ID: 1101889639

View in Genome Browser
Species Human (GRCh38)
Location 12:108701663-108701685
Sequence TCTTATCTGTAAAAGGGGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 846
Summary {0: 1, 1: 1, 2: 25, 3: 144, 4: 675}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101889639_1101889646 7 Left 1101889639 12:108701663-108701685 CCCTTCCCCTTTTACAGATAAGA 0: 1
1: 1
2: 25
3: 144
4: 675
Right 1101889646 12:108701693-108701715 AAAGTGAAATTCTCTGGTAGAGG 0: 1
1: 0
2: 0
3: 9
4: 209
1101889639_1101889647 12 Left 1101889639 12:108701663-108701685 CCCTTCCCCTTTTACAGATAAGA 0: 1
1: 1
2: 25
3: 144
4: 675
Right 1101889647 12:108701698-108701720 GAAATTCTCTGGTAGAGGTGAGG 0: 1
1: 0
2: 1
3: 22
4: 294
1101889639_1101889644 1 Left 1101889639 12:108701663-108701685 CCCTTCCCCTTTTACAGATAAGA 0: 1
1: 1
2: 25
3: 144
4: 675
Right 1101889644 12:108701687-108701709 AACTCCAAAGTGAAATTCTCTGG 0: 1
1: 0
2: 0
3: 28
4: 265

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101889639 Original CRISPR TCTTATCTGTAAAAGGGGAA GGG (reversed) Intronic
900383884 1:2400388-2400410 TCCCATCTGTAAATGGGGAGCGG + Intronic
900845816 1:5099645-5099667 TGTCATCTTTAAAATGGGAAGGG + Intergenic
901234154 1:7658606-7658628 TCTTATCTGTAAAATGAGTCTGG + Intronic
901679429 1:10904579-10904601 TCTCATCTGTAAAATGGGCATGG + Intergenic
901776319 1:11562884-11562906 TCTCATCTGTAAAATGGGAGTGG + Intergenic
901809571 1:11759834-11759856 CCTCATATGTAAAAGGGGGATGG - Intergenic
902096321 1:13948857-13948879 TCATGTCTGTAACATGGGAAGGG - Intergenic
902259903 1:15217011-15217033 TCTTATCTTTATAGTGGGAAGGG + Intronic
902283816 1:15393456-15393478 TGCTATCTGTAAAAGGGTGAGGG + Intronic
902605671 1:17567943-17567965 TCTTGACTTTAAAAGAGGAAGGG + Intronic
902657397 1:17878798-17878820 CCTCATCTGTAAAATAGGAAGGG - Intergenic
902689452 1:18101123-18101145 CCTCATCTGTAAAATGGGACTGG - Intergenic
902708355 1:18221965-18221987 CCTCATCTGTAAAATGAGAAGGG - Intronic
902765163 1:18609496-18609518 TCTCATCTTTAAAAAGGAAATGG - Intergenic
903177178 1:21588082-21588104 TCCTATCTGTAAAATGGGGCCGG - Intergenic
903189016 1:21646054-21646076 CCTCATCTGTAAAATGGGGATGG + Intronic
903337727 1:22636146-22636168 TTTTATCTGTACACTGGGAACGG - Intergenic
903475137 1:23614316-23614338 CCTTATCTGTAAAATGGGCGTGG - Intronic
903497990 1:23784014-23784036 CCTCATCTGTAAAATGGGAATGG - Intronic
903817792 1:26077664-26077686 TCTCATCTGTAAAATGGGGATGG - Intergenic
903847790 1:26288807-26288829 CCTTATCTGTAAAACAGAAATGG - Intronic
903857795 1:26346844-26346866 TCTCATCTGTGAAATGGGCATGG + Intronic
903870169 1:26428309-26428331 TCTAATAGGTAATAGGGGAAGGG - Exonic
904008861 1:27378705-27378727 CCTCATCTGTAAAGGGGCAAGGG + Intergenic
904035194 1:27555296-27555318 CCTCATCTGTAAAATGGGAGGGG - Intronic
904054589 1:27661829-27661851 TCTGATCTGCAGAAGGGGTAGGG - Intergenic
904105793 1:28081669-28081691 TCTTATTTTGAAAAGGGGGAGGG + Intronic
904287768 1:29462972-29462994 TCTTACCTGTAAAGTGGGAGTGG + Intergenic
904330455 1:29754997-29755019 TTTCTTCTGTAAAATGGGAATGG + Intergenic
904371095 1:30047799-30047821 TCTTATCTGTAAAGTGGGAGCGG + Intergenic
904417292 1:30371168-30371190 TCCTATCTGTAAAGTGGGAGTGG - Intergenic
904890992 1:33779389-33779411 TGTCATCTGTAAAATGGAAATGG + Intronic
905032759 1:34898931-34898953 TCTCATCTTTAAAATGGCAATGG - Intronic
905206620 1:36346333-36346355 TCTCATCTGTAAAATAGGGATGG - Intronic
905444057 1:38013378-38013400 CCTCATCTGTATAATGGGAATGG - Intronic
905574678 1:39034375-39034397 TCTCATCTGTCAAAGGAAAATGG - Exonic
905582060 1:39089826-39089848 CCTTATCTATAAAAGGGAGATGG + Intronic
906635423 1:47406524-47406546 TCTCATCTGTAAATTGGGGATGG + Intergenic
906713535 1:47950842-47950864 TTTTATCTGCAAAAAGGCAATGG + Intronic
906834075 1:49064045-49064067 TCTGATTTGTAAAATGGGAATGG + Intronic
907044699 1:51293502-51293524 ACTGCTCTGTAAAATGGGAAAGG + Intronic
907073384 1:51557727-51557749 TCTCATCAGTAAAATGGCAACGG + Intergenic
907257350 1:53190045-53190067 CCTTATCTGTAAAAGGGAGATGG - Intergenic
907263835 1:53242202-53242224 TCTCATCTATAAAATGGGAGTGG + Intergenic
907281814 1:53352460-53352482 TGTTATCTCTAAAATGGGACTGG - Intergenic
907392799 1:54169212-54169234 GCTCATCTATAAAATGGGAATGG - Intronic
908321591 1:62983869-62983891 TCTCATCTGTAGAATGGGGATGG + Intergenic
908648921 1:66310835-66310857 TCTTATCTGTAAAATGGGGAAGG + Intronic
908811832 1:67989362-67989384 TCTCTTCTGTAAAATAGGAATGG - Intergenic
909484613 1:76159052-76159074 TCTTGTCCCTAAAATGGGAAAGG - Intronic
909622337 1:77682847-77682869 GCTTTTCTGTACAAGGGGAAAGG - Intronic
910043364 1:82881917-82881939 ACTTAGCTGTAAAAGAGGATGGG - Intergenic
910258601 1:85275020-85275042 TATTAGCTGTAAAATGGGAATGG + Intronic
910418703 1:87031253-87031275 TCTTATCTCCAAAATGGGATAGG + Intronic
910928398 1:92419150-92419172 TCTCATCTGTAAACTGGGGATGG + Intergenic
911327782 1:96489524-96489546 ACTTAACTGTCAAAAGGGAATGG - Intergenic
911498266 1:98656783-98656805 CCTCATCTGTAAAATGGGGATGG + Intergenic
911783015 1:101907777-101907799 TCTTTTTTGCAAAAGGCGAAAGG + Intronic
912149093 1:106834377-106834399 TTTTTTATGTGAAAGGGGAATGG + Intergenic
912324417 1:108744473-108744495 TCTCATATGTAAAATGGCAATGG + Intergenic
912466584 1:109878876-109878898 TCTCTTCTGTAAAATGGGAAGGG - Intergenic
912902075 1:113662139-113662161 TTTTACCTGTCAATGGGGAATGG - Intronic
913350198 1:117849889-117849911 TTTTCTCTGTAAAAGCAGAAAGG + Intergenic
913539664 1:119806574-119806596 TCTTCTCTGTACAATGGAAATGG - Intronic
915098148 1:153478582-153478604 TCTCATCTGTCAGAGGAGAAAGG + Intergenic
915632770 1:157164565-157164587 TCTTTTCTGTAAAGTGGGCATGG + Intergenic
915750074 1:158199031-158199053 TATTCTCAGTAAAATGGGAATGG - Intergenic
915885610 1:159717972-159717994 ACTTATGTTTAAAAGGGAAAGGG + Intergenic
916014973 1:160741865-160741887 TCTTATCTGTGAAATGGGATTGG + Intronic
917087639 1:171319557-171319579 TCTCACCTGTAAAATGTGAATGG - Intronic
917522851 1:175762445-175762467 TCTTATAAGTAAAAGTGGAAAGG - Intergenic
917911632 1:179653676-179653698 TCTTTTCTGCAAAAGAGAAAGGG + Intronic
918073510 1:181151447-181151469 TCTTATCTGTGAAATGGGAATGG + Intergenic
918324110 1:183393322-183393344 CCTCATCTGTAAAATGGGATTGG - Intronic
918458935 1:184755544-184755566 TCTCGTCTGCAAAAGGGGGATGG - Intergenic
918881582 1:190130829-190130851 TCTGGTCAGTAAAAGGGGCAGGG - Intronic
920501702 1:206489746-206489768 TCTCATCTATAAAATGGGGAGGG - Intronic
920634563 1:207687096-207687118 TCTAATCTCTAAAACAGGAATGG - Intronic
920712370 1:208307330-208307352 TCTCATCTGTAAAAGGGGCTTGG - Intergenic
920878670 1:209860183-209860205 TGCTATCTGTAAAATGGGGATGG + Intergenic
921307407 1:213810817-213810839 TCTTATCTGTAAAATGAGGATGG - Intergenic
921374331 1:214458575-214458597 TCTTATCTGTAAAATGGAGATGG - Intronic
921472550 1:215567134-215567156 TCTGAAATGTAAAAGGGAAAGGG + Intergenic
923779848 1:237012379-237012401 TCTCATTTGTAAAACGGAAAGGG - Intergenic
924219883 1:241863221-241863243 CCTCATCTGTAAAATGAGAATGG - Intronic
924588905 1:245384585-245384607 CCTTATCTTTAAAATGAGAATGG - Intronic
1063438039 10:6050331-6050353 CCTCATCCGTAAAATGGGAATGG + Intronic
1063470280 10:6278941-6278963 CCTTATCTGTAAAACGAGATAGG + Intergenic
1064055492 10:12093843-12093865 ACTTATCTATAAATCGGGAATGG - Intronic
1065263655 10:23952665-23952687 CCTAACCTGTAAAATGGGAATGG + Intronic
1065892813 10:30135553-30135575 TCTGATCTATAAAATGGGCATGG - Intergenic
1066244749 10:33571537-33571559 TCTTATTTTTAAAGGGGAAAGGG + Intergenic
1067897316 10:50197629-50197651 TCTCATTTGCAAAATGGGAATGG - Intronic
1067951656 10:50744391-50744413 TCTCATTTGCAAAATGGGAATGG + Intronic
