ID: 1101889895

View in Genome Browser
Species Human (GRCh38)
Location 12:108703844-108703866
Sequence CAGGAGGAACAAGGGGCTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 924
Summary {0: 1, 1: 0, 2: 7, 3: 112, 4: 804}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101889895 Original CRISPR CAGGAGGAACAAGGGGCTGG AGG (reversed) Intronic
900371887 1:2335913-2335935 CAGGAGGAAGCTGGGGCTCGGGG - Intronic
900372888 1:2340113-2340135 CAGGAGGAAACAGGGCCTGTGGG - Intronic
900515715 1:3081356-3081378 CAAAGGGAACGAGGGGCTGGTGG + Intronic
900534381 1:3169776-3169798 CGGGGGGAACCAGGGGCTGCGGG - Intronic
900645747 1:3707923-3707945 CAGGAGGAGCATCGGGCAGGAGG + Intronic
900668952 1:3837474-3837496 CAGAACGAGCGAGGGGCTGGAGG + Exonic
900728687 1:4236609-4236631 CACCAGGATCAAGGTGCTGGCGG - Intergenic
900782752 1:4628745-4628767 GGGGAGGAACAAGGCCCTGGGGG + Intergenic
900875664 1:5340819-5340841 CAGCAGGAACAAAGGGCAGCAGG + Intergenic
900932853 1:5747710-5747732 GAGGAGGAAGAAGGAGATGGAGG + Intergenic
900973584 1:6004836-6004858 CTGGAGGGAGACGGGGCTGGAGG - Intronic
900989422 1:6091505-6091527 AAGGAGGAACGAGGGGATGGGGG - Intronic
901462007 1:9397621-9397643 CGGGAGGAACAAGGGCCTTACGG + Intergenic
901859980 1:12068182-12068204 CAGAAGGAAAATGGGGCTGAAGG + Intronic
901884105 1:12210747-12210769 CAGGAGGAAGTAGGGGTGGGGGG - Intergenic
902037251 1:13466859-13466881 AAGGAGGACCAAGGGGCTGAAGG + Intergenic
902225838 1:14996058-14996080 CCAGAGGCAGAAGGGGCTGGGGG - Intronic
902330942 1:15731024-15731046 CAGGGTGAAGAAGGGCCTGGGGG - Intronic
903221020 1:21869815-21869837 CAGGAGGAACAAGAGGGCAGTGG - Intronic
903234989 1:21944381-21944403 AGGAAGGAACAAGGGACTGGGGG - Intergenic
903566981 1:24275010-24275032 CAGGAAGTACAAGGGATTGGGGG - Intergenic
903669710 1:25028219-25028241 GAAGAGGAAGAAGGGGCTGGGGG - Intergenic
903767600 1:25744598-25744620 TAGGAGGAAGATGAGGCTGGAGG - Intronic
903857185 1:26344280-26344302 TAGGAGGAGCGAGGGGCTCGTGG + Exonic
904065374 1:27746055-27746077 TTGGAGGAAAAAGGGACTGGGGG + Intronic
904375846 1:30081983-30082005 GAGGAGGAACAAGAGGAGGGAGG - Intergenic
904439330 1:30520072-30520094 GAGGAGGACTGAGGGGCTGGGGG - Intergenic
904679021 1:32215957-32215979 CCTGAGGAACAAGCTGCTGGAGG - Exonic
904895124 1:33811388-33811410 CAGGAGGACCAAGGGGGTCACGG - Intronic
905541506 1:38763937-38763959 CAGCAGGTACAAAGGCCTGGTGG - Intergenic
905866244 1:41378342-41378364 TGGGAGGAACACGGGGCTGGGGG + Intronic
905966513 1:42102957-42102979 CTGGAGACACAAGGAGCTGGGGG + Intergenic
906536118 1:46551844-46551866 GAGGAGGAAGAACGAGCTGGTGG + Intergenic
907184317 1:52598188-52598210 CAGCAAGTACAAGGGCCTGGAGG - Intergenic
908539881 1:65112187-65112209 GAGCAGGAACAAGGGGGTGGGGG + Intergenic
908681191 1:66663224-66663246 CAGGAGTAAAAAGTGGGTGGGGG - Intronic
908733268 1:67248921-67248943 CAGGAAGCACAAGGGGCTGGGGG - Intronic
908793961 1:67812803-67812825 CAAGAGGCACAAGTGGCTGGTGG + Intronic
909301110 1:74014540-74014562 CAGGAAGCACAAGGGGTTGGGGG + Intergenic
909807947 1:79894533-79894555 CAGGAAGTGCAAGGGGTTGGGGG - Intergenic
911339297 1:96617791-96617813 CAGGAAGTGCAAGGGGTTGGGGG - Intergenic
911700813 1:100949948-100949970 CAGGAAGTGCAAGGGGTTGGGGG - Intronic
912417201 1:109517585-109517607 AAGCAGGGGCAAGGGGCTGGGGG + Intergenic
912587687 1:110781408-110781430 ATCGAGGACCAAGGGGCTGGAGG - Intergenic
912801586 1:112722923-112722945 CAGCAGGGAGGAGGGGCTGGAGG + Intronic
912963845 1:114219676-114219698 TAGGGGCAAGAAGGGGCTGGAGG + Intergenic
913051326 1:115119326-115119348 GAGCAGGACCAAGGGGTTGGGGG + Intergenic
913076415 1:115344059-115344081 AAGGAAGATGAAGGGGCTGGAGG - Intergenic
913450284 1:118988284-118988306 CCCGAGGAACAGGGGGCAGGCGG + Intronic
913512458 1:119574056-119574078 CAGGAAGCACAAGGGGTTGGGGG + Intergenic
913519686 1:119632694-119632716 CAGGAGGAATAGGGTGGTGGTGG - Intronic
914749308 1:150522669-150522691 CAGTAGTCACAAGTGGCTGGTGG - Intergenic
915912709 1:159924526-159924548 CAGGAGGCACAGGGCGCGGGGGG + Intronic
916406330 1:164501023-164501045 CTGGAGGAACAGGTGGCTGTGGG + Intergenic
916973380 1:170048724-170048746 CAGGAAGTGCAAGGAGCTGGGGG + Intronic
917006988 1:170426355-170426377 CAGGAAGTGCAAGGAGCTGGGGG + Intergenic
917111799 1:171556358-171556380 CAGGAAGCACAAGGGGTGGGGGG - Intronic
917529785 1:175824300-175824322 CAGGATGAATAAGGGCATGGAGG - Intergenic
917743653 1:177986208-177986230 CAGGAAGCACAAGGGGTCGGGGG + Intergenic
917904026 1:179572002-179572024 CAGGAAGCACAAGGGGTCGGGGG - Intronic
919436746 1:197572124-197572146 CGGGAAGCACAAGGGGTTGGGGG + Intronic
919823118 1:201485232-201485254 CAGGAGGCCCAAGGGGGTAGGGG - Intronic
919895118 1:202004830-202004852 CAAGAGGAACAAAGGCTTGGAGG + Intronic
920107392 1:203563623-203563645 CAGGAGGAGAAGGGGGCTGAGGG - Intergenic
920694328 1:208170414-208170436 CAGGGGGAAGCAGGGGCGGGTGG + Intronic
921351652 1:214242331-214242353 CAGGAGGAAGAAGGTGGGGGAGG - Intergenic
922189807 1:223308332-223308354 GAGCAGGAACAAGAGGGTGGGGG - Intronic
922342442 1:224668802-224668824 GAGGGGGAACCTGGGGCTGGGGG + Intronic
922657735 1:227400863-227400885 CTGGAGCAACATGGGGCTTGAGG + Intergenic
922984973 1:229859351-229859373 CATGAGGCACTAAGGGCTGGAGG - Intergenic
923225105 1:231931937-231931959 CAGGTGGGACCAGGGGTTGGTGG - Intronic
923679661 1:236109405-236109427 CAGCAGCCACATGGGGCTGGCGG + Intergenic
923853355 1:237820405-237820427 CAGGAAGCACAAGGGGTTGGGGG + Intronic
923855100 1:237837854-237837876 GAGGTGGAACCAGTGGCTGGAGG + Intergenic
924721720 1:246629234-246629256 CAGAAAGAACATGGGGTTGGAGG - Intronic
924775423 1:247112188-247112210 GAGGAGGGCCCAGGGGCTGGAGG + Exonic
924788147 1:247219423-247219445 CAGGAAGATCAAGGGGCAGCAGG + Intergenic
924805026 1:247355101-247355123 CAGGAAGATCAAGGGGCAGCAGG + Intergenic
1062778746 10:180927-180949 CATGAGAAACTAGGGGATGGGGG - Intronic
1063253348 10:4298850-4298872 CAGGAGGAACAGGGTGAAGGGGG - Intergenic
1063450223 10:6145659-6145681 CAGGAGGCAACTGGGGCTGGGGG - Intronic
1063499069 10:6536877-6536899 CAAGAGGAAGGAGAGGCTGGAGG + Intronic
1063710793 10:8476038-8476060 CAGGAGGAACTGGGGTATGGAGG - Intergenic
1063945555 10:11172684-11172706 AAGGAGGAAGAAGGGGAAGGAGG + Intronic
1064272701 10:13879764-13879786 GAGGAGGAAGAAGGGGAAGGAGG - Intronic
1064414343 10:15135808-15135830 CAGGAGCAACGAGGGGATGAAGG + Intronic
1064478717 10:15719402-15719424 CAGGGGAGAGAAGGGGCTGGTGG + Intronic
1065121057 10:22530717-22530739 CAGGAAGTGCAAGGAGCTGGAGG - Intergenic
1065231077 10:23599047-23599069 CAGGAAGCACAAGGGGTTGGGGG - Intergenic
1065306861 10:24377370-24377392 GAGGAGGAAGCAGGGGATGGTGG - Intronic
1065444109 10:25780047-25780069 AAGCAGGAGCAAGGGGTTGGGGG + Intergenic
1065701490 10:28430186-28430208 CAGGCAGAAAAAGGGGCAGGCGG + Intergenic
1065865628 10:29912828-29912850 GAGCAGGAGGAAGGGGCTGGGGG - Intergenic
1065963866 10:30755048-30755070 CAGGAGGAGCACAGGGATGGAGG - Intergenic
1066088443 10:31994123-31994145 AAGCAGGAACAAGAGGCTGAGGG + Intergenic
1066965812 10:42263722-42263744 CGGGAAGCACAAGGGGTTGGGGG - Intergenic
1067201118 10:44172860-44172882 CATGAAGAAGCAGGGGCTGGCGG - Intergenic
1067236450 10:44454459-44454481 CGGGAAGCACAAGGGGTTGGAGG - Intergenic
1067710940 10:48650845-48650867 CAGGAGAAAATAGGGGGTGGGGG - Intronic
1067850654 10:49751793-49751815 CTGGAGGGCCAAGTGGCTGGAGG - Intronic
1068210077 10:53909714-53909736 CAGGAAGCAAAAGGGGTTGGGGG + Intronic
1069622444 10:69846248-69846270 CTGGATGAAGAAGGGTCTGGTGG + Intronic
1069957448 10:72060702-72060724 CAGGAGAAAGAGGGGACTGGGGG + Exonic
1070043142 10:72802168-72802190 CAGGAGGCACATGGTTCTGGAGG + Intronic
1070112527 10:73498877-73498899 CAGGATGAACAATGGGAGGGTGG + Exonic
1070120160 10:73568255-73568277 CAGGAGGACCCAGGTGCTGATGG + Intronic
1070148544 10:73791836-73791858 CTGTGGGAACAAGGGGCAGGAGG - Intronic
1071698517 10:87903782-87903804 CAGGAAGCACAAGGGGTCGGGGG - Intronic
1072038607 10:91586800-91586822 TAGGTTGAACATGGGGCTGGGGG - Intergenic
1072394345 10:95023435-95023457 CAGGAAGCACAAGGGGTTGGGGG - Intergenic
1072564767 10:96608289-96608311 CAGAAGGAGCAAGGGACAGGTGG - Intronic
1072621362 10:97081557-97081579 CAGAAGAAAGAAGGGGCTGGAGG + Intronic
