ID: 1101895856

View in Genome Browser
Species Human (GRCh38)
Location 12:108756056-108756078
Sequence GGATTTCCTCTTTAAGGTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101895851_1101895856 19 Left 1101895851 12:108756014-108756036 CCTGTCTCTGCAGGCCAGAGTTC No data
Right 1101895856 12:108756056-108756078 GGATTTCCTCTTTAAGGTCCTGG No data
1101895852_1101895856 5 Left 1101895852 12:108756028-108756050 CCAGAGTTCCTGCACTAAAGTCA No data
Right 1101895856 12:108756056-108756078 GGATTTCCTCTTTAAGGTCCTGG No data
1101895854_1101895856 -3 Left 1101895854 12:108756036-108756058 CCTGCACTAAAGTCAAATGAGGA No data
Right 1101895856 12:108756056-108756078 GGATTTCCTCTTTAAGGTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101895856 Original CRISPR GGATTTCCTCTTTAAGGTCC TGG Intergenic
No off target data available for this crispr