ID: 1101897949

View in Genome Browser
Species Human (GRCh38)
Location 12:108769927-108769949
Sequence ACAAGTAACTGCCTCTCTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101897945_1101897949 6 Left 1101897945 12:108769898-108769920 CCAGCAAGAGACAGGCTCTGTGA No data
Right 1101897949 12:108769927-108769949 ACAAGTAACTGCCTCTCTCTGGG No data
1101897943_1101897949 18 Left 1101897943 12:108769886-108769908 CCGAAGCTGGAACCAGCAAGAGA No data
Right 1101897949 12:108769927-108769949 ACAAGTAACTGCCTCTCTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101897949 Original CRISPR ACAAGTAACTGCCTCTCTCT GGG Intergenic