1072930247 10:99656234-99656256 CAGGAGGGGCATGGGTCTGGGGG + Intergenic
1073998155 10:109339567-109339589 CAGGAAGCACAAGGGGCCGGGGG - Intergenic
1074631488 10:115259551-115259573 CGGGAAGCACAAGGGGTTGGGGG - Intronic
1074945836 10:118279625-118279647 CAGGGGGAACAAGGTGCTTTAGG + Intergenic
1075483294 10:122800155-122800177 CAGGAGGGACTGGGGGCAGGAGG + Intergenic
1075690471 10:124390521-124390543 CAGGAGAGAGTAGGGGCTGGTGG + Intergenic
1075844582 10:125535137-125535159 CTGCAGGAACAGGGGGCAGGTGG + Intergenic
1075978801 10:126719649-126719671 GAGGAGGAACCATGGGCAGGAGG + Intergenic
1076003140 10:126928203-126928225 CAGGTCGAATAAGGGCCTGGAGG + Intronic
1076159224 10:128229516-128229538 CAGGAAGCACAAGGGGTTAGGGG - Intergenic
1076383420 10:130040196-130040218 CAGCAGGGACTGGGGGCTGGGGG - Intergenic
1076397836 10:130154269-130154291 CAGGAAGCGCAAGGGGTTGGAGG - Intronic
1076473557 10:130736725-130736747 CAAGAAGAACAAGGGGCTGTGGG - Intergenic
1076889787 10:133277766-133277788 CAGGGCCAGCAAGGGGCTGGAGG + Intergenic
1076965176 11:77026-77048 CAGGAAGTGCAAGGGGTTGGGGG + Intergenic
1076993339 11:287112-287134 TAGGCAGAACCAGGGGCTGGTGG + Intergenic
1077080075 11:721204-721226 CAGGTGGGCCGAGGGGCTGGAGG + Exonic
1077249471 11:1554618-1554640 CAGAAGGGACAAGGGGAAGGGGG + Exonic
1077301029 11:1847077-1847099 CAGGAGCAACAAGGGGATCGGGG - Intergenic
1077303242 11:1856661-1856683 CTGAAGGAGGAAGGGGCTGGAGG + Intronic
1077304903 11:1864633-1864655 CGGGAGGAGAAGGGGGCTGGGGG + Intronic
1077479409 11:2806638-2806660 CAGGTGGAAGATGGAGCTGGGGG - Intronic
1077840430 11:5968375-5968397 CAGGAGGAAGAGGAGGCTGAGGG + Exonic
1077846123 11:6026828-6026850 CAGGAGGAATAAGGTGATGAAGG + Exonic
1077917516 11:6621242-6621264 CAGGAGGCACAGAGGGGTGGTGG - Intergenic
1078145460 11:8719135-8719157 CAGGCAGAAGAAGGAGCTGGAGG + Intronic
1078321591 11:10339804-10339826 CAGGAAGCACAAGGGGTCGGGGG + Intronic
1078430157 11:11282116-11282138 CAGGAGGAAGACAGTGCTGGTGG - Intronic
1078461711 11:11519740-11519762 CAGGAGCAACCAGGGGAAGGAGG + Intronic
1078574051 11:12483673-12483695 CAGGTGGGCCAAGGAGCTGGGGG + Intronic
1078593371 11:12665221-12665243 GAGGAGGAAGAAGGAGCAGGAGG + Intergenic
1079017463 11:16881438-16881460 GAGCAGGAACAAGTGGCTGCTGG - Intronic
1079093729 11:17497778-17497800 CAGGATGAAGGAGGGGCTGGTGG - Intronic
1079129965 11:17741559-17741581 CTGGAGCAGCCAGGGGCTGGAGG - Intronic
1079577796 11:22025167-22025189 CAGGAAGCACAAGGGGTAGGGGG + Intergenic
1080235872 11:30067558-30067580 CGGGAAGCACAAGGGGTTGGGGG - Intergenic
1081290366 11:41317669-41317691 TTGGAGGAACAAGGGGCTGCTGG + Intronic
1081678568 11:44985880-44985902 CAGGGAGAACTTGGGGCTGGAGG + Intergenic
1081937237 11:46913439-46913461 GTGGAGGAACTAGGGGTTGGGGG + Intronic
1082160426 11:48883242-48883264 CAGGAGGTGCACAGGGCTGGGGG + Intergenic
1082161940 11:48897164-48897186 CAGGAGGTGCACAGGGCTGGGGG - Intergenic
1082167525 11:48965608-48965630 CAGGAGGTGCACAGGGCTGGGGG - Intergenic
1082239492 11:49855598-49855620 CAGGAGGTGCACAGGGCTGGGGG + Intergenic
1082609536 11:55280970-55280992 CAGGAGGTGCACAGGGCTGGGGG + Intergenic
1082771894 11:57214285-57214307 ACTGAGGCACAAGGGGCTGGGGG - Intergenic
1083210338 11:61180599-61180621 CAGTGGTAACCAGGGGCTGGTGG + Intergenic
1083486228 11:62984498-62984520 CAGCAAGAACGGGGGGCTGGAGG - Exonic
1083531541 11:63427969-63427991 CAGGAAGTGCAAGGGGTTGGGGG + Intergenic
1083694309 11:64432434-64432456 CAGGAGGCAGCAAGGGCTGGTGG - Intergenic
1083964481 11:66035025-66035047 CAGGTGGCACAAGGGGAAGGGGG + Intergenic
1084025011 11:66442586-66442608 CAGGAAGATCAAGGGGCAGCAGG - Intronic
1084153176 11:67300677-67300699 GAGGAGGAAAACGGGGCTGTGGG + Intronic
1084225151 11:67711066-67711088 CAGGAGGGAGGAAGGGCTGGTGG + Intergenic
1084262971 11:67990909-67990931 CAGGAGGGAGGAAGGGCTGGTGG + Intergenic
1084486357 11:69450474-69450496 CAGGAGGCCCACAGGGCTGGGGG - Intergenic
1084566269 11:69930758-69930780 CAGGAGGACCAGGGGGCTCCTGG - Intergenic
1084810422 11:71608207-71608229 CAGGAGGGAGGAAGGGCTGGTGG - Intergenic
1085959998 11:81450503-81450525 CAGGAGGAACAAGAGGGAGAGGG + Intergenic
1086231684 11:84577880-84577902 CAGGAGGAAAAAGTGGTTTGGGG + Intronic
1086283676 11:85220466-85220488 CAGTAGGAAATAGGGCCTGGGGG + Intronic
1086507583 11:87521983-87522005 GAGGAGGAAGTATGGGCTGGAGG + Intergenic
1086903443 11:92392969-92392991 TAGGAGGAACTAGGGGCAGTGGG + Intronic
1088457797 11:110050500-110050522 CGGGAGGAAGCAGTGGCTGGTGG - Intergenic
1088692514 11:112339809-112339831 AAGGAAGATGAAGGGGCTGGTGG - Intergenic
1088946610 11:114519633-114519655 CAGGTGGAAGGAGGGGCAGGAGG + Intergenic
1089321042 11:117626898-117626920 CTGGAGGATCAGGGTGCTGGTGG - Intronic
1089492680 11:118893714-118893736 CAGGAGGAAGATGAGGCTGTAGG - Exonic
1090040807 11:123289633-123289655 CAGGAGGAAGCAAGGGGTGGGGG + Intergenic
1090307417 11:125703326-125703348 CAGGAAGTGCAAGGAGCTGGGGG + Intergenic
1090331483 11:125935763-125935785 CAGGAGGAGCAGGGGCCTGAAGG + Intergenic
1090434424 11:126674988-126675010 CAAGAGGAAGAAGGGGCTCTTGG + Intronic
1090848156 11:130547277-130547299 CAGCAGGAACAGGAGGCTGAAGG - Intergenic
1091224361 11:133948805-133948827 CAGGAGGAACAGAGGCCTAGGGG + Intronic
1091790087 12:3267152-3267174 CAGGATGGCGAAGGGGCTGGGGG - Intronic
1091834793 12:3577940-3577962 CTGGAGGAGGATGGGGCTGGAGG - Intronic
1091867228 12:3851317-3851339 CAGGAAGCACAAGGGATTGGGGG + Intronic
1092529972 12:9336015-9336037 CTGGAGGAGCACGGGGCTTGGGG - Intergenic
1095706476 12:45242508-45242530 CAGGAAGCACAAGGGGTCGGGGG - Intronic
1095940815 12:47725561-47725583 CAGGAAGAAAAAGGGGAGGGAGG + Intronic
1097071595 12:56359159-56359181 CAGCAGGAACAAGGGAAGGGAGG + Intronic
1097158311 12:57028434-57028456 GAGGAGGAAAAAGGGCATGGGGG + Intronic
1097301400 12:58023086-58023108 CATGAAGCACAAGGGGTTGGGGG - Intergenic
1097713332 12:62938403-62938425 AAAAAGGAACAGGGGGCTGGGGG + Intergenic
1097901189 12:64875296-64875318 CAGCAAGACCAATGGGCTGGGGG + Exonic
1098318253 12:69214674-69214696 CAGGAAGAACAAGTGCCAGGTGG - Intergenic
1098529276 12:71522057-71522079 TAGGTGGAACAAAGGGCTAGAGG + Intronic
1098654047 12:73006751-73006773 AAGGATGAAGAAGGGGTTGGGGG + Intergenic
1098760002 12:74411383-74411405 CAGGAGGAAAGAGGGGAGGGAGG + Intergenic
1099491960 12:83299629-83299651 CAGGAAGTGCAAGGGGTTGGGGG + Intergenic
1100900771 12:99238106-99238128 CAGGAAGTGCAAGGGGTTGGGGG + Intronic
1101812156 12:108116729-108116751 CAGTAGGAACATGTGGCTAGTGG - Intergenic
1101889895 12:108703844-108703866 CAGGAGGAACAAGGGGCTGGAGG - Intronic
1102119594 12:110429818-110429840 CAGGTGGAAGATGGGGGTGGCGG + Intergenic
1102547247 12:113665927-113665949 TAGGAGGTGGAAGGGGCTGGTGG - Intergenic
1103239781 12:119403590-119403612 CAGGGGGAAGATGGGGCTGAGGG - Intronic
1103255464 12:119538351-119538373 CAGGAAGTGCAAGGGGTTGGGGG - Intronic
1103341163 12:120221876-120221898 CAGGAGAGACAGGGAGCTGGTGG - Intronic
1103403582 12:120659600-120659622 TATCTGGAACAAGGGGCTGGAGG + Intronic
1103906015 12:124327571-124327593 CAGCACCAACATGGGGCTGGAGG - Exonic
1104083570 12:125455160-125455182 GAGGGGGAACAATGGGGTGGAGG + Intronic
1104553722 12:129780700-129780722 CAGCAGGTACAGGGGGCTTGTGG - Intronic
1105201340 13:18182346-18182368 CAGGAAGTACAAGGGGTTGGGGG + Intergenic
1105281296 13:18964142-18964164 CATGTGGAACACGGGGGTGGGGG + Intergenic
1105780657 13:23702705-23702727 CCACAGGAACAAGGGGATGGAGG + Intergenic
1106100760 13:26694021-26694043 CAGGAGGGACACAGGGCTGCTGG - Intergenic
1106555427 13:30804478-30804500 AATGAGGAAGATGGGGCTGGGGG + Intergenic
1107779264 13:43880121-43880143 TAGGAGGAACAGGGACCTGGCGG + Intronic
1108415210 13:50191711-50191733 CAGGAGGCTACAGGGGCTGGGGG - Intronic
1108471780 13:50774202-50774224 CAGGAAGCTCAAGGGGTTGGGGG - Intronic
1108474785 13:50803481-50803503 CAAGAGCCACATGGGGCTGGTGG - Intronic
1108692117 13:52868805-52868827 CAGGATGACCAAGGGGTTAGGGG - Intergenic
1109798705 13:67347219-67347241 CAGGAAGATCAAGGGGCAGCAGG - Intergenic
1109816197 13:67588525-67588547 CAGGAAGCAGAAGGGGTTGGGGG + Intergenic
1110071524 13:71184471-71184493 CAGGAAGCACAAGGGGTTGGGGG + Intergenic
1113391312 13:109899986-109900008 AAGGAGGAAAAAGGGGAAGGAGG - Intergenic
