ID: 1101895853

View in Genome Browser
Species Human (GRCh38)
Location 12:108756035-108756057
Sequence TCCTGCACTAAAGTCAAATG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101895849_1101895853 12 Left 1101895849 12:108756000-108756022 CCACAGCACAGGATCCTGTCTCT No data
Right 1101895853 12:108756035-108756057 TCCTGCACTAAAGTCAAATGAGG No data
1101895847_1101895853 26 Left 1101895847 12:108755986-108756008 CCAGGACTATCTGTCCACAGCAC No data
Right 1101895853 12:108756035-108756057 TCCTGCACTAAAGTCAAATGAGG No data
1101895851_1101895853 -2 Left 1101895851 12:108756014-108756036 CCTGTCTCTGCAGGCCAGAGTTC No data
Right 1101895853 12:108756035-108756057 TCCTGCACTAAAGTCAAATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101895853 Original CRISPR TCCTGCACTAAAGTCAAATG AGG Intergenic
No off target data available for this crispr