ID: 1101897948 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 12:108769926-108769948 |
| Sequence | GACAAGTAACTGCCTCTCTC TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1101897943_1101897948 | 17 | Left | 1101897943 | 12:108769886-108769908 | CCGAAGCTGGAACCAGCAAGAGA | No data | ||
| Right | 1101897948 | 12:108769926-108769948 | GACAAGTAACTGCCTCTCTCTGG | No data | ||||
| 1101897945_1101897948 | 5 | Left | 1101897945 | 12:108769898-108769920 | CCAGCAAGAGACAGGCTCTGTGA | No data | ||
| Right | 1101897948 | 12:108769926-108769948 | GACAAGTAACTGCCTCTCTCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1101897948 | Original CRISPR | GACAAGTAACTGCCTCTCTC TGG | Intergenic | ||