1113766883 13:112887526-112887548 CAGGAGGCTGAAGGGCCTGGAGG - Intergenic
1113801155 13:113087054-113087076 CAGCAGGTGCCAGGGGCTGGGGG - Intronic
1115116746 14:29889434-29889456 CCCGGGGAGCAAGGGGCTGGGGG + Intronic
1115940409 14:38602089-38602111 CAGGAAGCACAAGAGGTTGGGGG - Intergenic
1117117241 14:52526817-52526839 GAGGAGGAGCGAGGGGCTGAAGG + Intronic
1117199543 14:53374153-53374175 CTGGAGGAACAAGGGATTGGGGG + Intergenic
1117932257 14:60855561-60855583 CAGGAAGTGCAAGGAGCTGGGGG - Intronic
1118559914 14:67067889-67067911 CAGGAAGTGCAAGGGGTTGGGGG - Intronic
1119387409 14:74266243-74266265 CAGGAGACACAAGAGGCTGGAGG - Intergenic
1119670813 14:76516882-76516904 AAGAAGGACCAAGTGGCTGGGGG - Intergenic
1120559673 14:85974993-85975015 CGGGAAGCACAAGGGGTTGGGGG - Intergenic
1120827509 14:88969049-88969071 CAGCAGGAACAAGGGTCCTGAGG - Intergenic
1121233759 14:92377536-92377558 CAGCAGGAACAGGAGGCAGGAGG + Intronic
1121437918 14:93931009-93931031 AAAGAGCAGCAAGGGGCTGGGGG + Intergenic
1121494070 14:94379938-94379960 CCAGAGAAACACGGGGCTGGTGG + Intronic
1121917803 14:97851954-97851976 CAGGAGGAATAGGGGGATTGTGG + Intergenic
1122210427 14:100170313-100170335 CAGGAGAAACAAAGGGCTCCCGG + Intergenic
1122277873 14:100604473-100604495 CAGGAGGAGCAAAGGGCTCACGG + Intergenic
1122518687 14:102327108-102327130 CAGCAGGAACAAGGGGCAGGGGG + Intronic
1122601316 14:102923243-102923265 GAGAAGTAAGAAGGGGCTGGGGG - Intronic
1122833855 14:104421477-104421499 CGGGAGGACCAAGGGCCTGGGGG + Intergenic
1122889985 14:104727753-104727775 AAGGAGGAACTAGGGGGTGAAGG - Intronic
1122899524 14:104776587-104776609 TAGGAGGGACACGGGGATGGCGG - Intronic
1124554108 15:30709526-30709548 AGGGGGGCACAAGGGGCTGGGGG - Intronic
1124677138 15:31696145-31696167 AGGGGGGCACAAGGGGCTGGGGG + Intronic
1124724700 15:32145856-32145878 CAGGAAGTGCAAGGGGTTGGGGG - Intronic
1124885680 15:33683692-33683714 CAGGAAGCACAAGGGGTCGGGGG + Intronic
1124948438 15:34292949-34292971 CAGGAAGCACAAGGGGTCGGGGG - Intronic
1125713389 15:41805013-41805035 CAGGAGGAACAAGAGCGTGGGGG - Intronic
1125821727 15:42637562-42637584 CTGGAGGTATAGGGGGCTGGGGG + Intronic
1126023845 15:44427342-44427364 CAGGATGAGCAAGGGCCTGGGGG - Exonic
1126175967 15:45735913-45735935 CAGGAGAATCTAGGGGCTTGTGG + Intergenic
1126915070 15:53457289-53457311 CTGGGGGAACAGGGGGCAGGTGG - Intergenic
1127260330 15:57322731-57322753 AAGGATGAACACGGAGCTGGGGG + Intergenic
1127331473 15:57943972-57943994 CAGGAGGAGAGAGGGTCTGGAGG + Intergenic
1127570587 15:60237354-60237376 CAGGAAGCACAAGTGGTTGGGGG + Intergenic
1127952542 15:63823492-63823514 TAGAAGGAAGAAGGAGCTGGGGG + Intronic
1128581199 15:68811361-68811383 CAGGAGGAACAAGGGAACTGAGG + Intronic
1128844123 15:70874319-70874341 CAGGAGGTACAAAGGGCAGGTGG + Intronic
1129050128 15:72774280-72774302 GAGGAGGAAGAATGGGGTGGGGG + Intronic
1129232253 15:74203315-74203337 CAGGAGGAGCAGGAGGCAGGCGG - Intronic
1129362355 15:75031838-75031860 CAGAAGGAAATAGGGGCTTGGGG + Intronic
1129367414 15:75064845-75064867 CAGGAAGATCAAGGGGCAGCAGG + Intronic
1129739368 15:77982613-77982635 GAGGAAGACCAAGGGGCGGGGGG - Intergenic
1130322409 15:82852165-82852187 GAGGAGGATCGAGGAGCTGGAGG - Exonic
1130520031 15:84655070-84655092 TGGGAGGAAAAGGGGGCTGGAGG - Intergenic
1130834062 15:87632137-87632159 TTGGAGGAACAAGAGGCTGTTGG - Intergenic
1131117562 15:89804285-89804307 CAGCAGCAACAAGGAGCGGGTGG - Exonic
1131217528 15:90551491-90551513 CAGGAGGCACATGTGGCTGGTGG + Intronic
1131338384 15:91572234-91572256 CAGAGGGAATAAGAGGCTGGAGG + Intergenic
1131377449 15:91937317-91937339 CATGGGGAACAAGTGGCGGGAGG + Intronic
1131929858 15:97429731-97429753 CAGGAGCAAGAAGGGGAGGGAGG - Intergenic
1132592961 16:734357-734379 CAGGGGGCACACGGGGCTGGCGG + Intronic
1132710265 16:1263226-1263248 CAGGAGGGACCTGGGTCTGGAGG + Intergenic
1134138462 16:11696360-11696382 CAGGAGGAACCAGAGGAGGGAGG - Intronic
1134312932 16:13092756-13092778 CAAGAAGCACAAGGGGTTGGGGG - Intronic
1134513339 16:14866580-14866602 CTGGAAGAACAAGAGCCTGGAGG + Exonic
1134700976 16:16265068-16265090 CTGGAAGAACAAGAGCCTGGAGG + Exonic
1134876890 16:17708472-17708494 CAGGAGATACAAGGGGCTGTAGG - Intergenic
1134970849 16:18529590-18529612 CTGGAAGAACAAGAGCCTGGAGG - Exonic
1135037340 16:19089342-19089364 GAGGAGGACCACGGGGCCGGGGG - Intergenic
1135619363 16:23942153-23942175 GAGGAGGAAAAGGGAGCTGGTGG - Intronic
1135678909 16:24440371-24440393 CAGTAGCAAGAAGGGGCAGGTGG + Intergenic
1135765212 16:25171666-25171688 AAGGACGTATAAGGGGCTGGCGG + Intronic
1135984145 16:27171393-27171415 CAGGATGTACAAAGGCCTGGAGG + Intergenic
1136062774 16:27737976-27737998 GAGGAGGAACAAGGGGTAGTGGG + Intronic
1136238493 16:28930000-28930022 CGGGAGGATCAGGGGGATGGAGG - Intronic
1136268964 16:29137307-29137329 AAGCAGGAACAAAGGGCTGTGGG - Intergenic
1136545293 16:30950931-30950953 CTGCAGGAGGAAGGGGCTGGAGG + Intronic
1136652109 16:31681906-31681928 CAGGACACACCAGGGGCTGGTGG - Intergenic
1136731492 16:32417736-32417758 CGGGAAGCACAAGGGGTTGGGGG - Intergenic
1136762033 16:32741471-32741493 CGGGAGGCACAAGGGGTGGGGGG + Intergenic
1136806067 16:33128917-33128939 CGGGAGGCACAAGGGGTGGGGGG - Intergenic
1137057515 16:35752660-35752682 CTGTAGAGACAAGGGGCTGGAGG + Intergenic
1137382924 16:48015192-48015214 GAGCAGGAGCAAGGGGCCGGGGG + Intergenic
1137484058 16:48877053-48877075 CATGAGGAAAAAGGGGCTGGGGG + Intergenic
1137588993 16:49682068-49682090 GAGGAGGAACAGGAGACTGGGGG - Intronic
1137775257 16:51048811-51048833 GAGGAGGAACCAGGGGGAGGTGG - Intergenic
1138520332 16:57567444-57567466 CAGGAGGGAAGAGGGGCTGGAGG - Intronic
1139339364 16:66257987-66258009 CAGGAGCAAGTAGGGGCTGGTGG - Intergenic
1139355645 16:66365786-66365808 CAGAAGAACCAAGAGGCTGGGGG - Intergenic
1139449143 16:67016321-67016343 CAGCAGGAGCAAAGGCCTGGAGG + Intergenic
1139580773 16:67872599-67872621 CAGGTGGGACAAGGGGATGCTGG + Intergenic
1139582791 16:67883305-67883327 CAGCAGGGACAATGGCCTGGAGG - Intronic
1139752229 16:69115940-69115962 CAGGAGGAACAAAGAGATTGTGG + Exonic
1140056086 16:71526875-71526897 CAGGAGGTGCAAGGAGCTGTAGG + Intronic
1140125923 16:72119025-72119047 CAGGATGAACATGTTGCTGGGGG + Intronic
1140217942 16:73023336-73023358 CTGGAGGTGGAAGGGGCTGGAGG + Intronic
1140267482 16:73433257-73433279 CTGGGAGAACAAGGGGGTGGAGG - Intergenic
1141514555 16:84535083-84535105 AAGGAGGAAGAAGGGGAGGGAGG - Intronic
1141660922 16:85441020-85441042 CCTGAGGAACGAGGGGCTGGCGG + Intergenic
1141775697 16:86121545-86121567 GAGGAGCAACAAGGAGGTGGGGG - Intergenic
1141778789 16:86142895-86142917 CAGAAAGAACAAAGAGCTGGTGG - Intergenic
1142000011 16:87658850-87658872 GAGGAGGAAATAGGGGCTGGGGG - Intronic
1142024848 16:87806961-87806983 CTGGATGAAAAAGAGGCTGGTGG - Intergenic
1142034552 16:87855267-87855289 GGGGAGGCACAAGGGGGTGGGGG - Intronic
1142072271 16:88097675-88097697 AAGCAGGAACAAAGGGCTGTGGG - Intronic
1142356415 16:89603943-89603965 CAGGAAGCACTGGGGGCTGGAGG + Intergenic
1142359495 16:89619573-89619595 CAGGGGGACCAGGGGGCTGCAGG - Intronic
1202994900 16_KI270728v1_random:99534-99556 CGGGAAGCACAAGGGGTTGGGGG + Intergenic
1203021587 16_KI270728v1_random:411876-411898 CGGGAAGCACAAGGGGTTGGGGG + Intergenic
1142808345 17:2383462-2383484 CAAGGGGAAGAAGAGGCTGGAGG - Intergenic
1142975004 17:3638027-3638049 CAGGAGCAACCTGGGGCTAGGGG - Intronic
1143432034 17:6894557-6894579 CTGGAGGAAGAAGCGGGTGGGGG + Intronic
1143513491 17:7408142-7408164 CAGGAGGGAGGAGGGGCGGGGGG - Intronic
1143585401 17:7848107-7848129 CAGGAGGAAGGAGGGGCTGGAGG - Exonic
1143765059 17:9132291-9132313 CAGCAGGAACAAAGGTTTGGAGG - Intronic
1143948868 17:10617366-10617388 CAGGGAGAATAAGGGGCTTGCGG + Intergenic
1144293997 17:13855672-13855694 CAGGAAGTGCAAGGGGTTGGGGG + Intergenic
1144657326 17:17045100-17045122 CAGCAGGAAGCAGGGGCTTGGGG - Intronic
1144696304 17:17306100-17306122 CATGAGGGACAAGGGGGAGGGGG - Intronic
1145118131 17:20231104-20231126 CAAGGAGAACAAGGGGCTGCAGG + Intronic
1145170321 17:20650883-20650905 CAAGGAGAACAAGGGGCTGCAGG + Intergenic
1145903913 17:28506143-28506165 CAGGAGGAGGGAGGGGTTGGGGG + Intronic
1146122456 17:30207732-30207754 CAGGAGAAACAGAGGGCTGATGG + Exonic
