTCAATATAGGTGG - Intergenic
1177920164 21:27142922-27142944 AAATTTACCTAGAATATAAGGGG - Intergenic
1179046196 21:37847549-37847571 AGATGGACACTGGATAGAAGAGG + Intronic
1185381914 22:50513151-50513173 AGATGTACTCTGAATGATAGTGG + Intronic
949304995 3:2629666-2629688 AGATGTATCAGGAATATTAGTGG - Intronic
954785473 3:53089421-53089443 AGAAGTAGCCTCACTATAAGTGG + Exonic
956211469 3:66805876-66805898 AATTGTAAACTGAATATAAGAGG - Intergenic
956391098 3:68773357-68773379 TGTTGTACCCTGAATCCAAGGGG - Intronic
957551231 3:81707918-81707940 TGATATACCCTTAATATCAGTGG + Intronic
959949146 3:112159927-112159949 ACATGTACACTGAAAATGAGAGG - Intronic
960406709 3:117270355-117270377 AGATGTTCTCAGAATAGAAGTGG + Intergenic
961309220 3:125983524-125983546 ACATGGACCCTGAGTAAAAGTGG + Intergenic
962860554 3:139396537-139396559 AGATTTACGCAGAAAATAAGAGG - Intergenic
965029121 3:163340898-163340920 AGATGCACCCTCAATATGGGTGG - Intergenic
966302925 3:178498724-178498746 AGATGTTGACTGAAGATAAGAGG - Intronic
970462863 4:16292936-16292958 AAATTTAGCCTGAGTATAAGTGG - Intergenic
971343449 4:25791260-25791282 AAATCTACCCTGAAAAGAAGAGG + Intronic
971583673 4:28376626-28376648 AGATCAACCCTCAATATGAGTGG - Intronic
974575188 4:63710273-63710295 AGATATTGCCTGAATCTAAGAGG - Intergenic
975799625 4:78046490-78046512 TAATGTACTCTGACTATAAGAGG + Intergenic
976008765 4:80461734-80461756 GGATGATCCCTGAATATAACTGG - Intronic
976090442 4:81451894-81451916 TGTGGTACCCTGAATAGAAGTGG - Intronic
976427933 4:84928065-84928087 AGATCTGCCCTCAATATGAGTGG + Intronic
977830687 4:101588573-101588595 AGGTGTACCTTTTATATAAGAGG + Intronic
978663755 4:111157579-111157601 ATAATTACCTTGAATATAAGTGG + Intergenic
980391502 4:132153618-132153640 AGTAGTACGCTGAATAGAAGTGG + Intergenic
984903177 4:184602816-184602838 ATATTAACCTTGAATATAAGTGG + Intergenic
986227752 5:5832177-5832199 AGTAGTACACTGAATAGAAGTGG - Intergenic
986252741 5:6075588-6075610 ACATTTACCCTGCATATGAGAGG - Intergenic
988234270 5:28520609-28520631 AGATCTACCCTTAATCTCAGTGG - Intergenic
988844927 5:35118053-35118075 ACATGAACCCTGAAGGTAAGGGG - Exonic
989525558 5:42449664-42449686 AGAACTACGCTGAATAGAAGTGG + Intronic
992525059 5:77601301-77601323 AGATGAACCCTGAACTAAAGTGG + Intronic
993319407 5:86454864-86454886 AGATGCACCCTTAATCTGAGTGG + Intergenic
994946597 5:106401463-106401485 AGATGTATGTTGAATATAAGTGG + Intergenic
996215536 5:120860822-120860844 AGTTGCACCCTCAATATATGGGG - Intergenic
996351330 5:122545408-122545430 AGAAGAAACCTGAATATAAATGG + Intergenic
1000172137 5:158712623-158712645 AGATGTACCCTGGAGTTAACAGG + Intronic
1001091909 5:168748025-168748047 AAAGATACCCTGAGTATAAGTGG - Intronic
1002719975 5:181253017-181253039 AAAAGTACCCTGAGTATCAGTGG - Intergenic
1003088677 6:3082539-3082561 AGCTGTAGCCTGAACCTAAGAGG - Intronic
1006679826 6:35788861-35788883 AAATGTAACCTGAATATAACAGG - Intronic
1006763214 6:36482156-36482178 ATATGTACACTGAATATACCTGG - Intronic