1067989307 10:51192343-51192365 TCTTATCTGTAAAATAGAATGGG + Intronic
1068151176 10:53134144-53134166 ACTTATCTGTAAAATAGAAACGG - Intergenic
1069132925 10:64728617-64728639 TCTGATCTGTAAAATGGGGATGG + Intergenic
1069223695 10:65914646-65914668 TGTTAGCAGTAAAAGAGGAAAGG + Exonic
1069743864 10:70702569-70702591 TCTTATCTGTAAAATGGGACTGG + Intronic
1069831647 10:71285534-71285556 TCTCATCTGCGAAAGGGGCAGGG - Intronic
1070016476 10:72537602-72537624 TCTTATCAATAAAAAGGCAAAGG - Intronic
1070370986 10:75781798-75781820 TCTCATCTGCAAAATGGGAGTGG - Intronic
1070460397 10:76662241-76662263 CCTTATATGTCAAGGGGGAAAGG + Intergenic
1070695518 10:78560492-78560514 TCTTGACTGTAAAATGGGAGAGG + Intergenic
1070766431 10:79059235-79059257 CCTTATCTGTAAAGTGGGGATGG - Intergenic
1071729448 10:88233218-88233240 TCCAATCTGTAAAAGGGGAGGGG + Intergenic
1071782478 10:88861736-88861758 TCTCATCTGTTAAAAGGGGATGG - Intergenic
1072075900 10:91973568-91973590 TCTCATCTGCAAAACAGGAATGG - Intronic
1072162537 10:92781706-92781728 TCTTATCACTGAAACGGGAAAGG - Intergenic
1072483160 10:95829009-95829031 TGTTATCTATAAAATGGGCATGG - Intronic
1073189131 10:101637754-101637776 CCTTATCTCTAAAAGGAGGAGGG - Intronic
1073241882 10:102064720-102064742 CCTTATCTGTAAAAGGGACTAGG + Intergenic
1073799768 10:107028433-107028455 TCTTATCTGTAAAACCAGAGTGG + Intronic
1074102666 10:110365728-110365750 CCTCATCTGTAAAATGGGAATGG + Intergenic
1074226002 10:111484814-111484836 TCTCATCTGTAAAATGGGGGTGG + Intergenic
1074455982 10:113595414-113595436 TTTTATCTGCAAAATGGTAATGG - Intronic
1074596945 10:114876453-114876475 CCTTATCTGTAAAATGGGGATGG + Intronic
1074944284 10:118266149-118266171 CCTCATCTGTAAAATGGCAAAGG + Intergenic
1074957593 10:118407622-118407644 TGTTATGTGTATATGGGGAAGGG - Intergenic
1075712634 10:124538739-124538761 ACTTTTCTGTAAAATGGGATGGG - Intronic
1076021819 10:127080062-127080084 TCCTAGCTGTAAGAGGTGAATGG - Intronic
1076825757 10:132967120-132967142 TCTTATAAGTGAAATGGGAAAGG + Intergenic
1077240023 11:1505779-1505801 CCTTATCAGTAAAATGGGCAGGG - Intergenic
1077540077 11:3142518-3142540 CCTCATCTGTAAAAAGGGAGGGG - Intronic
1077829174 11:5845713-5845735 TCTAGTCTGTGAAGGGGGAAAGG - Intronic
1078107476 11:8367700-8367722 CCTCATCTGTAAAATAGGAATGG - Intergenic
1078349489 11:10580933-10580955 TCTCATCTGTAAAAGAGAGAGGG + Intronic
1078577846 11:12516811-12516833 TCTTATCTGTAAAACAGGGATGG - Intronic
1079129158 11:17737523-17737545 CCTTATCTGTAAAATGGGGGAGG + Intronic
1079285046 11:19121341-19121363 TCTGCTCTGAAAATGGGGAAGGG + Intronic
1079400301 11:20101613-20101635 CCTTCTCTGTAAAATGGGGATGG - Intronic
1079479667 11:20865998-20866020 TCTTTTCAGTAAAATGGGGATGG + Intronic
1079636491 11:22748259-22748281 TATTATCTGTAAAAGTGAGAGGG + Intronic
1079982067 11:27161728-27161750 TATTATCTATAAAAGGGAGATGG - Intergenic
1080036337 11:27715791-27715813 CCTCATCTGTAAAAGGTGATTGG + Intronic
1080302654 11:30801292-30801314 TCTCATCTGTAAAATGGAAATGG - Intergenic
1080594802 11:33762046-33762068 TATTATATGAAAAAGGTGAAGGG - Intronic
1080884323 11:36352516-36352538 TTTCATCTGTAAAGGGGAAAGGG - Intronic
1081655603 11:44855382-44855404 CTTTATTTGTAATAGGGGAAAGG + Intronic
1081782880 11:45725497-45725519 TCTTATAGGTAAACGGGGTAAGG - Intergenic
1081894192 11:46570578-46570600 TTTTGTCTGTAAAATGGGAGTGG - Intronic
1081942574 11:46956219-46956241 TCTAATAGGTAATAGGGGAAGGG + Intronic
1082790770 11:57345487-57345509 TCTCATCTGTCGAATGGGAATGG + Intronic
1083237937 11:61363847-61363869 TCTCATCTGTAAAATGGGGAAGG + Intronic
1083622857 11:64057536-64057558 TCTCATCTGTAAAATGGGCGTGG - Intronic
1083767286 11:64847674-64847696 CCTTGTCTGTAAAAGGGGGTTGG + Intergenic
1085008607 11:73118804-73118826 TCTCATCTGTAAAACAGAAATGG - Intronic
1085483839 11:76845154-76845176 TCTTATCTATAAAATGAGGATGG + Intergenic
1085708843 11:78811134-78811156 CCTTGTCTATAAAATGGGAATGG - Intronic
1085876924 11:80418754-80418776 CCTTGTCTGTAAAATGGGAAGGG + Intergenic
1085931511 11:81088857-81088879 TCTTATCTGTAAAACAGGAATGG + Intergenic
1086065257 11:82736946-82736968 CCTTATCTGAAAAAAGGGAATGG + Intergenic
1087707843 11:101515004-101515026 CCTTAACTGTAAAAATGGAAAGG + Intronic
1087789901 11:102394780-102394802 TGTCATCTGTAAAATGGGGATGG - Intergenic
1088119384 11:106350204-106350226 AATTATCTCGAAAAGGGGAAAGG + Intergenic
1088739797 11:112757885-112757907 TCTTCTCTGTAAAATGGGAATGG + Intergenic
1088782669 11:113151187-113151209 TCCTAAATGTACAAGGGGAATGG + Intronic
1088803713 11:113331651-113331673 TCTGATCTGAAAAAGGCCAAAGG + Intronic
1089637437 11:119824410-119824432 CCTCATCTGTAAAATGAGAATGG - Intergenic
1090562877 11:127951614-127951636 TCTTAAATTTAAAAGGAGAAGGG - Intergenic
1090564952 11:127979775-127979797 CCTTATCTATAAAGGAGGAAGGG - Intergenic
1091585351 12:1812849-1812871 CCTCATCTGTGAAACGGGAACGG + Intronic
1091645152 12:2267558-2267580 TCTCATCTGTAAAATGGGCATGG - Intronic
1091992266 12:4964957-4964979 TCTCATCTGTAAAATGGCACCGG - Intergenic
1092558753 12:9586817-9586839 TCCTTTCTGTAGAAGGGTAAGGG - Intergenic
1093096117 12:14974064-14974086 TGTAATCTTCAAAAGGGGAAGGG + Intronic
1093711836 12:22336186-22336208 TCTATCCTGGAAAAGGGGAAGGG + Intronic
1094023590 12:25940265-25940287 TCTTATCTGCAAAAACAGAAGGG - Intergenic
1094069816 12:26400874-26400896 CCTCATCTGTAAAATGGGGAGGG + Intronic
1094392008 12:29962002-29962024 ACTTAAATGTAAAAGGAGAAAGG - Intergenic
1094742842 12:33309760-33309782 TGATATCTTTAAAAGGGGAAGGG + Intergenic
1095355156 12:41263872-41263894 TATTATCAATACAAGGGGAAAGG - Intronic
1096098857 12:48956932-48956954 TCTTTTCTGTTAAAGGGCTAGGG - Intronic
1096882207 12:54682346-54682368 TCTTGGATGTAGAAGGGGAAGGG + Intergenic
1097581066 12:61457278-61457300 GCTTATGTGAAAAAGGGAAAAGG + Intergenic
1098351827 12:69570849-69570871 TCTTCTCTATAAAAGGGAAATGG + Intronic
1098457008 12:70685851-70685873 TCCTATCTGAAAAATGGGGAAGG - Intronic
1098598767 12:72304311-72304333 TCTTAATTGTAAATGAGGAAAGG + Intronic
1098604776 12:72376911-72376933 CCTTATCTGTAAAATGGGATTGG + Intronic
1098720454 12:73891147-73891169 TCTAATCTATAAAATGAGAATGG + Intergenic
1099201563 12:79683913-79683935 TTTTCTCTGTAAAGTGGGAAAGG + Intronic
1099496612 12:83354896-83354918 AATTATCTCTAAATGGGGAAAGG - Intergenic
1099849664 12:88076103-88076125 TCTTATCCCTAAATGGGGATAGG - Intronic
1100185386 12:92133382-92133404 TCTTGTCTGAAAAAGGAGAGAGG - Intronic
1100363318 12:93897650-93897672 TCTTATCTATAAAATAGAAAAGG - Intergenic
1100368541 12:93943767-93943789 TCTTGCCTGTAAAGGTGGAAAGG - Intergenic
1100459500 12:94785185-94785207 TCTAATCTGTAAAATGGAGATGG + Intergenic
1100820889 12:98428544-98428566 TCTTATCTCTAAAACGGGGATGG - Intergenic
1101347783 12:103902402-103902424 TCTCATCTGTAAAATGAGAATGG - Intergenic
1101438491 12:104684433-104684455 TATCATCTGTAAAAAGGGGATGG + Intronic
1101532385 12:105585505-105585527 TCCTGTCTGTGACAGGGGAAAGG + Intergenic
1101827537 12:108232235-108232257 TCTCATCTGTAAAATGGGTTGGG + Intronic
1101889639 12:108701663-108701685 TCTTATCTGTAAAAGGGGAAGGG - Intronic
1102199294 12:111046415-111046437 GTTCATCTGTAAAATGGGAATGG - Intronic
1102555104 12:113721808-113721830 TCTCATTTGCAAAAGGGAAATGG - Intergenic
1102725768 12:115063276-115063298 TTTTATTTGTAAAATGGGGATGG + Intergenic
1102856812 12:116301303-116301325 TATTATCTGTAAAAATGGAAAGG - Intergenic
1103079358 12:118011089-118011111 TCACATCTGTAAAATGGGCAGGG - Intergenic
1103236075 12:119373686-119373708 CCTTATCTGTAAAATGAGATGGG + Intronic
1103248958 12:119483421-119483443 CTTTATCTTTAAAAAGGGAAGGG + Intronic
