ID: 1101897946

View in Genome Browser
Species Human (GRCh38)
Location 12:108769904-108769926
Sequence AGAGACAGGCTCTGTGACCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101897943_1101897946 -5 Left 1101897943 12:108769886-108769908 CCGAAGCTGGAACCAGCAAGAGA No data
Right 1101897946 12:108769904-108769926 AGAGACAGGCTCTGTGACCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101897946 Original CRISPR AGAGACAGGCTCTGTGACCT TGG Intergenic