ID: 1101895851

View in Genome Browser
Species Human (GRCh38)
Location 12:108756014-108756036
Sequence GAACTCTGGCCTGCAGAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101895851_1101895855 13 Left 1101895851 12:108756014-108756036 CCTGTCTCTGCAGGCCAGAGTTC No data
Right 1101895855 12:108756050-108756072 AAATGAGGATTTCCTCTTTAAGG No data
1101895851_1101895856 19 Left 1101895851 12:108756014-108756036 CCTGTCTCTGCAGGCCAGAGTTC No data
Right 1101895856 12:108756056-108756078 GGATTTCCTCTTTAAGGTCCTGG No data
1101895851_1101895853 -2 Left 1101895851 12:108756014-108756036 CCTGTCTCTGCAGGCCAGAGTTC No data
Right 1101895853 12:108756035-108756057 TCCTGCACTAAAGTCAAATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101895851 Original CRISPR GAACTCTGGCCTGCAGAGAC AGG (reversed) Intergenic
No off target data available for this crispr