ID: 1101891062

View in Genome Browser
Species Human (GRCh38)
Location 12:108715774-108715796
Sequence GCGGTTGGTGTGAGACCTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 85
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 78}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101891062 Original CRISPR GCGGTTGGTGTGAGACCTCT TGG (reversed) Intronic
901778606 1:11577617-11577639 GGGGTGGGTGTGAGCCCTGTGGG - Intergenic
902988091 1:20167794-20167816 GCATTTGGTCTGAGACCTCAGGG - Intronic
903263079 1:22141924-22141946 GCGGATGGTGGCAGAGCTCTGGG + Intronic
914666770 1:149839244-149839266 GATGTTGGTGTCAGACATCTAGG - Intergenic
914668997 1:149854546-149854568 GATGTTGGTGTCAGACATCTAGG + Intronic
919818536 1:201457742-201457764 GTGGTTAGTGTGAGACACCTTGG + Intergenic
924297309 1:242600863-242600885 GAGGATGGTTTGACACCTCTAGG - Intergenic
1062787050 10:273429-273451 ACGGCTGGTGTGAGACCTGCAGG - Intergenic
1064655215 10:17549694-17549716 GGGGTGAGTGTGAGTCCTCTGGG - Intergenic
1078760368 11:14246580-14246602 GGGGTAGGTGTGAGACCATTTGG - Intronic
1082868316 11:57919920-57919942 GCGCTTTGAGAGAGACCTCTTGG + Intergenic
1084275683 11:68049901-68049923 GCGGGTGGTGGGGGACCTCCTGG + Intronic
1084423095 11:69070646-69070668 GCTGTTGGTGGGGGATCTCTGGG - Intronic
1084423134 11:69070759-69070781 GCTGTTGGTGGGGGATCTCTGGG - Intronic
1089741798 11:120589691-120589713 GCGGGTGGTGAGAGACCTGAGGG - Intronic
1092957524 12:13563695-13563717 GTGCTTGATGTGAGACCTGTTGG + Exonic
1096212207 12:49775532-49775554 GAGGGTGGAGTGAGAGCTCTAGG - Intergenic
1098915156 12:76249607-76249629 GTGGTTGGTCTGAGCCCGCTGGG + Intergenic
1101891062 12:108715774-108715796 GCGGTTGGTGTGAGACCTCTTGG - Intronic
1104968784 12:132521844-132521866 GGGGCTGGTGTGGGGCCTCTTGG + Intronic
1106316982 13:28602985-28603007 GCAGTTTGTGTGAGCCCCCTTGG - Intergenic
1128134853 15:65255222-65255244 GGGGATAGTGTGAGGCCTCTGGG - Intronic
1128889727 15:71320010-71320032 GTGGTTGTTGTTAGATCTCTTGG + Intronic
1129659050 15:77542934-77542956 GCCGTGGGTGAGAGAGCTCTAGG - Intergenic
1140416708 16:74778767-74778789 TCTGTTGATGTGAGGCCTCTAGG - Intergenic
1141221054 16:82069675-82069697 GCAGTTGGATTGAGAACTCTTGG - Intronic
1154222646 18:12470509-12470531 GAGGTTAGTGTGATTCCTCTGGG - Intronic
1163472804 19:17507050-17507072 CCGGCTGGTGTGAGAGCTCTGGG + Intergenic
1163772971 19:19201915-19201937 GGAGAAGGTGTGAGACCTCTAGG - Exonic
1167262128 19:48464733-48464755 AGGGTTGGTGTGAGAACTCGGGG - Exonic
928363907 2:30687262-30687284 GCTGCTGGTGAGAGCCCTCTGGG + Intergenic
942500690 2:176587486-176587508 GTGGTTGATGTGGGACTTCTGGG + Intergenic
946909925 2:224449956-224449978 GAGCTTGGGGTGAGACCTCAGGG - Intergenic
948259862 2:236595635-236595657 GCGTTTGGTGTAGGAGCTCTGGG + Intergenic
948861358 2:240754228-240754250 GCATTTGGTGTCAGACCTCCGGG - Intronic
1173302792 20:41818649-41818671 GGGGTTGTTGTGAGACATGTAGG + Intergenic
1175160267 20:57003061-57003083 GGGGTTGGTGTCAGAGCTCCGGG + Intergenic
1176412003 21:6454175-6454197 GAGGCTGGGGTGAGACCTCTGGG - Intergenic
1179687497 21:43062497-43062519 GAGGCTGGGGTGAGACCTCTGGG - Intronic
1180211140 21:46296031-46296053 AGGGTTGCTGTGAGACCCCTGGG - Intronic