1103446847 12:121000339-121000361 TCTCATCTGTAAAATGGGGGTGG - Intronic
1103594270 12:122014127-122014149 TCTTTTCTGTAAAAGGAGGGAGG + Intergenic
1104098947 12:125588228-125588250 CCTTATCTATAAAATGGGGATGG + Intronic
1104379586 12:128295434-128295456 TCTCATCTGTAAAATGGGGATGG - Intronic
1104496594 12:129246362-129246384 TCTTATGTGTAAAAGCAGAGCGG - Intronic
1104528717 12:129548848-129548870 TCTTGTTTGTAAAATGAGAAAGG - Intronic
1104656469 12:130577188-130577210 TCTCATCTGTAAAACAGGGATGG + Intronic
1104784021 12:131438273-131438295 TCCTCTCTGTCAAATGGGAATGG - Intergenic
1106327922 13:28711902-28711924 TCTCATCTGTAAAATGGGCGTGG - Intronic
1106606449 13:31233750-31233772 TCTAATCTTTAGAAGGGAAAGGG + Intronic
1106828758 13:33555201-33555223 TCTGATGTGAAAAAGAGGAATGG - Intergenic
1107303531 13:38993144-38993166 TCTCATCTGTAAAATGGGGATGG + Intergenic
1107583337 13:41816228-41816250 TCTCATCTGTAAAATGGGAACGG - Intronic
1108017820 13:46094836-46094858 TCAGATCTGGAAAAGGGCAATGG - Intronic
1108881612 13:55126772-55126794 TTTTAGCTGAAAAAGTGGAAGGG - Intergenic
1109147226 13:58794673-58794695 TCTGATCTATATAAGGGAAATGG - Intergenic
1109261234 13:60147423-60147445 ACTTATCTGATAGAGGGGAAGGG - Intronic
1109566757 13:64128007-64128029 TCTTATCTGTAAAAAGGATGTGG + Intergenic
1110105027 13:71662463-71662485 ACTCATCTGTAAAATGGAAATGG + Intronic
1110311626 13:74056763-74056785 TTCTATGTGTAAAAGAGGAATGG + Intronic
1110684205 13:78352432-78352454 TATTATCAGTAAAAGGAGGAAGG - Intergenic
1111861733 13:93715730-93715752 TCTCATGTGCAAAATGGGAATGG + Intronic
1112042079 13:95556593-95556615 TCTCATCTGTAAAACAGGGATGG - Intronic
1112262757 13:97892419-97892441 TCTCATCTGTAAAATGGATATGG - Intergenic
1112371928 13:98801930-98801952 TTTTATCAGTGAAAGGTGAAGGG + Intronic
1112818540 13:103302654-103302676 TTTCATCTGTAAAATGGGGATGG + Intergenic
1112985037 13:105438203-105438225 TCTAAACTGTAAAGGTGGAAGGG + Intergenic
1113135575 13:107085382-107085404 TATTATCTGGCAATGGGGAAGGG - Intergenic
1113546504 13:111154874-111154896 TCTTATCTGTAAACTGAGATGGG + Intronic
1114265850 14:21072041-21072063 TTTTTGCTGTAAATGGGGAAGGG - Intronic
1114411354 14:22503532-22503554 TCTCATCTGTAAAATGGGGATGG + Intergenic
1114539897 14:23447195-23447217 TCTTATCTGTAAAATGTGGATGG + Intergenic
1114839890 14:26251136-26251158 TCTTATCTATGAAATGGCAATGG - Intergenic
1115509636 14:34126974-34126996 TCTCATCTGTAAAATAAGAATGG - Intronic
1115960606 14:38832850-38832872 TCTTCTCTCTAAAGGGGAAAAGG + Intergenic
1115979567 14:39035382-39035404 TCTTATATTTAACATGGGAAAGG - Intronic
1116416954 14:44689772-44689794 TCTTATCTCTAAAAAGAGAGAGG + Intergenic
1116427648 14:44809888-44809910 ACTTATCTGGCAAAGTGGAAAGG - Intergenic
1116457391 14:45134918-45134940 TGTGATCTTTAAAAGGGAAATGG - Intronic
1116825604 14:49670527-49670549 TCCTATCTATAGAAGGGGGAAGG - Intronic
1117341869 14:54798573-54798595 CCTTGTCTGTAATAGGGTAAAGG - Intergenic
1117461057 14:55945222-55945244 TCTTACCTGGAAAAGAGGAAAGG - Intergenic
1117572241 14:57058908-57058930 TTTCATCTGTAAAATGGGCATGG - Intergenic
1118147784 14:63158583-63158605 TCTCATCTGTAAAATGGAAGGGG + Intergenic
1118553686 14:66987856-66987878 TCTTATTTTTAAAAGGAAAAAGG + Intronic
1118599371 14:67460968-67460990 TCTCATCTGTAAAATGGAGATGG - Intronic
1118608173 14:67518343-67518365 TCTCATCTGCAAAATGGAAATGG + Intronic
1119250062 14:73144643-73144665 TTTCATCTGTAAAAGGATAAAGG + Intronic
1119804224 14:77472055-77472077 TGTTATCAGTAAAATGGCAATGG - Intergenic
1120482365 14:85067148-85067170 TCTTAACTGAAAAAGAGGCATGG - Intergenic
1120599402 14:86482666-86482688 TCTCATCTGTAAAATGGAAATGG - Intergenic
1120657914 14:87217572-87217594 TCTTATCTGTAAAATAATAATGG + Intergenic
1121096920 14:91223853-91223875 GCTTATCTGTAAAATGGGGAGGG - Intronic
1121314036 14:92950563-92950585 CCTCATCTGTAAAACGGGAAGGG - Intronic
1121319856 14:92985894-92985916 TCCTATCTGTAAAATGGGGAGGG - Intronic
1121495632 14:94389898-94389920 CCCTATCTGTAAAATGGGGATGG + Intronic
1121642833 14:95497289-95497311 TCTCATCTGTAATATGGGGATGG + Intergenic
1121859372 14:97302203-97302225 TCTTATCTTTAAAATGAGAGAGG + Intergenic
1121921542 14:97886552-97886574 TTTTATTTGTAAAGGGGAAATGG + Intergenic
1122138518 14:99648328-99648350 CCTCATCTGTGGAAGGGGAAAGG - Intronic
1122189001 14:100025114-100025136 TCTTATCTTAAAAAGGAAAATGG - Intronic
1122591983 14:102860078-102860100 TCTTATCTCTCAGTGGGGAAGGG + Intronic
1122835492 14:104428697-104428719 TCCTCTCTATAAAATGGGAAGGG + Intergenic
1123762713 15:23445099-23445121 TCACATCTGTAAAATGGGGATGG - Intronic
1124334494 15:28846852-28846874 TCACATCTGTAAAATGGGGATGG - Intergenic
1124872925 15:33561481-33561503 TCTCCTCTGTAAAATTGGAATGG + Intronic
1125195750 15:37044103-37044125 TCTTATCTGTAGAATGGAGATGG - Intronic
1125751830 15:42034465-42034487 TCTTATCAGAGGAAGGGGAAAGG - Intronic
1126909725 15:53404907-53404929 TCTTATCTGTAAAATGCAGATGG + Intergenic
1127345657 15:58095220-58095242 TCTTATCTATAAAATGGTAATGG - Intronic
1128148664 15:65347371-65347393 TCTCATCTGTAAAATGGGAGTGG + Intronic
1128238206 15:66081677-66081699 TCTCATCTTTAAAGTGGGAAGGG - Intronic
1128619038 15:69133430-69133452 TCTCATCTGTAAAATAGGAGCGG + Intergenic
1128771149 15:70283459-70283481 TCTCATCTGTAAATGGGTAGCGG + Intergenic
1130154881 15:81341673-81341695 TCTTATCTTTAGAAGGTGGAGGG - Intronic
1130193896 15:81761268-81761290 TATTATCTGTAGAACGGGGATGG - Intergenic
1130867145 15:87942736-87942758 TCTCACCTGTAAAATGGGTATGG + Intronic
1130894636 15:88160520-88160542 TCTACTCTGGAAAAGGGGCAGGG - Intronic
1130926177 15:88387592-88387614 CCTTATCTGTAAAATGGGGATGG + Intergenic
1131230093 15:90653428-90653450 CCTTATCTATCAAATGGGAATGG - Intergenic
1131787588 15:95929635-95929657 TTTTATCTGTGAAGGGGGAAGGG - Intergenic
1131996952 15:98142554-98142576 TTATATTTGTAAAAGGGGCAAGG - Intergenic
1132323178 15:100942252-100942274 TCCTATCTGTGACAGGGGCAGGG + Intronic
1133668540 16:7994970-7994992 TCTGAACAGTATAAGGGGAACGG - Intergenic
1133683234 16:8140644-8140666 TCTCATCTGTCAAATGGGTAGGG + Intergenic
1133771029 16:8867327-8867349 CCTCATCTGTCAAAGGGGACAGG + Intronic
1133872795 16:9705227-9705249 CCTCATCTGTAAAAGGCGGATGG - Intergenic
1133921751 16:10159622-10159644 CCTCATCTGTAAAATGGGATTGG - Intronic
1134213596 16:12298500-12298522 TCTCATCTGTAAAATGGGAATGG + Intronic
1134351662 16:13443427-13443449 TGTTATCTATAAAATGGGGATGG + Intergenic
1134654209 16:15935042-15935064 TCTTTTCTGCAGAAGTGGAAAGG + Intergenic
1135458732 16:22622625-22622647 CCTCATCTGTAAAATGGCAAAGG - Intergenic
1135514419 16:23118135-23118157 TCTTTTCTGCAAAATGGGAATGG + Intronic
1136098649 16:27977131-27977153 TCTCATCTGTAAAATGGGAATGG - Intronic
1136145689 16:28315171-28315193 TCTCATCTGTAAATGGAGAGAGG - Intronic
1136454950 16:30375148-30375170 TCTCATTTGTAAAATGGGATGGG - Intronic
1136616181 16:31399873-31399895 TCATATCTGTAAAATGAGAATGG - Intronic
1137571666 16:49570332-49570354 TCTTATCTGTAAAATGGGGATGG - Intronic
1138121679 16:54405364-54405386 CCTCATCTGTAGAATGGGAAGGG + Intergenic
1138139833 16:54558644-54558666 CCTCATCTGTAAAATGGGGATGG + Intergenic
1138139987 16:54559801-54559823 CCTCATCTGTAAAATGGGGATGG - Intergenic
1138405795 16:56792986-56793008 TCTTACCTGTAAAATGGGGCAGG + Intronic
1138576379 16:57909897-57909919 CCTCAGCTGTAAAATGGGAATGG + Intronic
1138741821 16:59319756-59319778 CCTCATCTGTACAATGGGAATGG + Intergenic
1138835629 16:60431105-60431127 TCCTATCTGTAAAATGAGGAAGG - Intergenic
1138858532 16:60725751-60725773 TCTCATATGTAAATGGGAAAGGG + Intergenic