1146138565 17:30344832-30344854 CAGGACGAGCAAGAGGCTGTGGG - Intergenic
1146450020 17:32965410-32965432 CAGGAAGATCAAGGGGCAGGAGG + Intergenic
1147121755 17:38339204-38339226 CAGGAGGAATAGGGGGTGGGGGG + Intronic
1147428392 17:40357020-40357042 CAGAGGGAGAAAGGGGCTGGCGG - Intronic
1147559244 17:41498936-41498958 CTGTAGGAACAAGTGGGTGGCGG + Intergenic
1147915506 17:43883044-43883066 CAGGAGGGACTGGGGGGTGGTGG + Exonic
1148152033 17:45402713-45402735 CAGTAGGAAGAATGTGCTGGAGG - Exonic
1148355385 17:46972225-46972247 GAGGAGGAAGAAGCGGGTGGCGG - Intronic
1148552246 17:48557489-48557511 CTGGAAGAAGTAGGGGCTGGAGG - Intronic
1148749846 17:49939261-49939283 CATGAGGAACAACAGGCTGAGGG + Intergenic
1148841972 17:50504646-50504668 CAGAAGGTACAAAGGCCTGGAGG - Intergenic
1148910951 17:50942467-50942489 CTGTGGGCACAAGGGGCTGGCGG - Intergenic
1148927113 17:51097030-51097052 CAGGAGGGGAAAGGGGCTGAAGG + Intronic
1149192939 17:54085827-54085849 CAGAAGGCACAAGGGGTTGGGGG + Intergenic
1149212187 17:54316551-54316573 CAGGAAGTGCAAGGGGTTGGGGG + Intergenic
1150137236 17:62702825-62702847 CAGGATGGACGAGGGGATGGGGG - Intronic
1150300373 17:64043025-64043047 CCGGTGGAACAAGAGGCTCGTGG - Exonic
1150437256 17:65163762-65163784 CAGGCAGAACCAGAGGCTGGAGG + Intronic
1150561581 17:66300036-66300058 CAGGGGGACCCAGAGGCTGGAGG - Intergenic
1151436447 17:74100501-74100523 CAGGAGGGAGAAGGGGCTTCTGG + Intergenic
1151584308 17:74999541-74999563 GGAGAGGAACAAGGAGCTGGAGG + Exonic
1151716059 17:75831524-75831546 CAGGACCAGCAAGGGGCAGGTGG + Intronic
1151806353 17:76407934-76407956 TGGGAGCGACAAGGGGCTGGGGG + Intronic
1151875242 17:76864261-76864283 CAGCAGGACCCAGGGGCAGGGGG + Intergenic
1152147197 17:78575438-78575460 AAGGCAGAACAAGAGGCTGGGGG + Intronic
1152147474 17:78577004-78577026 CAGGAGGAAGCTGGGGCTAGGGG + Intronic
1152269860 17:79318037-79318059 CCTGAGTAACAAGGGGCTGGAGG - Intronic
1152311217 17:79551243-79551265 CAGCAGAAACCAGGGGCTGGGGG - Intergenic
1152495599 17:80669129-80669151 CAGGAGCAGCCAGGGGCTGGGGG + Intronic
1152504764 17:80741528-80741550 CAGGAGGACCATGAGGCTGGAGG + Intronic
1153384832 18:4480326-4480348 CAGGAGGATCACGAGGCAGGGGG + Intergenic
1153441259 18:5122181-5122203 CAGGAAGCGCAAGGGGTTGGGGG + Intergenic
1153979800 18:10298917-10298939 CAGGAGGACCAAGAGGCTGCAGG - Intergenic
1154075918 18:11201663-11201685 CAGTAGTTACCAGGGGCTGGGGG - Intergenic
1154194442 18:12255025-12255047 CAGGGGGGACAAGGGGCGGGTGG + Intronic
1155071774 18:22323149-22323171 CAGGAGGAGGAGAGGGCTGGGGG + Intergenic
1155155700 18:23155819-23155841 CAGGAAGAAAAATGGCCTGGAGG - Intronic
1155238267 18:23842979-23843001 GATGAGGAAGCAGGGGCTGGTGG - Intronic
1155264356 18:24076528-24076550 CAGGAGGAGGCAGAGGCTGGGGG - Intronic
1157058285 18:44256232-44256254 CAGGAAGCACAAGGAGTTGGGGG - Intergenic
1157568643 18:48697657-48697679 CAGAAGGAGCACTGGGCTGGGGG - Intronic
1157779100 18:50421306-50421328 CAGGAGCAACATGGAGCCGGGGG - Intergenic
1158202060 18:54952143-54952165 CAGGAGGAATAATTGGCTGATGG - Intronic
1158703674 18:59771541-59771563 CAGGAAGCGCAAGGGGTTGGGGG + Intergenic
1159677487 18:71303968-71303990 CAGGAGGAAGAGGGAGCAGGGGG - Intergenic
1159692246 18:71503682-71503704 CAGGAGGAACAGGTGCCTAGAGG + Intergenic
1160526296 18:79540377-79540399 AAGGAGGAAACAGAGGCTGGAGG - Intergenic
1160554728 18:79717851-79717873 CGGGTGGAACAAGGCGGTGGGGG - Exonic
1160641981 19:146656-146678 CAGGAAGTGCAAGGGGTTGGGGG + Intergenic
1160663866 19:313778-313800 CAGGAGGAGCACAGGGATGGCGG - Intronic
1160827676 19:1088382-1088404 CAGGAGGAAGCAGTGGCTGGTGG + Exonic
1160883926 19:1336041-1336063 CCGGTGGGAGAAGGGGCTGGTGG + Intergenic
1160920022 19:1515252-1515274 CAGGAGGGAACAGGGGCTGCGGG - Intergenic
1161200024 19:3009488-3009510 CAGCAGGGCCCAGGGGCTGGGGG - Intronic
1161398647 19:4058215-4058237 CAGGAGGAGCAGGGAGCCGGGGG + Intronic
1161559209 19:4962231-4962253 CAGGAGAAACATGAGGCAGGTGG + Intergenic
1161735667 19:5990798-5990820 CAGGAGGAAAACAGGGGTGGCGG + Intergenic
1162050301 19:8028756-8028778 CAGCAGGGACAAGGAGCTGTAGG + Intronic
1163757100 19:19112594-19112616 CAGGAGAGACAAGGGGTAGGTGG + Exonic
1164090957 19:21951856-21951878 TGGGAGGCACAAGGGGTTGGGGG + Intronic
1164556308 19:29255425-29255447 CAGGAAGCACAAGGGGTTGGTGG - Intergenic
1164618416 19:29680156-29680178 CAGGTAGAAAATGGGGCTGGGGG + Intergenic
1164635201 19:29786484-29786506 CAGGAGGAAGAAGGAGCAGTGGG + Intergenic
1164723530 19:30450302-30450324 CTGCAGCAACAGGGGGCTGGAGG + Intronic
1165193713 19:34084841-34084863 CAGAAAGAATAAGGGGCTTGGGG + Intergenic
1165257993 19:34591644-34591666 CAGCTGGAACAAGGGGCAGCAGG - Intergenic
1165896513 19:39144701-39144723 CAGGAGTTACAAGGGGCCAGAGG + Intronic
1165970470 19:39624526-39624548 CAGGAAGTGCAAGGGGTTGGGGG - Intergenic
1166074919 19:40408350-40408372 CAGGAGGCCCAAGGAGCTGGAGG - Exonic
1166534369 19:43563058-43563080 GAGGAGGAAGATGGTGCTGGAGG + Intronic
1166560287 19:43728314-43728336 CAGGAGCAAGAGGGGGCAGGTGG - Exonic
1166768517 19:45266381-45266403 CAGGAGGAGAAAAGGGCTGGAGG - Intronic
1167134500 19:47608849-47608871 GAGGAGGAGGAAGGGGGTGGGGG + Intronic
1167395322 19:49224657-49224679 CTGGAGCAACTTGGGGCTGGGGG - Intergenic
1167483865 19:49748695-49748717 CAGGAGGGAAAGGGGGATGGAGG + Intronic
1167576906 19:50322161-50322183 TAGGAGGAAGGAGAGGCTGGTGG - Intronic
1167792992 19:51692305-51692327 CCGGAGGGAGGAGGGGCTGGGGG + Intergenic
1167798933 19:51727802-51727824 AGGGTGAAACAAGGGGCTGGGGG + Intergenic
1168070990 19:53951683-53951705 CAAGAGGAACAGGGTGGTGGTGG - Intergenic
1168148026 19:54430386-54430408 CAGAAGGGACGCGGGGCTGGCGG + Intronic
1168155509 19:54471834-54471856 TCTGAGGAAGAAGGGGCTGGGGG - Intronic
1168155872 19:54472803-54472825 TCTGAGGAAGAAGGGGCTGGGGG - Intronic
1168245774 19:55112576-55112598 CAGGAGGTACCTGGGGGTGGGGG + Exonic
1168280406 19:55302497-55302519 TCGGAGGGAAAAGGGGCTGGAGG + Intronic
925198285 2:1945422-1945444 CAGGAGGACCAAGGGCCGTGAGG + Intronic
925548681 2:5044942-5044964 AAGAAGGAACAAAGGACTGGAGG + Intergenic
926116841 2:10218592-10218614 TAGGAGGAAGAAGGGGCTCCGGG + Intergenic
926157865 2:10467628-10467650 CAGAAGGAACACTGGGCGGGAGG + Intergenic
926207468 2:10844268-10844290 CAGCAGGAGCAAAGGCCTGGAGG + Intergenic
926648542 2:15316430-15316452 CAGGAAGTGCAAGGGGTTGGGGG + Intronic
926888463 2:17618914-17618936 CAGTAGGACCAAAGTGCTGGGGG - Intronic
927027913 2:19089444-19089466 CAGGAAGTGCAAGGGGTTGGGGG + Intergenic
928175335 2:29029794-29029816 CAGGAGGAACTAGTGGCAAGGGG + Intronic
928193100 2:29192214-29192236 CGGGAGGAACAGGCCGCTGGTGG - Intergenic
928193230 2:29193478-29193500 CAGGGGTAACCTGGGGCTGGAGG - Exonic
928223276 2:29423226-29423248 GAGGAGAAACAAGGGGGAGGAGG + Intronic
929977112 2:46645754-46645776 TAGGAGGAACACGGGGGTGGAGG - Intergenic
930229159 2:48826532-48826554 CAGGAGCAACATGGAGCTAGGGG + Intergenic
930634217 2:53787026-53787048 CAGGAGGCTCAAGGGGGCGGAGG + Intronic
930840226 2:55837480-55837502 CAGGAAGTGCAAGGGGTTGGGGG - Intergenic
931376580 2:61713504-61713526 CAGGAGGAGGAAGGGTCTGTAGG + Intergenic
932159446 2:69447050-69447072 AAGGAGGAATAACGGGCTGTGGG + Intergenic
932285010 2:70524698-70524720 AGGGAGGAAGAAGGGGATGGCGG + Intronic
933366756 2:81362901-81362923 CAGGAAGCACAAGGGGTTGGGGG - Intergenic
933777055 2:85777453-85777475 CAGAAGGACCGAGAGGCTGGGGG + Intronic
934314223 2:91901538-91901560 CGGGAAGCACAAGGGGTTGGGGG + Intergenic
934525270 2:95048059-95048081 CAGGATGATCAAGGTGGTGGTGG - Exonic
935973644 2:108556110-108556132 CAGAAGTTACTAGGGGCTGGGGG - Intronic
936151092 2:110022840-110022862 GAGGGAGACCAAGGGGCTGGCGG - Intergenic
936193585 2:110348529-110348551 GAGGGAGACCAAGGGGCTGGCGG + Intergenic
936273196 2:111068194-111068216 CAGGAGAAAAAAGGTGTTGGAGG + Intronic
936350225 2:111706884-111706906 CAGGAGGCACAAGGGTATTGCGG - Intergenic
936649896 2:114413937-114413959 CAGGAAGCTCAAGGGGTTGGGGG - Intergenic
937013398 2:118581851-118581873 TAAGAGGAACAAGGAGCTTGGGG - Intergenic
937084963 2:119165510-119165532 GAGGAAGACTAAGGGGCTGGAGG - Intergenic
937909075 2:127066662-127066684 CATGGGGAACCAGGGGCTGGGGG - Intronic
938318412 2:130345795-130345817 CAGTAGGACCAAAGGGCAGGTGG - Exonic
