ID: 1101897943

View in Genome Browser
Species Human (GRCh38)
Location 12:108769886-108769908
Sequence TCTCTTGCTGGTTCCAGCTT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101897943_1101897946 -5 Left 1101897943 12:108769886-108769908 CCGAAGCTGGAACCAGCAAGAGA No data
Right 1101897946 12:108769904-108769926 AGAGACAGGCTCTGTGACCTTGG No data
1101897943_1101897949 18 Left 1101897943 12:108769886-108769908 CCGAAGCTGGAACCAGCAAGAGA No data
Right 1101897949 12:108769927-108769949 ACAAGTAACTGCCTCTCTCTGGG No data
1101897943_1101897948 17 Left 1101897943 12:108769886-108769908 CCGAAGCTGGAACCAGCAAGAGA No data
Right 1101897948 12:108769926-108769948 GACAAGTAACTGCCTCTCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101897943 Original CRISPR TCTCTTGCTGGTTCCAGCTT CGG (reversed) Intergenic