1138922105 16:61543765-61543787 CCATATCTGTAAAATGGGCATGG + Intergenic
1139779699 16:69340179-69340201 TCTTCTCACTAAAAGGGTAAAGG - Exonic
1140016501 16:71192043-71192065 CCTTATCTGTGATATGGGAAGGG - Intronic
1140653746 16:77117958-77117980 GATTAACTGTGAAAGGGGAAAGG + Intergenic
1140892486 16:79297087-79297109 TATTATCTGGAAAAGGTGACTGG - Intergenic
1140956358 16:79870120-79870142 CCTTAGCTGGAAAAGAGGAAAGG + Intergenic
1140971021 16:80012610-80012632 TCTTATTTGCAGAATGGGAATGG - Intergenic
1141261500 16:82458487-82458509 CCTTATCTGAAACTGGGGAAGGG - Intergenic
1141544664 16:84757032-84757054 TCTCATCTGTAAAATGGGGTTGG + Intronic
1141586127 16:85034775-85034797 TCTCATCTGTGAAATGGGGACGG - Intronic
1141613700 16:85198265-85198287 TCCTGGCTGTAAAAGGGGAGAGG + Intergenic
1141989163 16:87600701-87600723 TCTCATCTGTAAAATGGAGATGG - Intergenic
1142149662 16:88507051-88507073 TCCTATCTGTGAACGGGGAAGGG + Intronic
1142233712 16:88911597-88911619 TCTCATCTGTAAAATGGGAATGG + Intronic
1143389190 17:6550091-6550113 CCTTATCTGTAAAAGTGAAAGGG - Intronic
1143392374 17:6567297-6567319 CCTTATCTGTAAAATGGGAATGG - Intergenic
1143446597 17:7013649-7013671 CATTATCTGGAAAAGGGGAATGG - Exonic
1143790419 17:9290788-9290810 TCCTGTTTGGAAAAGGGGAAAGG + Intronic
1144036302 17:11369004-11369026 CTTCATCTGTAAAATGGGAATGG - Intronic
1144391264 17:14795561-14795583 TCTTGTCTGTAAAATGGAAATGG - Intergenic
1144950449 17:18990881-18990903 TCCTGTCTATAAAATGGGAAAGG - Intronic
1145868745 17:28256802-28256824 CCTAATCTGTAAAATGGGGATGG - Intergenic
1146134528 17:30307282-30307304 CCTCATCTATAAAATGGGAATGG - Intergenic
1146472275 17:33134191-33134213 TCTTATATGTAAAATGGGGATGG - Intronic
1146579708 17:34025982-34026004 TCTCATCTGTGAAATGGGTATGG + Intronic
1146594930 17:34160149-34160171 TCTCATCTGTAAAATGGGCTTGG - Intronic
1146950415 17:36901518-36901540 TCTTGTCTGTAAAATGGGGATGG - Intergenic
1147437734 17:40427978-40428000 TCTCATAGGTAAAAGGGGAGAGG + Intergenic
1147621500 17:41871085-41871107 TCTTATGGGTAAAAGGGCCAAGG - Intronic
1148340783 17:46872365-46872387 CCTAATCTGTAAAATGGGGACGG + Intronic
1148719064 17:49737730-49737752 TGTCAGCTGTAAAAGGGGATAGG + Intronic
1148737908 17:49875142-49875164 TCTCATCTGTAAAAATGGAATGG + Intergenic
1148849233 17:50546856-50546878 TCTCATTTGTAAAATGGGCAGGG + Intronic
1148867083 17:50634439-50634461 CCTCATCTGTAAAATGGGAAGGG - Intergenic
1148871550 17:50661399-50661421 TCTCATCTGTGACATGGGAATGG - Intronic
1148992809 17:51681191-51681213 TCTGATCTGCAAAATGGGTATGG + Intronic
1149279974 17:55092746-55092768 TTTTATGAGAAAAAGGGGAAAGG + Intronic
1150322541 17:64227782-64227804 TTTCATCTGTAAAATGGGAATGG + Intronic
1151306572 17:73266512-73266534 GCTCATCTGTAAAAGGGGTGAGG - Intergenic
1152501947 17:80717990-80718012 TCTTCTTTGCAAAAGGAGAAAGG + Intronic
1152625464 17:81386258-81386280 GCTCATCTGTAAAATGGGCATGG + Intergenic
1152996814 18:415213-415235 CCTTATCTGTAAAATGGAAACGG - Intronic
1154238853 18:12633061-12633083 TCTTATCTATAAAATGTTAATGG - Intronic
1156777292 18:40807505-40807527 TCTTATCAGTCAAAAGGAAAAGG + Intergenic
1157075219 18:44458527-44458549 TCTCCTCTGTAAAAGGCAAAGGG + Intergenic
1157380256 18:47208073-47208095 TCTTATCTATAAAATGTGGATGG - Intergenic
1158219819 18:55139109-55139131 TCTCAACTGTAAAATGGGCATGG + Intergenic
1159459417 18:68704926-68704948 TTTCATCTATAAAATGGGAAAGG + Intronic
1160140531 18:76317835-76317857 TCTTTACTGTAAAAGGAAAAGGG - Intergenic
1161043136 19:2120672-2120694 TCGCCTCTGTAAAGGGGGAATGG + Intronic
1161205828 19:3040919-3040941 GCTCATCTGGAAAAGGGGCATGG + Intronic
1161261801 19:3341872-3341894 TCCCATCTGTAAAATGGGACAGG + Intergenic
1161439389 19:4281902-4281924 CCTTGTCTGGAAAAGGGGAATGG + Intronic
1162143149 19:8596580-8596602 TCATAGCTGTAAAAGGAGACAGG + Exonic
1162198823 19:9006731-9006753 TCTCATCTATAAAACGGGGATGG + Intergenic
1162552064 19:11363627-11363649 CCTTATCTGAAAAATGGGGATGG + Intronic
1163087409 19:14992381-14992403 TCTTATCTGTAAAAGGGAGCTGG - Intronic
1163166012 19:15498832-15498854 TCTCAACTGTAAAATGGGAGTGG - Intronic
1163273386 19:16267547-16267569 TCTCATCTGTGAAATGGGGATGG + Intergenic
1163551742 19:17969357-17969379 TCCCGTCTGTAAAATGGGAACGG + Intronic
1164407506 19:27965164-27965186 TCTTATCTGTAAAATGGTGTTGG + Intergenic
1165043674 19:33087079-33087101 ACTTATCTGTAAAATAGAAATGG - Intronic
1166097921 19:40553055-40553077 TCTCATCTGTAAAATGGAGATGG + Intronic
1166164659 19:40978867-40978889 TCTCATCTGTAAAATGAGAATGG - Intergenic
1166516880 19:43453843-43453865 TCTCATCTATAAAATGGCAATGG - Intergenic
1166545244 19:43630585-43630607 TCTCACCTATAAAATGGGAATGG - Intronic
1166625868 19:44355639-44355661 GCTTATCTTTAAAATGGGAATGG + Intronic
1167006891 19:46782159-46782181 CCTCATCTATAAAATGGGAACGG - Intronic
1167688867 19:50973164-50973186 TCTTATCTGTAAAATGGGAGTGG - Intergenic
1167834869 19:52060294-52060316 CCCTGTATGTAAAAGGGGAAAGG - Intronic
1168243390 19:55098242-55098264 CCTTATCTGTCAAATGGGAATGG - Intronic
925494275 2:4428448-4428470 TTTTATTTGTAAAAGGAGAGTGG - Intergenic
925839613 2:7979321-7979343 TCTTGTCTGTAAAATAGGAATGG + Intergenic
926088500 2:10035142-10035164 TCTCATCTGTAAAATGGGGATGG - Intergenic
926404120 2:12532536-12532558 TCTCATTTGCAAAAAGGGAATGG + Intergenic
926416354 2:12653388-12653410 TCTTACCTATCAAAGAGGAATGG - Intergenic
926906189 2:17807821-17807843 TCTTATCAGTAAAACAGGATTGG + Intergenic
926920650 2:17936837-17936859 CCTCATCTATAAAATGGGAATGG - Intronic
927154723 2:20214946-20214968 TCTCATCTGTAAAATGTGCATGG - Intronic
927270220 2:21199455-21199477 TTTTGTTTGTAAACGGGGAAAGG - Intergenic
927503913 2:23601013-23601035 TCTTCTCTATAAAACGGGAATGG - Intronic
928052247 2:28011143-28011165 TGTTATCAGCAAGAGGGGAATGG + Intronic
928117858 2:28560404-28560426 TCTTATGTGTATAAGGTAAAGGG + Intronic
928130497 2:28645684-28645706 CCTTCTCTGTAGAAAGGGAATGG - Intergenic
928266559 2:29817047-29817069 TGTCCTCTGTAAAAGAGGAATGG - Intronic
929036326 2:37695463-37695485 TAGTATCAGTAAATGGGGAATGG - Intronic
929042498 2:37759139-37759161 TTTCATCTGTAAAAGGGAAATGG - Intergenic
930857985 2:56039572-56039594 TCTAATATGTTAAAGTGGAAGGG + Intergenic
931119731 2:59202974-59202996 TCTTATCTATAAAAGCTCAAAGG + Intergenic
931188096 2:59973284-59973306 CCTCATCTGTAAAATGGGGATGG - Intergenic
931218496 2:60267696-60267718 GCGCATCTGTAAAATGGGAATGG + Intergenic
931486150 2:62694708-62694730 CCTCATCTGTAAAATGGGAATGG - Intronic
931964771 2:67521240-67521262 GCTTATTTGAGAAAGGGGAAAGG + Intergenic
932834747 2:75025876-75025898 TCTCATCTGTAATATGGGGATGG + Intergenic
932909992 2:75796191-75796213 TCTCATCTGTAAAATAGGAATGG - Intergenic
932951981 2:76304582-76304604 CCTTATCTGTAAAATGGTAGTGG - Intergenic
933094353 2:78159560-78159582 TCATCTCTGTAAAAGGAGTAGGG + Intergenic
933220446 2:79681461-79681483 TCTTTCCTGTAATATGGGAATGG + Intronic
933266589 2:80187517-80187539 TGTTTTCTGTAAAAAAGGAAAGG - Intronic
933863014 2:86488843-86488865 TCTCAACTGTAAAAGAGGAGGGG - Intronic
933876704 2:86627061-86627083 TATTATCTATAAAATGGGATAGG + Intronic
934934439 2:98454449-98454471 TCTCATCTGTAAAATGGGGAAGG + Intronic
935080281 2:99786247-99786269 CCTCATCTGTAAATGGGGACTGG + Intronic
935359272 2:102233674-102233696 TCTCATCTGTAAAATGGGGATGG + Intronic
936434011 2:112487641-112487663 TCTCATCTGTAAAATGGGGATGG + Intronic
936459207 2:112699724-112699746 TCTGAAGTGTAAAAGTGGAATGG + Intergenic
936834682 2:116694299-116694321 TCTTATCTATGAAAGGGGAAGGG + Intergenic
937355519 2:121195924-121195946 TCTCATCTGTAAAATGGAACTGG - Intergenic
937850227 2:126625794-126625816 TCTTATCTGACACATGGGAAGGG + Intergenic