938549153 2:132363969-132363991 CAGGAAGTGCAAGGGGTTGGGGG + Intergenic
938565921 2:132518917-132518939 CAATAGCCACAAGGGGCTGGTGG + Intronic
939019960 2:136946919-136946941 CAGGAAGTGCAAGGGGTTGGGGG - Intronic
939159769 2:138574136-138574158 CAAAAGGAACAAGGGGGTGGGGG - Intergenic
939512273 2:143122144-143122166 GAGGCGGAAGAAGGGACTGGAGG - Intronic
939795708 2:146642007-146642029 CAGGAGGTGCAGGGGGTTGGTGG + Intergenic
939929101 2:148209773-148209795 GGGGAGGAGCAAGGGGCGGGGGG + Intronic
940013068 2:149074889-149074911 GAGGAGGAAAAATGGGGTGGGGG - Intronic
940751807 2:157634387-157634409 CAGTAGCCACAAGTGGCTGGTGG - Intergenic
940846221 2:158644759-158644781 AAGGAGGAAAATGGGACTGGGGG + Intronic
940904270 2:159154556-159154578 CAGTTGAAACAAGGGGCAGGAGG - Intronic
941881908 2:170489361-170489383 GAGGAGGAACAATGGGATTGGGG + Intronic
942072128 2:172325398-172325420 CAGGAGAATCAAGGAGGTGGAGG + Intergenic
942080053 2:172391746-172391768 GAGGAAAAACAAGGGGGTGGGGG + Intergenic
942324052 2:174760529-174760551 CAGGAGTTACCAGGGACTGGGGG + Intronic
942779897 2:179629725-179629747 CAGGAAGCACAAGGGGCTGGGGG + Intronic
942802058 2:179887053-179887075 AAGGAGGCACAAGGGGCTTCTGG + Intergenic
942947540 2:181685631-181685653 AAGGAGGAAGAAGGGGAGGGAGG - Intergenic
942952011 2:181731831-181731853 CAGGAAGTGCAAGGGGTTGGGGG + Intergenic
943558187 2:189430401-189430423 CAGGAAACACAAGGGGTTGGGGG + Intergenic
944176096 2:196830798-196830820 CAGGAAGATCAAGGGGCAGCAGG - Intergenic
944894654 2:204151630-204151652 CGGGAGGGACGTGGGGCTGGTGG - Intergenic
945108988 2:206344769-206344791 GAGAGGGAACAAGGGGATGGGGG - Intergenic
946254612 2:218433564-218433586 CAGCAAGGACAAGGGCCTGGGGG + Intronic
946308551 2:218870317-218870339 GAGCAGGAAGAAGGAGCTGGGGG - Intronic
946375983 2:219309193-219309215 CAGGAGGAAACTTGGGCTGGCGG - Intronic
946433041 2:219635650-219635672 CTGGGGGAACAAGGGGCTGCTGG - Intronic
946749507 2:222879498-222879520 AAGGAGGAATAAGAGCCTGGAGG + Intronic
946866297 2:224043972-224043994 CAGGAGGAAGAACTGGTTGGGGG - Intergenic
947483548 2:230525620-230525642 CAGGAAGCACAAGGGGTGGGGGG + Intronic
947552311 2:231055229-231055251 AAGGAGGCACTAGGGGGTGGTGG - Intergenic
947741760 2:232487919-232487941 CAGGAGGAAGGAGGGGCGCGCGG - Intergenic
948112379 2:235466480-235466502 CAAGAGCCACATGGGGCTGGTGG + Intergenic
948126435 2:235567722-235567744 CAGGAGGAACGTGGCACTGGGGG + Intronic
948283853 2:236769178-236769200 CAGGAGGGACATGGGGCAGGGGG + Intergenic
948523478 2:238556858-238556880 CAGGAGGGAGAAGCGGGTGGAGG - Intergenic
948888125 2:240893928-240893950 CAGGAAGCCCGAGGGGCTGGGGG + Intronic
948925829 2:241096675-241096697 CAGGAGGGAGAAGGGGCAGAAGG + Intronic
1169410972 20:5370098-5370120 CAGGAAGAATGAGGGGCAGGAGG - Intergenic
1169421400 20:5463626-5463648 CAGGAAGTGCAAGGAGCTGGGGG - Intergenic
1170186155 20:13593415-13593437 CAGGAAGCACAAGGGGTCGGAGG + Intronic
1170350233 20:15432459-15432481 CAGGATGAGCACTGGGCTGGAGG + Intronic
1170814087 20:19698089-19698111 CAGCAGGAGCAAGAGGGTGGGGG + Intronic
1171143805 20:22764759-22764781 CTGCAGGAAGCAGGGGCTGGAGG + Intergenic
1171258344 20:23709299-23709321 CAGGAGGACCAAGGAGCTGCAGG - Intergenic
1171266062 20:23773191-23773213 CAGGAGGTGGAAGGAGCTGGGGG - Intergenic
1172114999 20:32568529-32568551 CAGGAAGAACATGGGGAGGGAGG - Intronic
1172136619 20:32690664-32690686 CAGCAGGAACAGGAGGCTGAAGG - Intergenic
1172390926 20:34564833-34564855 CTGGAGGATAAAGGGGGTGGCGG + Intronic
1172628296 20:36361170-36361192 GAGGAGAAACAAGGTGTTGGGGG + Intronic
1173417104 20:42866436-42866458 GAGGAGGAAAAGGGGGTTGGAGG - Intronic
1173909743 20:46657814-46657836 GAGCAGGAGCAAGGCGCTGGGGG + Intronic
1173957009 20:47041095-47041117 CAGGAGGAGCAGGGACCTGGGGG - Intronic
1174543279 20:51306454-51306476 AAGCAGGAGCATGGGGCTGGAGG + Intergenic
1174686580 20:52461857-52461879 CAGGAGGGAGAAGGAGATGGAGG - Intergenic
1175096976 20:56548960-56548982 GAGGAGGAGCAAGGGGGTGAGGG - Intergenic
1175206894 20:57317971-57317993 CAGGGGGCACAAGGGGCAGAAGG - Intergenic
1175592895 20:60207484-60207506 GAGCAGGACCAAGGGGGTGGGGG + Intergenic
1175642483 20:60642670-60642692 CAGGCTGACCAAGGGGCTGTGGG - Intergenic
1175831072 20:61965792-61965814 GAGGAGGAGCCAGGGGCGGGGGG - Intronic
1176097557 20:63351286-63351308 CAGGAGCACAAAAGGGCTGGCGG + Intronic
1176139330 20:63538173-63538195 CAGGAGGAGGCAGAGGCTGGAGG - Intergenic
1176156030 20:63621223-63621245 CAGAAGTGACCAGGGGCTGGGGG + Intronic
1176168264 20:63685690-63685712 CAGGAGGCAGGTGGGGCTGGGGG + Intronic
1176664232 21:9669593-9669615 GTGGAGGAGGAAGGGGCTGGGGG - Intergenic
1176716605 21:10355642-10355664 CAGGAAGTACAAGGGGTTGGGGG - Intergenic
1176925378 21:14743214-14743236 CAGAGGGAACAAGGGGGTAGAGG + Intergenic
1177614622 21:23500790-23500812 CAGGAGGAAGAGAGGTCTGGGGG - Intergenic
1177855927 21:26400055-26400077 CAGGAGGAAGCAGGGGCGGGGGG - Intergenic
1178091911 21:29172844-29172866 CACTGGGAACAAGGGGCGGGGGG - Intronic
1178295289 21:31404895-31404917 TAGGAGGAACAGGGAGCTGTTGG - Intronic
1179045282 21:37838938-37838960 CAGGAGGAAGTAGGGGGAGGGGG - Intronic
1179582469 21:42352225-42352247 CTGGAGGAGCAGGGGCCTGGAGG - Intergenic
1179582503 21:42352331-42352353 CTGGAGGAACAGGGGCCTGGAGG - Intergenic
1179838433 21:44053735-44053757 CATGTGGAACAAGGGGCTCCCGG - Intronic
1179982499 21:44903634-44903656 CAGGAGGATTTGGGGGCTGGAGG - Intronic
1180070854 21:45435253-45435275 GAAGAGGAAGAAGGGGGTGGGGG + Intronic
1180083902 21:45498882-45498904 CAGGATGAACCTGGGGCTGAAGG + Intronic
1180601731 22:17024294-17024316 CAGGAAGTACAAGGGGTTGGGGG + Intergenic
1181618009 22:24068197-24068219 CAGGAGGGAGAAGGGGGTGGAGG + Intronic
1182146162 22:27998110-27998132 CAGGGGTAACAAGGGGATGATGG - Intronic
1182745943 22:32605664-32605686 CAGGAGGGAGCAGGGGCGGGTGG - Intronic
1183060234 22:35332068-35332090 AAAAATGAACAAGGGGCTGGAGG - Intronic
1183316263 22:37138688-37138710 GAGGAGGTACAAAGGGCTAGGGG + Intronic
1183319449 22:37156152-37156174 CAGAGGGAACAGGAGGCTGGAGG - Intronic
1183654734 22:39177889-39177911 CAGGAGGCACCAGGGGAAGGCGG - Intergenic
1183937612 22:41272426-41272448 GAGGAGGAATATGGGACTGGGGG - Intronic
1184169875 22:42752527-42752549 GAGGAGGACCACGGGGTTGGGGG - Intergenic
1184343701 22:43900372-43900394 CAGAAGGCACCAGGAGCTGGTGG - Intergenic
1184413308 22:44338135-44338157 TTGGAGGAGGAAGGGGCTGGGGG - Intergenic
1184598118 22:45526453-45526475 CAGGAGGAACTTGGGCCTGGAGG + Intronic
1184652692 22:45926349-45926371 GAGGAGGAACCAAGGCCTGGAGG - Intronic
1184693593 22:46128236-46128258 CAGGAGGAGGATGGGGCTGGGGG - Intergenic
1184755368 22:46512827-46512849 CGGAAGGAACAAGAGGGTGGGGG - Intronic
1185119046 22:48954900-48954922 CAGGAGGCCCCAGGGGCAGGGGG - Intergenic
1185167105 22:49268211-49268233 CAGAATGAACAAGATGCTGGGGG - Intergenic
949279584 3:2330399-2330421 CAGGAGGGAAGAGGGGCTGAAGG - Intronic
950109936 3:10412496-10412518 CAGCAGGAGCAAAGGCCTGGGGG - Intronic
950299907 3:11867932-11867954 CAGGAAGCACAAGGGGGCGGAGG - Intergenic
950364363 3:12472552-12472574 CAGCAGGAACAAGGGGCTCTAGG - Intergenic
950647258 3:14384557-14384579 CAGGAGGAAGGAGAGGATGGGGG - Intergenic
951041702 3:17995018-17995040 CAATAGCCACAAGGGGCTGGTGG - Intronic
951469132 3:23036367-23036389 CAGGAAGTGCAAGGGGTTGGGGG - Intergenic
951912584 3:27767214-27767236 CAGAAGGAAGAAGAGGCTTGAGG - Intergenic
952189164 3:31003988-31004010 CAGGAGGTACAGGGGAGTGGAGG + Intergenic
952519596 3:34143316-34143338 CAGGAAGAACAAGGGGGAGAAGG - Intergenic
952550595 3:34472166-34472188 CCGGAAGCACAAGGGGTTGGGGG - Intergenic
952863968 3:37838993-37839015 CGGGAAGCACAAGGGGTTGGGGG + Intergenic
953167031 3:40474638-40474660 GAGGAGGAACAGGGGGATGAGGG + Intergenic
953277773 3:41520223-41520245 CAGGGGTTACCAGGGGCTGGGGG - Intronic
953888336 3:46732804-46732826 CAGGAGGAACCAAGAGGTGGAGG - Intronic
954311192 3:49768821-49768843 AAGAACGTACAAGGGGCTGGGGG + Intronic
954441498 3:50524719-50524741 CAGGACGAGGCAGGGGCTGGGGG + Intergenic
954799568 3:53179380-53179402 CAGCAGGAACAAAGGCCTGGAGG + Intronic
954807201 3:53227394-53227416 CAGGAGCAAGATGGGGCTGGAGG - Intronic
954827917 3:53391334-53391356 CAGGAAGAGCAAGGGGTCGGGGG + Intergenic
