ID: 1101897945

View in Genome Browser
Species Human (GRCh38)
Location 12:108769898-108769920
Sequence TCACAGAGCCTGTCTCTTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101897945_1101897949 6 Left 1101897945 12:108769898-108769920 CCAGCAAGAGACAGGCTCTGTGA No data
Right 1101897949 12:108769927-108769949 ACAAGTAACTGCCTCTCTCTGGG No data
1101897945_1101897948 5 Left 1101897945 12:108769898-108769920 CCAGCAAGAGACAGGCTCTGTGA No data
Right 1101897948 12:108769926-108769948 GACAAGTAACTGCCTCTCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101897945 Original CRISPR TCACAGAGCCTGTCTCTTGC TGG (reversed) Intergenic