937959779 2:127448361-127448383 TCTTATCTGTAGAAGAACAATGG - Intronic
938270782 2:129968797-129968819 TCTCATCTGAAAAACAGGAATGG + Intergenic
938615362 2:132992120-132992142 CCTTATCTGTAAAATGGGAAAGG - Intronic
939055095 2:137355794-137355816 CCTTCTCTGTAAAGTGGGAATGG + Intronic
939069237 2:137518943-137518965 TCCTCACTGGAAAAGGGGAAAGG + Intronic
939154783 2:138511922-138511944 TCTCTTCTGTAAAATGGAAATGG + Intronic
940144842 2:150534800-150534822 TCTCATCTATAAAATGGGTAGGG - Intronic
940391159 2:153134095-153134117 TCTTAACTGTCAAAACGGAAGGG - Intergenic
940868518 2:158840103-158840125 TGTTAGCTGGAAAATGGGAAAGG - Intronic
940888361 2:159011101-159011123 TCTCATCTGTAAAATGGGGATGG - Intronic
941399635 2:165014922-165014944 TCCTATCTGGAAATGGGAAAAGG - Intergenic
941419761 2:165268724-165268746 TCTTATCTGTAGATGAGGAACGG + Intronic
941576670 2:167241192-167241214 TCTTGTCTATAAAAATGGAATGG + Intronic
942368891 2:175259336-175259358 CCTTACCTGTAAAATGGGAATGG - Intergenic
942873344 2:180762760-180762782 TCTTGTCTATAAAATGGGAATGG + Intergenic
943081659 2:183264530-183264552 TCTAATAGGTAATAGGGGAAGGG - Intergenic
943333334 2:186586506-186586528 TCTTATCTATGAAAGGGAAAGGG - Intergenic
944134501 2:196383953-196383975 ACTCATCTGTAAAATGGCAATGG + Intronic
944483018 2:200176468-200176490 TATTATTTTTAAAAGGAGAAAGG + Intergenic
944991588 2:205243481-205243503 TCTCATCTGTAGAATGAGAATGG + Intronic
945209063 2:207363777-207363799 TCTGCTCTGAAAAAGGGAAAAGG + Intergenic
945497486 2:210526485-210526507 TCTTATCTGTAAAAGAGAGAAGG + Intronic
945949708 2:216027162-216027184 TCTTATTGGTAAAATGTGAACGG + Intronic
946140168 2:217683474-217683496 TCTTGTCTGAAAAAGGGTAAAGG - Intronic
946413039 2:219525000-219525022 GCTCATCTGTAAAAGGGGAATGG - Intronic
946541221 2:220686651-220686673 ACTTATCTGTGAAAAGGGAAGGG - Intergenic
946616001 2:221510949-221510971 TCATATATGTATAAAGGGAATGG + Intronic
946679571 2:222199119-222199141 TCTCATCTGTACAAAAGGAATGG + Intergenic
946746881 2:222854946-222854968 TCTTATCTGTAAAGGAGGCTGGG - Intergenic
946867368 2:224054281-224054303 TCTTATCTGACAAGGGGGACTGG - Intergenic
947418050 2:229918932-229918954 TTTTATCTGTAAAATGGGAGTGG - Intronic
947806553 2:232972615-232972637 TTTGATCTGTAAAATGGGTATGG + Intronic
948504723 2:238421019-238421041 TCCTATGTGGAAAAGGGGAGAGG + Intergenic
948515563 2:238501313-238501335 TCTTATCTTTAAAATTAGAAGGG + Intergenic
948623905 2:239255401-239255423 TCTTAGCTGTCAAAGGAAAAAGG - Intronic
948710491 2:239822096-239822118 TCTTCTCTGTGCAAGGGGCACGG - Intergenic
1168807581 20:681468-681490 TCTTGTCTGTCAAATGGGAATGG + Intergenic
1168939475 20:1696473-1696495 TCCCATCTGTAAAAGGGCATTGG + Intergenic
1168966223 20:1899804-1899826 GCTCATCTGTAAAAGAGGAATGG + Intronic
1169072554 20:2742249-2742271 TCTCATCCGTAAAGTGGGAATGG + Intronic
1170077742 20:12438287-12438309 TCTCATTTGTGAAAGGGTAAAGG + Intergenic
1170532200 20:17305281-17305303 GCTTTTCTGAAAAAGGGGACAGG + Intronic
1171432544 20:25092267-25092289 TTTTGTCTGCCAAAGGGGAAAGG + Intergenic
1171436637 20:25129918-25129940 CCTTGTCTGTAAAATGGAAATGG + Intergenic
1171451816 20:25241045-25241067 TATTAGCTATAAAAGGGAAAAGG - Intergenic
1172049848 20:32109168-32109190 TCCCATCTGTGAAATGGGAAGGG - Intergenic
1172116802 20:32577879-32577901 CCTCATCTGGAAAATGGGAATGG - Intronic
1172563978 20:35913829-35913851 TCTTATCAGAAAAAGAGGAGAGG + Intronic
1172662932 20:36579742-36579764 CCTTATCTGTAAAGGGGCAGGGG + Intronic
1172807644 20:37624116-37624138 TCTCATCTGCAAAATGGGATTGG - Intergenic
1173212891 20:41050682-41050704 TGTCATCATTAAAAGGGGAATGG - Intronic
1173348770 20:42225395-42225417 TCTCATCTGTAAAATGGGAATGG - Intronic
1173664176 20:44753384-44753406 CCTTGTCTGTAAAATGGAAATGG + Intronic
1173702585 20:45086018-45086040 TCTGATCTGTAAAATGGGGCTGG + Intergenic
1173798095 20:45876649-45876671 TCTTATCTTTATAAGGGGTGGGG + Intronic
1173871141 20:46342910-46342932 GCTTATCTGTAGAATGGGGACGG + Intergenic
1174169702 20:48608361-48608383 TCTCATCTGCAATAGGGGACTGG + Intergenic
1174187728 20:48719078-48719100 TCCCATCTGTAAAATGGGCATGG - Intronic
1174365464 20:50053726-50053748 TCTCATCTGTAAAATGGGGATGG + Intergenic
1174911515 20:54612915-54612937 TCTCCTTTGTAAAATGGGAAGGG + Intronic
1175300362 20:57938575-57938597 CTTTATCTGTAAAATGGGGATGG + Intergenic
1175334781 20:58188152-58188174 TATTATCTTAAAAAGGAGAAGGG + Intergenic
1175693779 20:61085830-61085852 TCTCATCTATAAAATGGGGAGGG - Intergenic
1178161247 21:29918373-29918395 TCTTGTCTGTAAAATGAGATTGG - Intronic
1178248696 21:30979789-30979811 CCTTATCTGTAAAATGGGCATGG + Intergenic
1178294792 21:31400613-31400635 CCTTATCTGTAAAATGGGGTAGG - Intronic
1178412819 21:32379664-32379686 TCTCATCTGTAAAATGGGTGTGG - Intronic
1178600151 21:33987710-33987732 TCCCAGCTCTAAAAGGGGAATGG - Intergenic
1179009715 21:37546851-37546873 TCCTATCTATAAAACGGGAATGG - Intergenic
1179593578 21:42427569-42427591 TCAGATCTGTAAAATGGGTAGGG - Intronic
1180742123 22:18061117-18061139 TCTGATCTGGAAAAGGGGCAGGG + Intergenic
1181690757 22:24558525-24558547 TCTCATCTGTAAAATGGGGGTGG + Intronic
1181723142 22:24791529-24791551 TCCCATCTGTAAAATGGGATGGG - Intergenic
1181758871 22:25043939-25043961 TCTTGTCTGTAAAAGGGACTAGG + Intronic
1181762825 22:25069639-25069661 TCCTCTCTGTAAAATGGGGATGG + Intronic
1181802777 22:25358261-25358283 CCTCATCTGTGAAAGAGGAAGGG - Intronic
1181956086 22:26589189-26589211 CCCCATCTGTAAAAGGGGAAGGG + Intronic
1181997758 22:26896240-26896262 TCTCATGTGTAAAATGGGAATGG - Intergenic
1182047309 22:27285413-27285435 CCTCATCTATAAAATGGGAAGGG - Intergenic
1182052093 22:27321140-27321162 CCTCATCTGTAAAATGGAAATGG + Intergenic
1182068488 22:27446693-27446715 TCTCATCTGTAAGATGGGGATGG + Intergenic
1182096282 22:27628110-27628132 TTTCATCTGTAAAATGGGGATGG - Intergenic
1182893251 22:33836753-33836775 TTTTATCTGTAAAATAGGGATGG + Intronic
1183255156 22:36757211-36757233 CCTCATTTGTAAAAGGGGGATGG + Intergenic
1183406966 22:37634950-37634972 TCCTTTCTGGAAAAGGGGAGAGG + Intronic
1183622664 22:38983562-38983584 TCTCCTCTGTAAGATGGGAATGG + Intronic
1184565052 22:45286858-45286880 TCTCTTGTGTAAAATGGGAAAGG - Intronic
1203294687 22_KI270736v1_random:30633-30655 TTTCATCTGTAAAAGGGAAATGG - Intergenic
949239128 3:1849083-1849105 ACTTATCTATAAAATGGGAGTGG - Intergenic
949484507 3:4524873-4524895 TCTCACCTGTAAAATGGGAGAGG + Intronic
949729669 3:7093727-7093749 TCTTAAATGTAAAAGAGCAAAGG - Intronic
950364246 3:12471817-12471839 TCTTATCTGTGAAAGGAAAGGGG + Intergenic
950454786 3:13086210-13086232 TCCTATATGGAAAATGGGAAAGG + Intergenic
950521382 3:13499949-13499971 CCTCATCTGTAAAATGGGGATGG + Intronic
950771016 3:15311253-15311275 TCTTATCTGTAAACTCGGGATGG - Intronic
951214264 3:20008822-20008844 TCTTATCTGTAAAATGCACAAGG + Intronic
951600803 3:24372701-24372723 TCCTGTCTGTAAAATGGGGATGG - Intronic
951742428 3:25939226-25939248 TCTTATCACTAAAGGGGAAAGGG - Intergenic
951950633 3:28196709-28196731 TACAATCTGTAAAAGGGGAATGG + Intergenic
952986575 3:38790767-38790789 CATTATCTGTAAAATGGGGATGG + Intronic
953355685 3:42254611-42254633 TATTATTTGTAAAATGGGAGTGG + Intergenic
953741839 3:45545121-45545143 CCCTATCTGTAAAATGGGATGGG + Intronic
955133919 3:56197249-56197271 CAGTATCTGTAAAATGGGAATGG + Intronic
955146555 3:56325788-56325810 TCTCATCTGTAGAAAGGGGATGG - Intronic
955210994 3:56940874-56940896 TCTTATCTGCAAAATAGGTATGG - Intronic
955432923 3:58868548-58868570 TCTCCTCTGTAAAATGGGAATGG - Intronic
955730363 3:61978979-61979001 CATTATCTGTAAAATGGGGAAGG + Intronic