955281739 3:57600489-57600511 CAGGAGGAAAAAGGGAGGGGAGG - Intergenic
956404388 3:68912652-68912674 CGGGAGGACCAAGGTGCTGCTGG + Intronic
957591692 3:82207455-82207477 CAGGAGGAAAGAGGGTCAGGAGG + Intergenic
958413992 3:93852695-93852717 CAGGAAGTGCAAGGGGTTGGGGG - Intergenic
958479699 3:94630809-94630831 CAGGAAGCACAAGGGGTTGGGGG + Intergenic
958553529 3:95645231-95645253 CAGGAAGCACAAGGGGTTGGGGG + Intergenic
959062508 3:101628824-101628846 CAGGAAGAAATAGGGGCTTGGGG + Intergenic
959097442 3:101971358-101971380 CGGGAGGCACAAGGGGTTGGGGG - Intergenic
959736448 3:109664925-109664947 CGGGAGGTGCAAGGGGTTGGGGG + Intergenic
959820585 3:110730404-110730426 CTGGAGGAAAAAGGTGTTGGAGG - Intergenic
960508071 3:118516915-118516937 CAGGAAGCACAAGGGGTTGGAGG + Intergenic
960836088 3:121908317-121908339 CAGGAAGGACAAGCGGTTGGGGG - Intronic
960911224 3:122651141-122651163 CGGGAAGCACAAGGGGTTGGGGG + Intergenic
960987790 3:123291928-123291950 CAGGAGGAGCAAGTGCCAGGAGG + Intronic
961044902 3:123701380-123701402 CAGGAGGAAGGTGGGGATGGGGG + Intronic
962291428 3:134140060-134140082 CAGGAAGCACAAGGGGTAGGGGG + Intronic
962385477 3:134929106-134929128 CGGAGGGAACAAGGGGCTGTGGG + Intronic
962513457 3:136126180-136126202 CAGGAAGCACAAGGGGTTGGGGG + Intronic
962886064 3:139628962-139628984 CAGGAGGAGAAAGGAGATGGTGG + Intronic
962943480 3:140146790-140146812 CAGGAGGAAGGAGGGGATGGTGG - Intronic
963234945 3:142947316-142947338 CAGGAGGAGGAAGGGGCAGGCGG + Intergenic
964701732 3:159575038-159575060 CTGGAAGCACAAGGGGTTGGGGG - Intronic
964881038 3:161423191-161423213 GGGGAGGAACAAGAGGCCGGAGG - Intergenic
964883908 3:161458331-161458353 AAAGAGCAAAAAGGGGCTGGGGG - Intergenic
964969507 3:162542265-162542287 AAGAAGGAACAAGGGGATGGAGG - Intergenic
965667309 3:171109013-171109035 CCGGAAGAACGAGGGGCTGAAGG + Intronic
966879374 3:184341333-184341355 GAGGAGGAGCAAGGGGCAGAGGG + Intronic
967330441 3:188284438-188284460 CAGGAGGCCCAAGGGGGAGGTGG + Intronic
967578363 3:191124090-191124112 CTGAAGGAACAAATGGCTGGTGG - Intergenic
967883491 3:194317771-194317793 GAGTAGGAGCAAGGGGTTGGGGG + Intergenic
968948326 4:3677143-3677165 CGGGAGGAGCCCGGGGCTGGGGG + Intergenic
969021480 4:4142825-4142847 CAGGAGGGAGGAAGGGCTGGAGG + Intergenic
969313716 4:6369242-6369264 CAGCAGGCACATGGGGCTGGTGG + Intronic
969586465 4:8097014-8097036 CAGGAGGAAGAAGGGAAGGGAGG + Intronic
969732386 4:8964592-8964614 CAGGAGGGAGGAAGGGCTGGTGG - Intergenic
969791967 4:9498675-9498697 CAGGAGGGAGGAAGGGCTGGTGG - Intergenic
970157120 4:13152783-13152805 CGGGAGGCACCAGGGGCTGAAGG - Intergenic
970714654 4:18907644-18907666 CAGGAAGTGCAAGGAGCTGGGGG + Intergenic
971748987 4:30622052-30622074 CAGCATGAACAAAGGGCTGTGGG - Intergenic
972386794 4:38574752-38574774 CAAGAAGAACAGGTGGCTGGAGG - Intergenic
973598956 4:52522058-52522080 CAGGAGGTAAAAGGGGTTGGGGG + Intergenic
973786506 4:54337455-54337477 AAGGAGACAGAAGGGGCTGGAGG - Intergenic
973835731 4:54807255-54807277 CAGGAAGTACAAGGGGTTGGGGG + Intergenic
974196810 4:58585548-58585570 CAGGAAGCACAAGGGGTTGGGGG - Intergenic
974307258 4:60157474-60157496 CAGGAAGCACAAGGGGTTGGGGG + Intergenic
974954643 4:68622612-68622634 CCGGAGGTGCAAGGGGTTGGGGG - Intronic
975177834 4:71308606-71308628 CAGGAAGTGCAAGGGGCCGGGGG + Intronic
975296326 4:72738487-72738509 CAGTAGCTACAAAGGGCTGGGGG - Intergenic
975744669 4:77464537-77464559 CAGGAAGCACAAGGGGTTGGGGG - Intergenic
976451531 4:85196452-85196474 CCGGAAGCACAAGGGGTTGGGGG - Intergenic
976477969 4:85506680-85506702 CAGGAAGTGCAAGGGGTTGGTGG - Intronic
976552606 4:86413852-86413874 TAGGAAGCACAAGGGGTTGGGGG - Intronic
976975905 4:91165866-91165888 CAGGAAGCACAATGGGTTGGGGG - Intronic
977326505 4:95580734-95580756 CACGAAGCACAAGGGGTTGGGGG - Intergenic
977771743 4:100868739-100868761 CCGGAAGCACAAGGGGCCGGGGG - Intronic
977923235 4:102669353-102669375 TAGGAGTGACAAGGGGCTGGAGG - Intronic
977946443 4:102919616-102919638 CGGGAAGCACAAGGGGTTGGGGG + Intronic
978338631 4:107697376-107697398 TAGGTGGAACAAAGGGATGGTGG + Intronic
979289781 4:118966725-118966747 CAGGAGGAACTAGGGGAGGGGGG - Intronic
979576198 4:122294448-122294470 CAGGAGGAACCTGGTGCAGGAGG + Intronic
980075290 4:128287797-128287819 GAGGAGGAGGAAGGCGCTGGCGG - Exonic
980584018 4:134789431-134789453 CAGGAAGCACAAGGGGTTGGGGG + Intergenic
981850946 4:149229586-149229608 CAGGAAGCACAAGGGGTTGAGGG + Intergenic
982043407 4:151417540-151417562 CATGCGGAACAAGGAGATGGGGG + Intronic
983850114 4:172569965-172569987 CAGGAGGAAGGAGGGGCTGGTGG + Intronic
983855551 4:172639641-172639663 AAGGAGGTACAGGGAGCTGGAGG - Intronic
985860026 5:2463650-2463672 CAGTAGGGACCAGAGGCTGGTGG + Intergenic
985966602 5:3342843-3342865 GAGGAGGAAGAAGAGGCAGGTGG - Intergenic
986271254 5:6232904-6232926 CAGGGAGAAGATGGGGCTGGAGG + Intergenic
986476339 5:8137457-8137479 GAGGAGGAACAAGGGGTGGCAGG + Intergenic
986662112 5:10068508-10068530 TGGGAGGAAGAAGGGACTGGAGG - Intergenic
986979234 5:13427704-13427726 CAGTAGCCACAAGTGGCTGGTGG - Intergenic
987306359 5:16641322-16641344 AAGGAAGAGCAAGGGTCTGGAGG + Intergenic
987335047 5:16891392-16891414 AAGGAGGAAGGAGGGGCAGGCGG + Intronic
988167898 5:27617554-27617576 CAGGAAGCACAAAGAGCTGGGGG - Intergenic
988203997 5:28110769-28110791 CAGGAAGTGCAAGGAGCTGGGGG - Intergenic
988381302 5:30499779-30499801 CAGGAAGTGCAAGGGGTTGGGGG - Intergenic
989465495 5:41750340-41750362 CAGGTGGGAGGAGGGGCTGGAGG - Intronic
991105424 5:62837274-62837296 CAGGAAGCACAAGGGGTAGGGGG + Intergenic
991243486 5:64484929-64484951 CAGGAAGCACAAGGGGTTGGGGG - Intergenic
992498847 5:77321989-77322011 CAGGAGGCACAGGGAGCGGGAGG + Intronic
992770637 5:80044009-80044031 CAGCAGGAACAAAAGGATGGAGG - Intronic
992965079 5:81991496-81991518 CAGGAGCAAAAAGGGGCAGAGGG - Intronic
993843420 5:92909458-92909480 CAGGAGAATCAAGGAGCAGGTGG + Intergenic
995229250 5:109740054-109740076 CAGGCTTAACAAAGGGCTGGAGG - Intronic
995584467 5:113633311-113633333 CAGGATGAAGAATTGGCTGGAGG + Intergenic
996859069 5:128044105-128044127 CGGGAAGCACAAGGGGTTGGGGG + Intergenic
998250830 5:140551108-140551130 CTGCAGGAACAGTGGGCTGGAGG - Exonic
999777593 5:154823440-154823462 CAGGAGGAACCAGTGGAAGGTGG + Exonic
999963471 5:156783002-156783024 CAGGAAGCACAAGGGGTTGAGGG + Intergenic
999965573 5:156806043-156806065 CAGGAAGCACAAGGGGTTGGGGG + Intergenic
1000022423 5:157329780-157329802 CAGTAGGCACATGTGGCTGGTGG + Intronic
1000120882 5:158196878-158196900 GAACAGGAACAAGGGGCTGAGGG - Intergenic
1000145199 5:158447142-158447164 CAGGAAGCACAAGGGGTTGGGGG - Intergenic
1000414096 5:160965345-160965367 CAGGAGGAAAGGGGGGCGGGGGG - Intergenic
1000505411 5:162110719-162110741 CAGGAGTAACAAGAGACTGTAGG - Intronic
1000706844 5:164523176-164523198 CAGTAGGAACAAAGGCATGGAGG + Intergenic
1001080003 5:168660712-168660734 AAGAAGGAACAACCGGCTGGGGG + Intergenic
1001144059 5:169168813-169168835 CAGGAGGAACAAGGGGAAATGGG + Intronic
1001393388 5:171398941-171398963 CAGGAGGAACCAGGAGGCGGAGG - Intronic
1001396786 5:171423523-171423545 CAGGAGGGACAAGAGGCCAGGGG - Intronic
1001396795 5:171423551-171423573 CAGGAGGGACAAGGGGCTAAGGG - Intronic
1001829591 5:174774311-174774333 CAGGAGGAACCAAGGGCTGTGGG - Intergenic
1002203667 5:177547707-177547729 AAGCAGAAAGAAGGGGCTGGTGG - Intronic
1002749648 6:96294-96316 CAGGAAGTGCAAGGGGTTGGGGG + Intergenic
1003053729 6:2801409-2801431 CAGAAGGAGCCAAGGGCTGGCGG + Intergenic
1003153875 6:3574977-3574999 CAGCAGGAGCCAGGGCCTGGGGG - Intergenic
1003228171 6:4225148-4225170 TAGGAAGCACAAGGGGTTGGGGG + Intergenic
1003380951 6:5624333-5624355 AAGGAGGAACAAGGTGTTTGGGG - Intronic
1003477488 6:6497682-6497704 CATGAGAAACAAAGTGCTGGGGG - Intergenic
1004149011 6:13097359-13097381 CTGGTGGAACTAGGGGCAGGAGG - Intronic
1004156273 6:13171096-13171118 CAGGGAGAACAGGTGGCTGGTGG - Intronic
1004436428 6:15599348-15599370 CATGAGGAAAATGGGGCTTGAGG + Intronic
1004883033 6:20027403-20027425 AGGGAGCAAGAAGGGGCTGGGGG + Intergenic
1005801221 6:29427203-29427225 CAGACGGTACATGGGGCTGGTGG - Exonic
1005963999 6:30713587-30713609 GAGGAAGAACCAGGGGCTGGAGG - Intronic
1005994945 6:30925417-30925439 CTGCAGGAAAAGGGGGCTGGTGG + Intronic
