ID: 1101898551

View in Genome Browser
Species Human (GRCh38)
Location 12:108774008-108774030
Sequence TCCCCTCCCTGAAGGCCTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101898545_1101898551 3 Left 1101898545 12:108773982-108774004 CCACGCGCACAGGCCGCCCATGC No data
Right 1101898551 12:108774008-108774030 TCCCCTCCCTGAAGGCCTGTTGG No data
1101898546_1101898551 -10 Left 1101898546 12:108773995-108774017 CCGCCCATGCCTTTCCCCTCCCT No data
Right 1101898551 12:108774008-108774030 TCCCCTCCCTGAAGGCCTGTTGG No data
1101898544_1101898551 4 Left 1101898544 12:108773981-108774003 CCCACGCGCACAGGCCGCCCATG No data
Right 1101898551 12:108774008-108774030 TCCCCTCCCTGAAGGCCTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101898551 Original CRISPR TCCCCTCCCTGAAGGCCTGT TGG Intergenic