955852217 3:63232706-63232728 CCTAGTCTGTAAAACGGGAATGG + Intronic
955959815 3:64328711-64328733 TGTTATCTGTAAAATGGGAAGGG - Intronic
956041648 3:65151387-65151409 CATTAACTGCAAAAGGGGAATGG + Intergenic
956326403 3:68057493-68057515 TCTAATGTATAAAAAGGGAAAGG - Intronic
956343255 3:68249550-68249572 TGTTATCAGTAAAAGGGGAATGG + Intronic
956482275 3:69685146-69685168 CCATATCTGTAAAATGGGAATGG + Intergenic
956542742 3:70361028-70361050 TCTTATCTGTAATACAGGGATGG - Intergenic
956986406 3:74706424-74706446 TCTCATCTGCAAAATGGGAAGGG + Intergenic
957194228 3:77047314-77047336 CCTTACCTGTAAAATGGGCATGG + Intronic
958778670 3:98515292-98515314 TCTTATTTCTAATAGGGGGAAGG + Intronic
958902132 3:99899819-99899841 TCTCATCTGTAAAATGGGAATGG + Intronic
958974287 3:100648744-100648766 TCTTATTTGTAAAATATGAAAGG - Intronic
959361596 3:105400873-105400895 TCCCATCTGTAAAATGGGGAAGG + Intronic
959537846 3:107507296-107507318 TCTCATCTGTAAATTGGGAGTGG - Intergenic
960335207 3:116409417-116409439 TTTCATCTTTAAAAGGGAAATGG - Intronic
960574498 3:119216861-119216883 CCTCATCTGTAAAATGGCAATGG + Intronic
961190019 3:124952197-124952219 TCTTATCTGTAAAATAGGACTGG + Intronic
961203794 3:125065048-125065070 TCTTATCTGTAAAATATGAACGG + Intergenic
961535496 3:127568137-127568159 CCTCATCTGTAAAATGGGATAGG + Intergenic
961792445 3:129385876-129385898 TCTTGTCTGTGAAAAGGGATTGG + Intergenic
961816059 3:129550982-129551004 TCTTATCTGTAAGATGGGGATGG - Intronic
961818226 3:129562047-129562069 TCCCATCTGTAAAATGGGGAGGG + Intronic
961935719 3:130581374-130581396 TCTAACCTGTAAAAGTGTAAGGG - Intronic
962070359 3:132027329-132027351 TCTTATCTGGAAAATGGGAGGGG + Intronic
962786147 3:138769871-138769893 TCTTATCTTTAAAATGGGTAGGG - Intronic
963233031 3:142928005-142928027 CCTTATCTGTAAACTGGGGATGG + Intergenic
963607279 3:147421855-147421877 GCTGGTCTCTAAAAGGGGAAAGG + Intronic
964339175 3:155690235-155690257 TCTCATCTATAAAAGGAGAGTGG + Intronic
964573931 3:158143313-158143335 TCTTTTCTTTAAAAGTGGAAAGG - Intronic
965400458 3:168206818-168206840 TCTCATCTTTAAGATGGGAATGG + Intergenic
965840328 3:172897689-172897711 TGTTATCTGCAAATAGGGAAGGG + Intronic
966167987 3:177042705-177042727 TCTTATGTGTAAAATGAGATGGG - Intronic
967079658 3:186037718-186037740 TATTAACTGTAAGAGGGGATTGG + Intergenic
967490047 3:190079866-190079888 TCTCATCCATAAAAGGGGACAGG + Intronic
967834369 3:193948549-193948571 TCTCATCTGGAAAATGGCAATGG + Intergenic
967925005 3:194639119-194639141 TCCTTTCTGTAAAAGGAGGAAGG + Intergenic
968283925 3:197497128-197497150 TCTCATCTGTAAAAGAGGGGAGG + Intergenic
969148926 4:5151781-5151803 TCTCATCTGTAAAATGGAAAGGG + Intronic
969241909 4:5904528-5904550 CCTTATCTGTAAAATGGGTGTGG - Intronic
969943364 4:10757475-10757497 TCTCATCTATAAAATAGGAATGG + Intergenic
970073905 4:12195901-12195923 ACTTATATTTAAAAGGGGAGGGG - Intergenic
970359612 4:15295726-15295748 TCAGATCTGTAAAATGGGAATGG + Intergenic
970373907 4:15436751-15436773 TGTTAACTCTAAAAGAGGAAGGG + Intronic
970383482 4:15532030-15532052 TCACATCTGTAAAATGGGTATGG - Intronic
970560355 4:17276170-17276192 CCTCGTCTGTAAAATGGGAAGGG + Intergenic
971167855 4:24202826-24202848 TCTTTTCTGAAATAGGGGCAGGG - Intergenic
971181688 4:24334272-24334294 TCTCATCTATAAAATGGGAAAGG - Intergenic
972654332 4:41050372-41050394 TCTCATCTGTAAAATGGGGATGG - Intronic
973158812 4:46991730-46991752 CCTTATCTGTAAAGTGGGGATGG + Intronic
973194508 4:47424330-47424352 CCTTATCTATAAAATGGGGATGG + Intronic
973668846 4:53192664-53192686 TCTTATCTACAAAATGGGGATGG + Intronic
973801560 4:54483457-54483479 TCCCATCTGTATAACGGGAAAGG - Intergenic
973991200 4:56409170-56409192 GTTTATCTGTAAAATGGGCATGG - Intronic
974046548 4:56903504-56903526 TTTTATATGTAAAAGGAGACAGG - Intergenic
974907882 4:68079665-68079687 TTTGAACTGTAAAAAGGGAAAGG - Intronic
975512785 4:75211783-75211805 TCTCCTCTGTAAAATGGAAAAGG + Intergenic
975684797 4:76909086-76909108 TCTTATTTGTGAAAAGGTAAAGG - Intergenic
975824939 4:78309486-78309508 TCCTATCTGGAAAATGAGAATGG - Intronic
975997422 4:80332356-80332378 GCTTATTTTTAAAATGGGAAAGG + Intronic
976614536 4:87063041-87063063 TCTTTTCTGTAAAATAGCAATGG + Intronic
978475976 4:109130537-109130559 TTTTATCAGTAAAAAGGGGAAGG + Intronic
978840928 4:113210632-113210654 GCTTATCTGTAAAACAGGTAAGG + Intronic
979353218 4:119670423-119670445 CCTTGTCTGTAAAATGAGAATGG + Intergenic
979465250 4:121029940-121029962 TCTCATTTGTAAAATGAGAAGGG - Intergenic
980283236 4:130749615-130749637 TCTTATTAGTAAAAGGTGAGGGG + Intergenic
981411104 4:144433723-144433745 TCTTATCTGTAAAATGGGAATGG - Intergenic
981576241 4:146208738-146208760 TCTCATCTGTAAAGTGGAAATGG + Intergenic
982849950 4:160300689-160300711 TCATAACTGTAAAAGGGCAAGGG - Intergenic
983068356 4:163238151-163238173 TATTTTCTGTAAAATGGTAATGG + Intergenic
983369846 4:166843358-166843380 TGTTATCTGGCAAAGGTGAAGGG + Intronic
983380752 4:166989950-166989972 TCTTATAAGTAGAAAGGGAAGGG + Intronic
984408985 4:179371085-179371107 TATTATATGGAAAAGGTGAAGGG - Intergenic
985139572 4:186825337-186825359 TCTCATCTGCAAAATGGGAGTGG + Intergenic
986172183 5:5324105-5324127 TCTGCTCTGTAAAATGGGATTGG - Intergenic
987072776 5:14353593-14353615 TCTCATCTATAAAATGGGCATGG - Intronic
987096354 5:14554097-14554119 TCTTGTCTGTTAAGGGGGAAGGG + Intergenic
988297598 5:29385974-29385996 TCTCATCTGTTAAATGGCAAGGG + Intergenic
988550697 5:32198291-32198313 TTGTCTCAGTAAAAGGGGAAAGG + Intergenic
988704734 5:33713940-33713962 TCTTATCTGTAAAAGAAGGTTGG - Intronic
989127643 5:38072612-38072634 CTTCATCTGTAAAAGGGGGAGGG + Intergenic
989151377 5:38303050-38303072 TCTTCTCTATGAAATGGGAATGG - Intronic
989288460 5:39732201-39732223 TTTTATCTATAAAAAGGGAATGG + Intergenic
989344393 5:40412772-40412794 TCCCATGTGTAAAATGGGAAAGG + Intergenic
989718956 5:44502283-44502305 TCTGATCTGCAATAGGGGAAGGG - Intergenic
990358406 5:54994224-54994246 TCCTATCCCTCAAAGGGGAAAGG - Intronic
990510629 5:56486400-56486422 CCTCATCTGTAAAATGGGGAGGG - Intergenic
990626014 5:57612351-57612373 TCTAATTTGTAAAATGGGAAGGG - Intergenic
990770824 5:59242771-59242793 CCTTATCTATAAAGGAGGAAAGG - Intronic
991006850 5:61836434-61836456 TCTCATCTTTAAAATGAGAAAGG + Intergenic
991298597 5:65105773-65105795 TCTTATCTCTCCAAGGGGAGAGG + Intergenic
991439543 5:66632448-66632470 TCCTAGCTGTGAAATGGGAATGG + Intronic
991490188 5:67175163-67175185 TCTCATCTATAAAATGGGAATGG - Intergenic
991950506 5:71943015-71943037 TCTTATCTGTAAAATGCATAGGG - Intergenic
991972763 5:72156893-72156915 CCTCATCTGTAAAAGGGCAGTGG - Intronic
992197991 5:74358349-74358371 CCTTATCTGTAATGTGGGAATGG + Intergenic
992743003 5:79792616-79792638 TCTCATCTGTTAAAGGGGAGAGG + Intronic
992918377 5:81483536-81483558 TCTTACCTGTAAAATAGGAGTGG - Intronic
992930733 5:81642006-81642028 TATTATCTGGAATAGGGAAAAGG + Intronic
993336367 5:86664624-86664646 GCTTATCTGTAAAATGGAAGAGG + Intergenic
993526904 5:88976157-88976179 TGTTACCTGTAAAAGGGGCATGG + Intergenic
993820423 5:92608161-92608183 TTTAATCTGTAAAATGGGGATGG + Intergenic
993822591 5:92637707-92637729 TCTTTTCTATAAAATGGGATAGG + Intergenic
994939372 5:106301813-106301835 TCATATCATTAAAACGGGAATGG + Intergenic
995035381 5:107528134-107528156 TGTCATCTGCAAAATGGGAATGG + Intronic
995110299 5:108421414-108421436 AGTTTTCTGGAAAAGGGGAAGGG + Intergenic
996118494 5:119645374-119645396 TATTTTCTATAAAAGGGGAGGGG - Intergenic
996531034 5:124527201-124527223 TCTTATGTGTAAAAATGGAATGG - Intergenic
996824442 5:127665403-127665425 CCTCATCTGTAAAATGGGCATGG + Intergenic
996864161 5:128100320-128100342 CCTTATATGAAAAATGGGAAAGG + Intronic