1006154368 6:32006340-32006362 CAGGAGGAGCTGGGGGCTGGAGG - Intergenic
1006160675 6:32039068-32039090 CAGGAGGAGGTGGGGGCTGGAGG - Intronic
1006260724 6:32867169-32867191 CAGGAGGAACCAGGGTGTGGGGG + Intergenic
1006284714 6:33083782-33083804 GAGGAGGAAAAAGGTACTGGTGG + Intronic
1006358758 6:33575847-33575869 CAGCAGGAACAGGAGGCTGAAGG - Exonic
1006446916 6:34084765-34084787 CAGTAGGAACAAAAGCCTGGAGG - Intronic
1006474322 6:34245003-34245025 CAGGTGGAAGATGGGGGTGGCGG - Exonic
1006616585 6:35332135-35332157 CAGGAAGCAGAAGGGGTTGGGGG + Intergenic
1007070787 6:39036888-39036910 CAGGAGAAACAGGGAGCTGCCGG - Intergenic
1007207226 6:40162786-40162808 CAGGAGAACCAGGGGCCTGGAGG - Intergenic
1007336717 6:41159905-41159927 CTCGAGGAGGAAGGGGCTGGAGG - Intronic
1007767761 6:44171048-44171070 CTGGAGGGACAATGGGCTGGAGG + Intronic
1007991658 6:46262331-46262353 CAGGGTGAACAGGGGGCTGATGG - Intronic
1008247408 6:49194915-49194937 GAGGAGAAACATGGGGCAGGGGG - Intergenic
1008359545 6:50599268-50599290 CAGTAGGCACCAGGGGATGGTGG - Intergenic
1010171848 6:72984646-72984668 CAGGAAGCACAAGGGGTGGGGGG - Intronic
1010247461 6:73674859-73674881 CTGGAAGATCAAGGAGCTGGTGG - Intergenic
1010364212 6:75031032-75031054 CAGGAAGCATAAGGGGTTGGGGG + Intergenic
1010676950 6:78756306-78756328 CAGGAAGAACAAGGGGTCAGGGG + Intergenic
1010751849 6:79624764-79624786 CAGTAAGAATAAGGTGCTGGGGG + Intergenic
1011776726 6:90739220-90739242 CAGGAGGCACAGGGCGGTGGGGG + Intergenic
1011884595 6:92078468-92078490 CAGGAAGCACAAGGGGTTGGAGG + Intergenic
1012938624 6:105394016-105394038 CAGGAGCTACAAGTGGCTAGTGG + Intronic
1014472621 6:121835091-121835113 CAGCAGGAACAAGGGCATGAAGG - Intergenic
1014558053 6:122856823-122856845 CAGCAGGAGCAAGGTGGTGGGGG + Intergenic
1015075112 6:129147485-129147507 CAGGGGCAATAAGGGGGTGGAGG + Intronic
1015091574 6:129364920-129364942 CAGGAGGAAGTGGGGGCTGGAGG + Intronic
1015439205 6:133228397-133228419 TAGGAGGTAGAAGGAGCTGGAGG - Intergenic
1016265890 6:142232346-142232368 CAGGAAGTGCAAGGGGCTGGGGG + Intergenic
1016732535 6:147442328-147442350 CAGGACAAACAAGGGGCAGAAGG + Intergenic
1016856067 6:148671651-148671673 CTGGAAGCACAAGGGGTTGGGGG - Intergenic
1016990167 6:149922978-149923000 TAGAAGGAACGCGGGGCTGGCGG + Exonic
1016996233 6:149964060-149964082 CAGAAGGAACGCGGGGCTGGCGG - Exonic
1017084855 6:150704522-150704544 CAGGTGGAGTAAGGGGCTGCAGG + Intronic
1017210515 6:151850656-151850678 CAGGCAGAAGGAGGGGCTGGTGG - Intronic
1017524630 6:155231723-155231745 CAGTGGGAACAAGGGGCTCCTGG - Intronic
1018047182 6:159975539-159975561 CAGGTGGAAGGAGGGGCAGGTGG + Intronic
1018890067 6:167976862-167976884 CAGGAAGACCCAGGGGCAGGAGG - Intergenic
1019310151 7:356599-356621 CAGGAGGAACAAAGGCATTGAGG - Intergenic
1019428704 7:988828-988850 CAGGAGGACCTGGGGGCTGGGGG - Exonic
1019518442 7:1449911-1449933 CAGGCAGAACAAGGGTCTGGGGG - Intronic
1019633005 7:2059537-2059559 GAGGAGAGGCAAGGGGCTGGCGG + Intronic
1020308902 7:6854854-6854876 CAGGAGGGAGGAGGGGCTGGTGG + Intergenic
1021282720 7:18740204-18740226 CAGGAAGCACAAGGGGTTGGGGG - Intronic
1021557788 7:21939173-21939195 CAGAAGTAACCAGGGGCTGGAGG + Intronic
1022519283 7:30995429-30995451 CAAGAGGCAGAAGGGGCAGGAGG - Intergenic
1022745415 7:33166817-33166839 CAGGAAGTGCAAGGGGTTGGGGG - Intronic
1022818698 7:33937923-33937945 CAGAAGGAGCATGTGGCTGGAGG - Intronic
1023029470 7:36079820-36079842 GGGGAGGAAGCAGGGGCTGGTGG - Intronic
1023551059 7:41370056-41370078 GAGGAGGGACCAGGGGGTGGGGG + Intergenic
1024059816 7:45689483-45689505 GAGCAGGAGCAAGGGGGTGGGGG + Intronic
1024769276 7:52699092-52699114 ATGCAGGAACAAGGAGCTGGAGG - Intergenic
1025283656 7:57646385-57646407 CAGGAGGAAGAAGCTGCGGGCGG - Intergenic
1025887749 7:65614420-65614442 GAGGAGGAAGAAGGGGAAGGAGG - Intergenic
1025968847 7:66302982-66303004 CAGAAGGAACAAAGGTATGGAGG - Intronic
1026796158 7:73367279-73367301 CAGGAGGATCGAGCCGCTGGCGG - Intergenic
1026894248 7:74000805-74000827 CATGAGAACCAGGGGGCTGGAGG + Intergenic
1028112173 7:86954127-86954149 TAGGAGGGAGAAGGGGATGGTGG - Intronic
1028229263 7:88287074-88287096 CAGGAGAAGGAAGGGGCTGTTGG + Intronic
1028526295 7:91790656-91790678 CAGAAAGAGCAAGGGGTTGGGGG + Intronic
1028544841 7:91986331-91986353 CAGGAAGAGTAAGGGGTTGGAGG - Intronic
1029142867 7:98424089-98424111 CAGGAAGATCAAGCGGGTGGTGG + Intergenic
1029207316 7:98877753-98877775 GAGGTGGAACCAGGGCCTGGAGG + Intergenic
1029248404 7:99218974-99218996 AAGGCTGACCAAGGGGCTGGAGG - Intergenic
1029252195 7:99244857-99244879 CAGGAGGAACAAGGGCTTGCGGG - Intergenic
1029325735 7:99807448-99807470 CAGGAAGATCAAGGGGCAGCAGG - Intergenic
1029401773 7:100351643-100351665 CAGAAGGTAGCAGGGGCTGGGGG + Intronic
1029801655 7:102954138-102954160 CAGGAAGCACAAGGGGTCGGGGG + Intronic
1029951993 7:104595995-104596017 CGGGAAGCACAAGGGGTTGGGGG - Intronic
1030063529 7:105641678-105641700 CAGGAAGAGCCAGGTGCTGGGGG + Intronic
1030166428 7:106560379-106560401 CAGGAAGCACAAGGGGTTGGGGG - Intergenic
1031798793 7:126214811-126214833 CAGCAGGAGCAAGAGGATGGAGG - Intergenic
1031991752 7:128203144-128203166 CAGGAGGGACACGGGGAAGGTGG + Intergenic
1033648713 7:143323782-143323804 CACGCGGGACAAGGGGGTGGAGG - Intronic
1033683971 7:143622139-143622161 CAGGAGGAGCATGTGGCTGAGGG + Intronic
1033687147 7:143701328-143701350 CAGGAGGAGCATGTGGCTGAGGG + Intronic
1033700641 7:143835499-143835521 CAGGAGGAGCATGTGGCTGAGGG - Intergenic
1034100792 7:148448726-148448748 CAGCAGGAGCAAGAGGCTGAGGG + Intergenic
1034152118 7:148925277-148925299 CAGGAGGAACCAGTTTCTGGAGG - Intergenic
1034202357 7:149290348-149290370 CGGGAGGAGCGACGGGCTGGCGG + Intronic
1034285648 7:149881599-149881621 CAGGAGGAAGATGAGGCTGCAGG + Intergenic
1034643751 7:152625930-152625952 AAGCAGGAACAAGGGGGTGGGGG + Intergenic
1034741336 7:153476309-153476331 CAGGAAGCAGATGGGGCTGGAGG - Intergenic
1034782607 7:153894649-153894671 CAGGAGGAACCAGTGGCTCCAGG - Intronic
1035217914 7:157383737-157383759 CAGGAGCTACACGTGGCTGGTGG - Intronic
1035451177 7:158977887-158977909 CAGAAGGTAGAAGGGGGTGGGGG - Intergenic
1035508632 8:156463-156485 CAGGAAGTGCAAGGGGTTGGGGG + Intergenic
1035583576 8:755597-755619 GAGTAGGAACGAGGGGCAGGTGG + Intergenic
1035731647 8:1857709-1857731 GAGAAGAAACAAGAGGCTGGGGG - Intronic
1035783634 8:2247300-2247322 GAGGAGGAACCAGGGGAAGGCGG + Intergenic
1035783645 8:2247338-2247360 GAGGAGGAACCAGGGGAAGGTGG + Intergenic
1035783658 8:2247376-2247398 GAGGAGGAACCAGGGGAAGGTGG + Intergenic
1035783721 8:2247566-2247588 GAGGAGGAACCAGGGGAAGGTGG + Intergenic
1035783785 8:2247756-2247778 GAGGAGGAACCAGGGGAAGGTGG + Intergenic
1035783798 8:2247794-2247816 GAGGAGGAACCAGGGGAAGGTGG + Intergenic
1035783811 8:2247832-2247854 GAGGAGGAACCAGGGGAAGGTGG + Intergenic
1035783876 8:2248021-2248043 GAGGAGGAACCAGGGGAAGGTGG + Intergenic
1035784044 8:2248553-2248575 GAGGAGGAACCAGGGGAAGGTGG + Intergenic
1035784129 8:2248819-2248841 GAGGAGGAACCAGGGGAAGGTGG + Intergenic
1035784142 8:2248857-2248879 GAGGAGGAACCAGGGGAAGGTGG + Intergenic
1035784178 8:2248971-2248993 GAGGAGGAACCAGGGGAAGGTGG + Intergenic
1035784304 8:2249351-2249373 GAGGAGGAACGAGGGGAAGGTGG + Intergenic
1035784372 8:2249579-2249601 GAGGAGGAACCAGGGGAAGGTGG + Intergenic
1035784465 8:2249883-2249905 GAGGAGGAACCAGGGGAAGGTGG + Intergenic
1035808430 8:2472096-2472118 GAGGAGGAACCAGGGGAAGGTGG - Intergenic
1035808469 8:2472210-2472232 GAGGAGGAACCAGGGGAAGGTGG - Intergenic
1035808480 8:2472248-2472270 GAGGAGGAACCAGGGGAAGGCGG - Intergenic
1035808492 8:2472286-2472308 CAGGAGGAACCAGGGGAAGATGG - Intergenic
1036398122 8:8386105-8386127 CGGGAGGACCGAGGAGCTGGAGG - Intronic
1036708027 8:11059597-11059619 GAGGAGGAGCAGGGCGCTGGGGG + Intronic
1036709777 8:11070864-11070886 CAGGAGGAATGAGGGGCAGCGGG - Intronic
1036731907 8:11273127-11273149 CACGAGCATCAAGGGGATGGTGG - Intergenic
1037234829 8:16705848-16705870 CAGAAGAAACAGGAGGCTGGAGG + Intergenic
1037311045 8:17556962-17556984 TAGAAGGAACATGGGGCTGTTGG + Intronic
1037471869 8:19218464-19218486 CATGGGGAAGAAGGGGTTGGTGG - Intergenic
1037764905 8:21766661-21766683 GAGGATGAACAGGGGCCTGGGGG + Intronic
1037877387 8:22554683-22554705 CAGGAGGATGAAAGGGATGGAGG + Intronic