1183428482 22:37751912-37751934 GGGGCTGGTGTGAGAACCCTGGG + Intronic
1183489722 22:38109905-38109927 GTGGGTGGTGTGAGGCCTCCAGG + Intronic
1184092275 22:42299057-42299079 GCGGTGGGTGTGGGAACCCTTGG - Intronic
950532510 3:13560472-13560494 GTGGGTGGTGTGAGACCCCAAGG - Intronic
953343967 3:42159942-42159964 GCAGTTGCTGTGAGACTTCTAGG + Intronic
953956409 3:47235320-47235342 GTGGTTGGTGGGACTCCTCTAGG + Intronic
954446136 3:50547827-50547849 GAGGATGGGGTGAGCCCTCTGGG - Intergenic
955194103 3:56788754-56788776 GGGGTTGGTGTGTGAGCTCTGGG - Intronic
958259384 3:91362483-91362505 GTGTCTGGTGTGAGTCCTCTTGG + Intergenic
967503034 3:190222329-190222351 GGGGGTGGGGTGAGACCTATGGG + Intergenic
968830552 4:2931271-2931293 GCGGCTGGTGGGAGACATCGAGG + Exonic
969122190 4:4918872-4918894 GAGGTGCGTGTGAGACCTCCTGG - Intergenic
975847823 4:78543473-78543495 GCGGTTGCTGGGAGCACTCTGGG - Intronic
980729878 4:136811881-136811903 GCTGTCGGTGTGAGAACGCTTGG - Intergenic
983266788 4:165515761-165515783 GCGGTTGGTGTCAGAAGTGTGGG + Intergenic
985008789 4:185561334-185561356 GCTGTTGGTGTCACAGCTCTTGG + Intergenic
985008796 4:185561439-185561461 GCTGTTGGTGTCACAGCTCTTGG + Intergenic
985008800 4:185561499-185561521 GCTGTTGGTGTCACAGCTCTTGG + Intergenic
985555987 5:558240-558262 GGGGTTGGTTTGAGAGGTCTGGG + Intergenic
989168042 5:38449547-38449569 GGGGTTAGTGAGAGACCACTAGG + Intronic
995329205 5:110928066-110928088 GCGATTGCTCTGAGACCTATGGG - Intergenic
996084474 5:119290578-119290600 GCTGTTGGTGTGTGACTTATTGG + Intronic
999250508 5:150179710-150179732 GGGGTGGCTGTGAGTCCTCTGGG + Intronic
1003701966 6:8476462-8476484 GCTGTTGGTGTTAGAAATCTTGG - Intergenic
1004486845 6:16074057-16074079 GAGGCTGGTGTGACACCCCTGGG - Intergenic
1008995852 6:57657842-57657864 GTGTCTGGTGTGAGTCCTCTTGG - Intergenic
1009184381 6:60556624-60556646 GTGTCTGGTGTGAGTCCTCTTGG - Intergenic
1010202948 6:73299064-73299086 GAGGCTGGTGTCAGACCTATTGG + Intronic
1013586998 6:111588297-111588319 GGGGTTGGGGAGAGACATCTAGG - Intronic
1018059462 6:160079134-160079156 GCAGTAGGTGTGAGCCTTCTGGG + Intronic
1018831836 6:167449128-167449150 TCAGGTGGTGTGAGCCCTCTTGG - Intergenic
1021571011 7:22065262-22065284 GAGGTAGGGGTGGGACCTCTGGG + Intergenic
1032322893 7:130900593-130900615 GGGGTAGGGGTGAGAGCTCTCGG - Intergenic
1032690624 7:134283081-134283103 GTGGTTGTGGTGAGTCCTCTTGG + Intergenic
1034104540 7:148479055-148479077 GTGGTTGGTGTGTGCCTTCTGGG - Intergenic
1035430318 7:158815261-158815283 GCTGTTGGGCTGAGTCCTCTTGG + Intronic
1036075689 8:5497114-5497136 GAGGTTGCTGTGAGAATTCTTGG + Intergenic
1036651130 8:10644719-10644741 GTGGCTGGTGTGAGAGCTGTGGG - Intronic
1041157385 8:55002666-55002688 TGGGTTGGTGTGAGACCCCATGG + Intergenic
1043578890 8:81689307-81689329 GCTGTTGAGGTGAGGCCTCTTGG - Intergenic
1053288755 9:36866383-36866405 GAGGTTGGTCTGAGACCTGCAGG - Intronic
1060232740 9:121837788-121837810 GCGTTTGGCGTGAGCCCTTTGGG - Intronic
1062361682 9:136191250-136191272 GCAGTGGGTGTGTGACCTCTTGG + Intergenic
1193939595 X:87664822-87664844 GCTGTTGCTGTGTGCCCTCTTGG + Exonic
1200062834 X:153491250-153491272 GCGGGTGGTGTGAGTCCTAGAGG - Intronic