997047564 5:130337165-130337187 TATTAACTGGAAAAGGAGAAAGG - Intergenic
997079590 5:130722765-130722787 TCTTACCAGTAAATGGGGGAAGG + Intergenic
997423425 5:133786898-133786920 TCTTATCTGTGAAATGAGAATGG - Intergenic
997503271 5:134395511-134395533 TCTTGTTTGTAAAGGTGGAAAGG - Intergenic
997880213 5:137582615-137582637 TCTCATCTATAAAATGGGAATGG - Intronic
998377691 5:141702168-141702190 TCTTAGCTGTAAAATGGGCACGG + Intergenic
998390566 5:141784576-141784598 CCTTATTTTAAAAAGGGGAAAGG - Intergenic
998516954 5:142764976-142764998 CCTTACCTGTAAAATGGGGATGG + Intergenic
999220430 5:149971734-149971756 TTTTATCTGTAAAAGACAAAAGG + Intronic
999276133 5:150331287-150331309 TCTTATCTGTAAACAGAGTAGGG - Intronic
999530638 5:152459515-152459537 ACTTAGCTGCAAAAGAGGAATGG - Intergenic
999768781 5:154758991-154759013 TCTTATACTTAAAAGGGGTATGG - Intronic
999861278 5:155649299-155649321 CCTCATCTGTAAAATGGGGATGG + Intergenic
1000171966 5:158711505-158711527 TCTCATCTGTAAAATTGGGAAGG - Intronic
1000281529 5:159786561-159786583 TCCCACCTGTAAAATGGGAATGG + Intergenic
1000961777 5:167609205-167609227 TGTTATCTGTACAATGGGTATGG - Intronic
1001019115 5:168167810-168167832 TCTTATCTGTAAAATAGGCATGG + Intronic
1001301674 5:170538081-170538103 TCTCATCTTTAAAATGGGAAAGG - Intronic
1001489376 5:172144852-172144874 CCTCATCTGTAAAAGGGGGTGGG - Intronic
1001728012 5:173924119-173924141 ACTTATCTGTAAGATGGGAGAGG - Intronic
1001752091 5:174139250-174139272 TCTCATCTGTAAAATGGGAATGG + Intronic
1001775750 5:174327960-174327982 CCTTATCTGTAAAAATGGGACGG + Intergenic
1002093616 5:176818284-176818306 CCTCATCTGTAAAACGGGAATGG - Intronic
1002758266 6:181277-181299 TCTCCTGTTTAAAAGGGGAACGG + Intergenic
1002811985 6:639626-639648 TCTTCCCTGCAAAAAGGGAAGGG + Intronic
1003047475 6:2747042-2747064 TCTTACTTGTAAATGGAGAAGGG - Intronic
1003075602 6:2981332-2981354 TCTCATATGTAAGAGGAGAAAGG - Intergenic
1003343488 6:5243961-5243983 TCTTATTTTTTAAAAGGGAAAGG + Intronic
1003534410 6:6963767-6963789 TCTTATTTTTAAAAAGGGGAGGG - Intergenic
1004533319 6:16475071-16475093 TCTCATCTATAAAAGGAGTAGGG - Intronic
1005005283 6:21281742-21281764 AGCTATCTGTAAAAGGGGGAGGG - Intergenic
1005663713 6:28027059-28027081 TCTTATCTGTGAAATAGGCATGG - Intergenic
1006135464 6:31893130-31893152 TCTCATCTGTAAAATGGAAAAGG - Intronic
1006387313 6:33738575-33738597 TCTCATCTGTAAAACGGGGCTGG - Intronic
1006590814 6:35155558-35155580 TCTTATATGTAAAATGGTGAAGG - Intergenic
1006808926 6:36807345-36807367 CCTCCTCTGTAAAATGGGAATGG + Intronic
1007366823 6:41400014-41400036 TCTTATCTGTTATTGTGGAATGG - Intergenic
1007918019 6:45579262-45579284 CCTCATCTGTAAAATGGGGATGG - Intronic
1007960280 6:45952660-45952682 CCTTATCTGTAAAAATGGAGTGG + Intronic
1008055605 6:46942516-46942538 TCTTATGTGTAAAAGAGAGACGG + Intronic
1008608849 6:53167236-53167258 TCTTTTCTGCAAAAATGGAATGG + Intergenic
1008979317 6:57464896-57464918 TCTTATCTGAAAAAGAGGGACGG - Intronic
1009749553 6:67866353-67866375 TTTTGTTTGTAAAAGGGAAAGGG + Intergenic
1010066905 6:71693145-71693167 TGATATCTGGCAAAGGGGAATGG - Intergenic
1010084998 6:71906753-71906775 TCTTATTTGTGAAATGGGGATGG + Intronic
1010392109 6:75349572-75349594 ACTTTTCGGGAAAAGGGGAAGGG + Intronic
1010515713 6:76770681-76770703 TCTTATCTGTAGAAGAGGAAAGG - Intergenic
1010715649 6:79226347-79226369 TCTCATATGTAAAATGAGAACGG + Intronic
1010952659 6:82055565-82055587 TCTAATCTGTAAAATGGGGTTGG - Intergenic
1011128608 6:84032842-84032864 TCTCATCAGTAAAATGGAAATGG + Intergenic
1012666658 6:101979429-101979451 ACTTATCTGTTAAAGGTGGAAGG + Intronic
1012862141 6:104572521-104572543 CCTCATCTGTAAAATGGGTATGG + Intergenic
1012952317 6:105531480-105531502 TCTCATCTATAAAATGGGAATGG - Intergenic
1013193852 6:107828088-107828110 CCTTATCTGTAAGATGGGAATGG - Intergenic
1013545588 6:111153810-111153832 TCTTATCTTTGTAAGGAGAAAGG - Intronic
1013878257 6:114861225-114861247 TATTATCTGTAAAATTAGAAAGG + Intergenic
1014631986 6:123799757-123799779 TCTTATTTATAAAATGGGAGGGG - Intergenic
1015576822 6:134680591-134680613 TCTCATCTGTAGAATGGGCAAGG - Intergenic
1015744350 6:136493929-136493951 TCATGTCTGTAAAATGGGGAAGG + Intronic
1016123374 6:140370999-140371021 TTTTATGTGTAAAAGTAGAATGG - Intergenic
1016558324 6:145366075-145366097 TCATATCTGGAAAAGGGGGTGGG + Intergenic
1017241482 6:152174608-152174630 TCTTCTCTCTAACAGGGAAAAGG + Intronic
1018021783 6:159767935-159767957 CCTTACCTGTAAACTGGGAATGG - Intronic
1018078262 6:160235390-160235412 TCTTATCTGTCAGTGGGGAATGG - Intronic
1018271258 6:162080552-162080574 TCTTATGTCTAAAACGAGAATGG + Intronic
1018575488 6:165255588-165255610 TCTTATATGTGTCAGGGGAAGGG - Intergenic
1018771236 6:166973140-166973162 CCCTGTATGTAAAAGGGGAAAGG + Intergenic
1018975118 6:168558563-168558585 TCTCATCTTTAAAATGGTAATGG + Intronic
1019561405 7:1660510-1660532 TGTCACCTGTAAAAGGGGGAAGG + Intergenic
1019567459 7:1691515-1691537 CCTCATCTGTAAAATGGGCAGGG + Intronic
1019682037 7:2355617-2355639 TCTTTCCTGAAAAAGGGGACAGG + Intronic
1019854252 7:3588110-3588132 CCTTACCTGTAAAACGAGAATGG - Intronic
1019984542 7:4646250-4646272 TCTTATCTGTAAGTGGAGATGGG + Intergenic
1020129623 7:5552346-5552368 TCTCATCTGTAAAATGGGGTGGG + Intronic
1021260055 7:18444452-18444474 TCTTGTAAATAAAAGGGGAAAGG + Intronic
1021459907 7:20874807-20874829 TCTCATCTATAAAATGGGGATGG - Intergenic
1021712651 7:23431440-23431462 AAGTATCTGTAAAAGTGGAAAGG + Intronic
1021982319 7:26066889-26066911 CCTCATCTGTAAAATGGGGATGG - Intergenic
1022283423 7:28933204-28933226 TCTCATCTGTGAAAGGGGTTAGG - Intergenic
1022495163 7:30848526-30848548 GCTTATCAGAAAAAGGAGAAAGG - Intronic
1024189618 7:46992920-46992942 TCTAACATGTAAAGGGGGAATGG + Intergenic
1024474089 7:49792288-49792310 TTTTATCTGTAAAATGAGGATGG - Intronic
1025753743 7:64314538-64314560 TTTTATTTTTAAAAGGAGAAAGG - Intronic
1026020105 7:66699388-66699410 TCTCATCTGTAAAATGGGAGTGG + Intronic
1026865877 7:73823731-73823753 TCTCATCTCTAAGATGGGAATGG + Intronic
1027227406 7:76252782-76252804 TCTCATCTGCAAAATGGAAAGGG + Intronic
1028566534 7:92238842-92238864 TCACATCTATAAAATGGGAATGG - Intronic
1028745700 7:94323991-94324013 CCTCATCTGCCAAAGGGGAAGGG - Intergenic
1029676362 7:102071841-102071863 TCTCATCTGTAAAATGGAACAGG + Intronic
1029790300 7:102836430-102836452 TCTTATCTGTAGGGGGGAAATGG - Intronic
1030676410 7:112390379-112390401 CCTCATCTGTAAAATGGGGATGG + Intergenic
1030697646 7:112603681-112603703 CTTTATCTGTAAAATGGGGATGG - Intergenic
1030941650 7:115658331-115658353 TCTTCTCTGTAATGTGGGAAAGG + Intergenic
1031085211 7:117295801-117295823 TCTTATCTGTACAATGGAGAAGG + Intronic
1032458118 7:132088665-132088687 TTTTATCTGTAAAGGGACAAGGG + Intergenic
1032698481 7:134358289-134358311 TCTCATCTGTAAAATGGGGATGG + Intergenic
1037237533 8:16738802-16738824 TCATATCAGTTAAAGGGGATGGG - Intergenic
1037744412 8:21631398-21631420 CCTCATTTGTAAAATGGGAATGG + Intergenic
1038041508 8:23727604-23727626 TTTCATCTGTAAAATGGGACTGG - Intergenic
1038467045 8:27773933-27773955 TATTATTTGTAAAATGGGAATGG + Intronic
1038664676 8:29527983-29528005 TCTTATCTGTAAAGTGGGAAAGG + Intergenic
1039559972 8:38504935-38504957 TCTTATCTGTGAAAGAGGGATGG + Intergenic
1040008556 8:42641730-42641752 TTTTCTCTGTGAAAGAGGAAAGG - Intergenic
1041438811 8:57871545-57871567 CCATATCTGTAAAAAAGGAATGG + Intergenic
1041984622 8:63907559-63907581 TCTTACCTGCAAAATGGGTATGG - Intergenic
1042125565 8:65534371-65534393 TCTTATGTCTAAAATGAGAATGG - Intergenic
1043268931 8:78304105-78304127 CCTTATCAGTAAAATGGGGATGG + Intergenic
1043528484 8:81122947-81122969 CTTTATCTGTAAAATGAGAATGG - Intergenic