1007017426 6:38482874-38482896 AGATGTACCCAGATTGAAAGAGG - Intronic
1008248691 6:49210181-49210203 AGATGTAACCTGAATATTGTGGG + Intergenic
1009044040 6:58216309-58216331 AGATCTACCCTCAATGTGAGTGG + Intergenic
1009219868 6:60970577-60970599 AGATCTACCCTCAATGTGAGTGG + Intergenic
1009516267 6:64622432-64622454 AAATTTAACCTGGATATAAGTGG - Intronic
1009983918 6:70759393-70759415 AGGTGTCCCTTGAATATAACAGG + Intronic
1013168458 6:107615315-107615337 AGATTTAGACTGAATATTAGTGG + Intronic
1015332189 6:131993444-131993466 AGATCTAACATGGATATAAGTGG + Intergenic
1018519223 6:164626813-164626835 AAATGGACCTTGAATATAAAGGG + Intergenic
1020801278 7:12735232-12735254 GGATGTACTTGGAATATAAGGGG + Intergenic
1021355096 7:19644550-19644572 AGACCTACCCTCAATATGAGTGG + Intergenic
1021579290 7:22135338-22135360 AGATTTACACTGAATGTCAGCGG + Intronic
1021957151 7:25837012-25837034 AGATCTGCCCTGAAAAAAAGGGG + Intergenic
1023524932 7:41092027-41092049 AGATGTAACATGAATGTAATGGG - Intergenic
1029815168 7:103086146-103086168 AGATGTTCCATAAAAATAAGGGG - Intronic
1031533356 7:122903398-122903420 AGATGTGCCTTAAATAAAAGGGG - Intergenic
1031737764 7:125388307-125388329 AGATGTAGTCTGAATAAAGGAGG + Intergenic
1033825306 7:145182652-145182674 ACATATCCCCTGAACATAAGGGG - Intergenic
1035868400 8:3110068-3110090 ATATGTGCCTTGTATATAAGTGG + Intronic
1037842090 8:22251970-22251992 AGATGTACCCAAAATCTAAGGGG - Exonic
1039786524 8:40839013-40839035 AAATGTACCCTGTACATAAAAGG + Intronic
1042388101 8:68201621-68201643 AGATCTACCCTCAATATGGGTGG - Intronic
1043922646 8:86001498-86001520 AAATGCACCCTAAATATATGAGG + Intronic
1044342671 8:91065434-91065456 AGATGAATCCAGAATATACGGGG + Intergenic
1044907038 8:97015847-97015869 ATATGTGCCCTGACTTTAAGTGG + Intronic
1045718909 8:105082556-105082578 ACGTATACCCTGAAGATAAGGGG + Intronic
1047170304 8:122486260-122486282 TGAAGTATCCTTAATATAAGTGG - Intergenic
1047340165 8:123973382-123973404 AGATTTACCTTGAGGATAAGAGG - Intronic
1048041654 8:130735305-130735327 ATATTAACCCTGAATATAAATGG + Intergenic
1051494163 9:17700140-17700162 AGATGGATCCTGAATACCAGAGG - Intronic
1052566002 9:30152687-30152709 ACATGTACACTGAAAATAAAGGG - Intergenic
1186642651 X:11472668-11472690 TGAGGTAGCCTGAATAGAAGGGG + Intronic
1187553545 X:20329558-20329580 TGATGTTCCATGAAAATAAGTGG - Intergenic
1188152801 X:26699665-26699687 AGATGTACCCTTAACCAAAGAGG + Intergenic
1190106341 X:47563453-47563475 ACATGTACCCTGCAGATAAGGGG - Intronic
1190894102 X:54598885-54598907 AGATGTAGCATGAACATAATTGG + Intergenic
1191630539 X:63316900-63316922 AGATGCACCCTTAATCTCAGTGG - Intergenic
1194691144 X:96986696-96986718 ACATGTACCCTGAAATTAATAGG + Intronic
1197285551 X:124591221-124591243 ATATTTACCTTGAATATAAATGG - Intronic
1198058522 X:133019969-133019991 AGATGAAGCATGAAAATAAGAGG + Intergenic
1198421834 X:136476038-136476060 AGATGTGCACTGATTATTAGGGG - Intergenic
1199064241 X:143395510-143395532 AGATCTGCTCTAAATATAAGCGG - Intergenic