1037917457 8:22781298-22781320 CCGGAGGGGGAAGGGGCTGGTGG + Intronic
1038472974 8:27840724-27840746 CAGGAGGAGGCAGGGGATGGGGG + Intergenic
1038687829 8:29734466-29734488 CAGGAGGAACTTGGAGCTGGGGG - Intergenic
1039554718 8:38467831-38467853 CAGGAGGTGAAAGGGGCGGGCGG + Exonic
1039603976 8:38865970-38865992 GAGGGGGAAGAAGGGGCTTGGGG + Intergenic
1039680928 8:39735538-39735560 CAGGAAGCACAAGGGGTTAGGGG + Intergenic
1039967140 8:42291637-42291659 TAAGAGGCACAAGGGCCTGGAGG - Intronic
1040556678 8:48485764-48485786 CAGGAAGCACAAGGGGTTGGGGG + Intergenic
1042633282 8:70844490-70844512 CAGCAGCAACAATAGGCTGGGGG - Intergenic
1042878936 8:73466470-73466492 CAGGAAGAAAAAGGGGGTGGAGG + Intronic
1042971444 8:74413614-74413636 CAGCAGAAACAAGGGCCTGTAGG + Intronic
1043605167 8:81991041-81991063 CAGGAAGCACAAGGGGTTGGGGG - Intergenic
1043735152 8:83731513-83731535 CAGCAGGAGCAAGGAGCAGGTGG - Intergenic
1044449210 8:92314101-92314123 CAGGAAGCATAAGGGGTTGGGGG - Intergenic
1044576997 8:93780304-93780326 CAGGAAGCGCAAGGGGTTGGGGG - Intronic
1045360065 8:101424835-101424857 GAGGAGGAACAAAGGCCTGTTGG - Intergenic
1045646993 8:104308772-104308794 CAGGAAGTGCAAGGGGTTGGGGG + Intergenic
1046092377 8:109518940-109518962 CAGGAAGGACAAGCTGCTGGAGG + Intronic
1047424208 8:124730483-124730505 CATGAGAGACAAGGGCCTGGTGG - Intergenic
1047739373 8:127794516-127794538 CCGGAGGAGCGCGGGGCTGGCGG - Intergenic
1047775641 8:128068083-128068105 CAGCAGGAACAGGGGGCAAGAGG - Intergenic
1048353469 8:133634602-133634624 GAGGAGGAACAAGAAGCTGCAGG - Intergenic
1048494730 8:134925683-134925705 CATGGGGTAGAAGGGGCTGGAGG + Intergenic
1048981784 8:139706358-139706380 GAGGAAGAACCAGGGTCTGGGGG - Intergenic
1049659875 8:143815155-143815177 CCGGAGGAATCACGGGCTGGGGG + Intronic
1049798527 8:144507263-144507285 CAGGAGGAAGAGGTGGGTGGTGG - Intergenic
1049850974 8:144829984-144830006 CAGGAGGGGCAAGGGGATGACGG - Intronic
1049880460 8:145058615-145058637 CAGGATCAACAATGGGCTGTGGG - Intergenic
1050412959 9:5385437-5385459 CAGGAGGATCACGAGGCAGGAGG - Intronic
1050555700 9:6788100-6788122 TCGGAGGAACAAAGGGCTGAAGG - Intronic
1051210055 9:14731869-14731891 CAGCAGGAAGGAGGAGCTGGGGG - Intergenic
1051452046 9:17207598-17207620 CAGGAAGTACAAGGAGCTGGGGG - Intronic
1051614810 9:18997152-18997174 CAGGAAGAACAAGGGGTTGGGGG + Intronic
1051844641 9:21438018-21438040 CAGGTGGCTCCAGGGGCTGGAGG - Intronic
1051875969 9:21793853-21793875 GTGGAGGATCAAGGGACTGGAGG - Intergenic
1051875973 9:21793869-21793891 GTGGAGGATCAAGGGGGTGGAGG - Intergenic
1052125205 9:24765664-24765686 CAGGAAGCACAAGGGGTTGGGGG - Intergenic
1052335470 9:27315075-27315097 CAGGAGGCCAGAGGGGCTGGAGG + Intergenic
1052391472 9:27883237-27883259 CAGGAGGAAGAAAGAGCAGGCGG - Intergenic
1052819858 9:33129893-33129915 GAGGAGGAGGAAGTGGCTGGAGG + Intronic
1052849861 9:33371284-33371306 CAGCAGGAACAGGTGACTGGAGG + Intergenic
1052857908 9:33418408-33418430 CAGCAGGAAGAGGGGGCTTGAGG + Intergenic
1052887706 9:33666209-33666231 CAGGAAGCACAAGGGGTCGGGGG + Intergenic
1053144864 9:35705502-35705524 CATCAGGAACAAGGGGCAGGGGG + Intronic
1053350723 9:37411772-37411794 AAGGAGGAGCAAGGGGATGGAGG - Intergenic
1053463836 9:38290614-38290636 CAGTAGGAAAAAAGGCCTGGTGG - Intergenic
1053510588 9:38684694-38684716 CATGAGGAAAGAGGGGCTAGTGG - Intergenic
1053751742 9:41263939-41263961 CAGGAAGTGCAAGGGGTTGGGGG - Intergenic
1054334048 9:63787457-63787479 CAGGAAGTGCAAGGGGTTGGGGG + Intergenic
1054857242 9:69914339-69914361 CAGGAGGCAGAAGGGGTGGGGGG - Intergenic
1055053241 9:72000426-72000448 CAGGAAGTGCAAGGGGTTGGGGG - Intergenic
1055712403 9:79077445-79077467 CAGGAAGAACACTGGGCTGAGGG - Intergenic
1056668044 9:88597502-88597524 CGGGAAGTGCAAGGGGCTGGGGG + Intergenic
1056723124 9:89088682-89088704 AAGGAGGAACAACGAGCTGTGGG + Intronic
1057018541 9:91677521-91677543 CAGCAGGAAGAAGGAGGTGGTGG + Intronic
1057382538 9:94582047-94582069 CTGGTGGAACAAGAGCCTGGGGG - Intronic
1058011970 9:99988739-99988761 CAGGAAGCACAAGGGATTGGGGG + Intronic
1058093317 9:100829850-100829872 CAGGAAGCACAAGGGGTTGGAGG - Intergenic
1058110613 9:101028294-101028316 CAGGAGGAACCACAGGCTGCAGG - Intergenic
1058429470 9:104905197-104905219 CATGAGGAACAAGGAGCAGAAGG + Intronic
1058946032 9:109857137-109857159 CAGGAGGAGGAAGGGGCAGAAGG - Intronic
1058983818 9:110193919-110193941 CAGGAAGAACCTGAGGCTGGAGG + Intronic
1059471652 9:114509363-114509385 CAGGAGGAAGAAGAGGCTCAAGG + Intergenic
1060106979 9:120878659-120878681 CAGGGGGATCAAGGGGCAGAAGG - Intronic
1060186514 9:121567156-121567178 CAGGTGGGGCCAGGGGCTGGGGG + Exonic
1060705094 9:125791552-125791574 CAGGAGGAAGAGAGGGCAGGGGG - Intronic
1060724062 9:125995765-125995787 CGAGAGAAACAAGGAGCTGGAGG - Intergenic
1060788930 9:126472485-126472507 AAGGAGGAAAAAGGGGGTGGTGG - Intronic
1060945199 9:127566416-127566438 CAGGAGCCCCACGGGGCTGGTGG - Intronic
1061315919 9:129795720-129795742 CAGGAGAGAGAAGGGGCGGGGGG + Intergenic
1062050282 9:134443528-134443550 GAGGAGCAAGAAGGGACTGGAGG - Intergenic
1062185833 9:135217994-135218016 CCGGAGGAGGAAGGGCCTGGGGG - Intergenic
1062202148 9:135309259-135309281 CAGAAGGGACAAGGGAGTGGTGG - Intergenic
1062500350 9:136849421-136849443 GAGGAGGAACATGGCGGTGGCGG + Exonic
1062524452 9:136972618-136972640 CAGGAGGAAGGAGGGCCTCGTGG - Intergenic
1062610018 9:137369427-137369449 CAGGAGGAGCAGAGGGCGGGCGG - Intronic
1062759346 9:138330436-138330458 CAGGAAGTGCAAGGGGTTGGGGG - Intergenic
1203661869 Un_KI270753v1:52159-52181 GTGGAGGAGGAAGGGGCTGGGGG + Intergenic
1185603636 X:1355089-1355111 CAGGAGGAAGAAGGAGCGGGAGG + Intronic
1186246618 X:7622487-7622509 AAGGAGGAAGAGGGGGATGGAGG - Intergenic
1186253374 X:7693248-7693270 CAGGAGGAACCAAGGACTCGAGG + Intergenic
1186679911 X:11862004-11862026 GAGCAGGAGCAAGGGGTTGGGGG + Intergenic
1186883375 X:13888666-13888688 CAGGAAAAAAAAGGGGGTGGGGG - Intronic
1187278154 X:17834725-17834747 CAGGAGGAAAAAGGAGGTTGAGG + Intronic
1187358538 X:18602083-18602105 CAAGAGGAGAGAGGGGCTGGGGG - Intronic
1187729499 X:22238317-22238339 CGGGAAGCACAAGGGGTTGGGGG + Intronic
1187944456 X:24412660-24412682 GACCAGGAACAAGGGGCTAGGGG - Intergenic
1188496278 X:30786407-30786429 CTTGAGGAAAAAGGAGCTGGTGG + Intergenic
1188746914 X:33856266-33856288 CAGGAGGAAAAAGGGGGCTGTGG + Intergenic
1189540939 X:41987788-41987810 CAGTAGTTACAAGAGGCTGGGGG + Intergenic
1189724544 X:43954993-43955015 GTGGAGGAAGGAGGGGCTGGAGG - Intronic
1190157535 X:48005971-48005993 CAGGAGATACATGGGACTGGTGG + Intronic
1190167160 X:48082807-48082829 CAGGAGGGACAACCTGCTGGTGG + Intergenic
1190173305 X:48128856-48128878 CAGGAGATACATGGGACTGGTGG + Intergenic
1190622223 X:52298907-52298929 CAGGAAGCACAAGGGGTCGGGGG + Intergenic
1191121706 X:56912901-56912923 CAGGAAGAACAAGGGGTCAGAGG - Intergenic
1191122514 X:56921094-56921116 CAGGAAGTGCAAGGGGTTGGGGG - Intergenic
1191132694 X:57031264-57031286 CAGGAATTACAAGGAGCTGGGGG - Intergenic
1191202860 X:57803347-57803369 CAGGAGGAAAAAGTGGTTTGTGG + Intergenic
1192629061 X:72760935-72760957 CAGGAAGCACAAGGGGTCGGGGG - Intergenic
1192652649 X:72959879-72959901 CAGGAAGCACAAGGGGTCGGGGG + Intergenic
1193281547 X:79656391-79656413 CTGGAAGCACAAGGGGTTGGGGG - Intergenic
1193338548 X:80319454-80319476 CAGGAAGTACAAGGGGTTGGGGG + Intergenic
1193715991 X:84935155-84935177 AAGCAAGAACAAGGGGGTGGTGG + Intergenic
1195031183 X:100929059-100929081 CAGGATGAAGAAAAGGCTGGAGG + Intronic
1195774863 X:108391768-108391790 CAGGAAGCACAAGGGGTCGGGGG - Intronic
1196012541 X:110904265-110904287 CAGGAAGTGCAAGGGGTTGGGGG - Intergenic
1196094492 X:111784630-111784652 CAGGAAGCACAAGGGGTTGGGGG + Intronic
1197241237 X:124125274-124125296 CAGGAGGGTAAAGAGGCTGGGGG - Intronic
1198062530 X:133061683-133061705 CAGGAAGTGCAAGGAGCTGGGGG + Intronic
1198736563 X:139792109-139792131 AAGGAGGAAAGAGGGGCTGAAGG + Intronic
1199968548 X:152841241-152841263 CAGGAAGTGCAAGGGGTTGGGGG - Intronic
1200059440 X:153477686-153477708 CAGGACGCACAAGGAGATGGTGG + Intronic
1200140735 X:153901772-153901794 AGGGAGGAACAACGGGTTGGAGG - Intronic
1201938673 Y:19435090-19435112 CAGGAAGCACAAAGGGTTGGGGG + Intergenic