1043813906 8:84777954-84777976 TCTTATCTGTAAAATGCGAGAGG + Intronic
1044019573 8:87087833-87087855 CCTCATCTGTAAAATGAGAAAGG - Intronic
1044097301 8:88082557-88082579 TCTTCTGTGTAAAAGAGGATGGG + Intronic
1044110498 8:88267241-88267263 TCTCAACTGTAAAATGGCAATGG - Intronic
1044350841 8:91164707-91164729 TATCATCTGTAAAATGGAAATGG - Intronic
1044843722 8:96360135-96360157 CCTGATCTGTAAAATGGGGAGGG - Intergenic
1044954852 8:97469418-97469440 CCTCATCTGTAAAATGGGGACGG + Intergenic
1045177055 8:99736886-99736908 TCTCATCTGTAAAATAAGAATGG - Intronic
1045259334 8:100558804-100558826 CCTTATCTGTATAATGGAAATGG + Intronic
1046041856 8:108915195-108915217 TTTTATCTGTTAGAAGGGAATGG + Intergenic
1046437897 8:114217509-114217531 TCTTATTTTTAAAAAGGAAACGG + Intergenic
1047301927 8:123620935-123620957 TCCCATCTGTAGAATGGGAATGG + Intergenic
1048070386 8:131014732-131014754 TCTCATATGTTAAATGGGAATGG + Intronic
1048200031 8:132364914-132364936 GTTTGTCTGTAAAAGGAGAAAGG - Intronic
1048264525 8:132973936-132973958 TCTGATCTGGAAATGTGGAAGGG + Intronic
1048468248 8:134685177-134685199 TCTCCTCTGTAAAAAGGGGATGG - Intronic
1048472940 8:134719562-134719584 TTTCATCTGTAAAAGGGCACTGG + Intergenic
1048569937 8:135643810-135643832 CCTTATCTGTCAAATGGGTATGG + Intronic
1048580391 8:135725655-135725677 CCTTCTCTGTAAAGTGGGAACGG - Intergenic
1048677401 8:136798974-136798996 TCTCATCTCTAAAAGGAGAGAGG + Intergenic
1048781788 8:138009464-138009486 TTTAATCTGTAAAATGGGAATGG - Intergenic
1048851802 8:138652448-138652470 TCTGATCTGCAAATGGGGCAAGG - Intronic
1048973923 8:139660795-139660817 TCCCATCTGGAAAATGGGAATGG - Intronic
1049944793 9:583276-583298 TTTTATCTGTAAAAGAGGAATGG + Intronic
1050088746 9:1994171-1994193 TTTAATCTGTAAAACGTGAAAGG - Intergenic
1050459662 9:5866880-5866902 CCTCATCTGTAAAATGGGACTGG + Intergenic
1050969458 9:11850692-11850714 TCTTAATTGTAAAAATGGAAAGG + Intergenic
1051405009 9:16727582-16727604 TCTTAAAAGAAAAAGGGGAAAGG - Intronic
1051708150 9:19902155-19902177 TCTAAACTGCAAAAAGGGAAGGG + Intergenic
1051764530 9:20508276-20508298 TTTTCTTTATAAAAGGGGAAGGG - Intronic
1052354990 9:27494840-27494862 TCTTATGTGGAATAGGGGGAGGG - Intronic
1052502619 9:29311733-29311755 TATTATCTGTAAAAATGAAAAGG - Intergenic
1052676852 9:31637277-31637299 TATCATCTGTAAAACAGGAATGG - Intergenic
1053020814 9:34692659-34692681 CCTTATTTGTAAAATGGGAATGG + Intergenic
1053350269 9:37409390-37409412 CCTTATCTGTAAGATGGGGATGG + Intergenic
1053419479 9:37968276-37968298 ACTTATCTGTAAAATGGGGATGG - Intronic
1053481131 9:38417368-38417390 TCTCATCTGTGAAATGGGGATGG - Intronic
1054828796 9:69600352-69600374 CCTCATCTGTAAAATGGGAGTGG + Intronic
1055349226 9:75368496-75368518 TCTCATCTTTAAAAAGGGAGAGG + Intergenic
1055568711 9:77594655-77594677 TGTTGTCTCTAAAAGGTGAAAGG + Intronic
1055585658 9:77756812-77756834 CCTTATCTGTAAAATGAGAAGGG + Intronic
1056012917 9:82351408-82351430 TATCATCTGTAAAATGGGGATGG + Intergenic
1056444587 9:86653537-86653559 TCCTATCTGTAAAATAGGTATGG - Intergenic
1056763315 9:89429403-89429425 TCTTAGCTGCAAAAGAGGGATGG - Intronic
1057073019 9:92116395-92116417 CATTATTTGTAATAGGGGAAAGG - Intergenic
1057184990 9:93052520-93052542 TCCCATCTGTAAAATGGGGATGG + Intergenic
1057774271 9:97993247-97993269 CCTTCTCTGTAAATGGGGGAAGG + Intronic
1057824918 9:98365018-98365040 TCTCATTTGTAAAATGGGCAGGG + Intronic
1058054701 9:100437466-100437488 TCTTATCTGGGAAATGGGAATGG + Intronic
1059480486 9:114585614-114585636 TCTTATGTGTAAAAGAGGCAAGG + Intergenic
1059694344 9:116716497-116716519 TCCCATCTGTAGAATGGGAATGG + Intronic
1059728174 9:117029379-117029401 ACTTATCTGGAGAAGGGCAATGG - Intronic
1059788643 9:117615628-117615650 CCTAATCTGTAAAATGGGAATGG - Intergenic
1059923316 9:119181469-119181491 TCTTATCTGTCAAATGGGGAAGG + Intronic
1059925412 9:119204514-119204536 CTTTATCTGTAAAATAGGAATGG + Intronic
1060153742 9:121304735-121304757 TCTCATCTGTAAAATGGAATGGG - Intronic
1060292340 9:122315461-122315483 TGTTTTCTGTAAAAAGGGATTGG + Intronic
1060392756 9:123291901-123291923 TCTCATCTGTAAAATGTGCAGGG - Intergenic
1060568921 9:124619702-124619724 CCTTATCTGTAAAATAGGGAGGG + Intronic
1060571240 9:124642365-124642387 TATTATCTATAAAATGGGGATGG + Intronic
1060583595 9:124772047-124772069 CCCTATCTGTAAAAGGGGGTTGG + Intergenic
1060825718 9:126686793-126686815 GCTCATCTGTAAAATGGGAATGG + Intronic
1061456705 9:130703677-130703699 TTTGATCTGAAAAAGGGAAAAGG - Exonic
1061884417 9:133584371-133584393 TCTTATCTGTACAATGGGTGTGG + Intronic
1061889566 9:133610699-133610721 GCCCATCTGTAAAAGGGAAATGG - Intergenic
1062231411 9:135484093-135484115 CCTTCTCTGTAAGAGGGGAGAGG - Intronic
1185935323 X:4250018-4250040 TTTCATCTGTAAAATGGGGAGGG + Intergenic
1187248764 X:17577855-17577877 TCTCATCTTTAAAAAGGGATAGG + Intronic
1187849803 X:23580555-23580577 TCTTTACTCTAAAAGGGGAAGGG + Intergenic
1188055449 X:25535769-25535791 TCTTATCAGAAAAACAGGAATGG - Intergenic
1188295434 X:28441757-28441779 TCTCATCTTTAAAACGAGAATGG - Intergenic
1188682305 X:33025944-33025966 ATGTATCTTTAAAAGGGGAAGGG + Intronic
1189033902 X:37476957-37476979 CCCTATCTATACAAGGGGAAGGG - Intronic
1190441024 X:50474429-50474451 TCTCATCTGTTAAAGGGTAGGGG - Intergenic
1192151723 X:68716955-68716977 TCCTATCTGTAAAATTGGAAGGG + Intronic
1192157936 X:68760283-68760305 CCTCATCTGTAAAATGGGGATGG + Intergenic
1193843060 X:86433058-86433080 CCTAATCTGTAAAATGGGGATGG + Intronic
1194051760 X:89078082-89078104 TCTTATCTGTCAGTGGGGAGTGG + Intergenic
1195216420 X:102708503-102708525 TAGTATCTGTGAAAGGGGTAAGG - Intergenic
1195767770 X:108314777-108314799 TCCTATCTGTAAAATGAGGATGG + Intronic
1195768466 X:108321909-108321931 TTTTATCTGTAAAATGATAATGG - Intronic
1196141651 X:112269294-112269316 GCTGATTTGTAAAATGGGAATGG - Intergenic
1196602219 X:117615449-117615471 TTTTACCTGGAAAAGGGGTAAGG - Intergenic
1196794295 X:119489877-119489899 CCTCATCTGTAAAATGGGGAGGG + Intergenic
1196919218 X:120568743-120568765 TCTTATCTGTACAGTGGGGATGG - Intronic
1197721736 X:129749897-129749919 CCTTATCTGTAAAATGGGATGGG + Intronic
1197793827 X:130280588-130280610 CCCTGTATGTAAAAGGGGAAAGG - Intergenic
1198420651 X:136468315-136468337 TCTCACCTGTAAAATGGGGATGG - Intergenic
1199058133 X:143321472-143321494 TCTTATCTATCAAAGGAGGAGGG + Intergenic
1199540545 X:148953444-148953466 TCCTATCTATAAAATGGGAACGG + Intronic
1199562161 X:149174371-149174393 CCTTATCTGTAAAACAGGAAGGG + Intergenic
1199748879 X:150795479-150795501 CCATCTCTCTAAAAGGGGAAGGG + Exonic
1199760451 X:150900183-150900205 TCTCATGTGTCAAAGGGGGAGGG + Intergenic
1200829525 Y:7677781-7677803 TTTTATCTGTAAAAGGGGATGGG - Intergenic
1200987991 Y:9324644-9324666 TTTTGTCTATAAAAGGGGATGGG - Intergenic
1201017699 Y:9623093-9623115 TTTTGTCTGTAAAAGGGGATGGG - Intergenic
1201955696 Y:19619944-19619966 CCTTATGTGTAAAAGGGCTATGG - Intergenic
1202109243 Y:21404571-21404593 TTTTATCTGTAAAAGGGGATGGG - Intergenic
1202120032 Y:21511548-21511570 TTTTGTCTATAAAAGGGGATGGG + Intronic
1202122483 Y:21535089-21535111 TTTTGTCTATAAAAGGGGATGGG + Intronic
1202156522 Y:21894294-21894316 TTTTGTCTATAAAAGGGGATGGG - Intronic
1202158970 Y:21917835-21917857 TTTTGTCTATAAAAGGGGATGGG - Intronic
1202185419 Y:22182750-22182772 TTTTGTCTATAAAAGGGGATGGG - Intronic
1202197442 Y:22309033-22309055 TTTTGTCTATAAAAGGGGATGGG + Intronic
1202205940 Y:22403645-22403667 TTTTGTCTATAAAAGGGGATGGG + Intronic
1202379793 Y:24266373-24266395 TCTTATCTGTAAAGCTGGAAGGG - Intergenic
1202490989 Y:25403748-25403770 TCTTATCTGTAAAGCTGGAAGGG + Intergenic