ID: 1101900085

View in Genome Browser
Species Human (GRCh38)
Location 12:108785445-108785467
Sequence GCATGTAAACAGATGGCACA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 3, 3: 20, 4: 164}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101900085_1101900092 27 Left 1101900085 12:108785445-108785467 CCATGTGCCATCTGTTTACATGC 0: 1
1: 0
2: 3
3: 20
4: 164
Right 1101900092 12:108785495-108785517 CTTACCCTTTTCTCCAGGCCAGG 0: 1
1: 0
2: 0
3: 36
4: 266
1101900085_1101900090 22 Left 1101900085 12:108785445-108785467 CCATGTGCCATCTGTTTACATGC 0: 1
1: 0
2: 3
3: 20
4: 164
Right 1101900090 12:108785490-108785512 TAAACCTTACCCTTTTCTCCAGG 0: 1
1: 0
2: 2
3: 22
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101900085 Original CRISPR GCATGTAAACAGATGGCACA TGG (reversed) Exonic
900338061 1:2174562-2174584 GCATGTAACCAGGAGGCCCAGGG + Intronic
900392458 1:2439689-2439711 CCAGGTGAACAGATGGCTCAGGG - Intronic
902755088 1:18543820-18543842 GTATTAAAACAGCTGGCACATGG + Intergenic
903376126 1:22867273-22867295 GCATGTATACAGAACCCACATGG - Intronic
912312501 1:108637872-108637894 GAGTGTAAACTGATGGCTCAGGG - Exonic
918311583 1:183289153-183289175 GCAAGGACACAGATGGGACATGG + Intronic
918562248 1:185882868-185882890 GCATTTACAAAGATGGCAAAAGG + Intronic
921174788 1:212584614-212584636 GCATTTAAACTGATGGATCAAGG - Intronic
921952326 1:220943338-220943360 TCATATAAACAGATGGGAAAAGG + Intergenic
922756509 1:228099990-228100012 GCATAAAGACAGATGGCACCTGG - Intergenic
1062899192 10:1129259-1129281 ACAGGTGAACAGATTGCACACGG - Exonic
1065805512 10:29390440-29390462 GCGTGGAAGCAGATGGCACAGGG + Intergenic
1068808112 10:61223604-61223626 GCATTTAAAACTATGGCACAGGG + Intergenic
1070361891 10:75698531-75698553 GCACATAAACAGGTGGCACATGG + Intronic
1070552174 10:77498476-77498498 AGATGCAAACAGTTGGCACAAGG + Intronic
1072415778 10:95245748-95245770 ACATGCAAACACATGGCCCATGG + Intronic
1073041414 10:100609604-100609626 ACAGGTAAACCCATGGCACATGG - Intergenic
1074222953 10:111456128-111456150 GCATGTAAACAGATGGTAAATGG - Intergenic
1079018033 11:16886202-16886224 GCATCTAACCAGATGCCACCTGG + Intronic
1080657111 11:34266780-34266802 ACATGTCTACAGAGGGCACAGGG - Intronic
1085000002 11:73024479-73024501 ACATGTAAACAGATGGCAGAGGG + Intronic
1085694148 11:78689741-78689763 GCACGGAAACAGTTGGCAAATGG - Intronic
1089178247 11:116563534-116563556 GCTTGTAAAGAGCTGGCACTTGG - Intergenic
1089222961 11:116890434-116890456 GAATGTAAACAAATGCCACTGGG + Intronic
1090851665 11:130576043-130576065 GTGTGAAAACAGCTGGCACAGGG - Intergenic
1092995686 12:13948287-13948309 GCATTTAAACATATGGGGCAGGG - Intronic
1093306121 12:17522795-17522817 GCATGAAAACTTATGGCACATGG + Intergenic
1095180764 12:39144864-39144886 GCCTGCAAACAGAGGGCCCAGGG + Intergenic
1098852758 12:75617057-75617079 GTAGGTAAACACATGTCACAGGG - Intergenic
1099083082 12:78210789-78210811 GCAACTGAACAGATTGCACATGG + Exonic
1101888100 12:108686892-108686914 GCATGTATACAGCTGGCACAAGG + Intronic
1101900085 12:108785445-108785467 GCATGTAAACAGATGGCACATGG - Exonic
1103515055 12:121502278-121502300 GCTGGTTTACAGATGGCACAGGG + Intronic
1106006853 13:25778710-25778732 GCATTTCATCAGAAGGCACAGGG - Intronic
1106747914 13:32723004-32723026 GTATGTAAACAGCCAGCACAGGG + Intronic
1109244697 13:59939548-59939570 GCATAAAGACAGGTGGCACATGG + Intronic
1111406628 13:87814955-87814977 GCTTGTAAGTAGATGGCACATGG + Intergenic
1113743418 13:112726184-112726206 GCATGCAAAGAGAAGGCCCAGGG + Intronic
1115360484 14:32494974-32494996 GAATGTAAGCTGATGGCAAAGGG - Intronic
1122166460 14:99828315-99828337 GGATGAAAGCAGACGGCACAAGG - Intronic
1124627977 15:31320316-31320338 TCATGTGTACACATGGCACAGGG - Intergenic
1128467016 15:67921318-67921340 GCATGAAAACACAAGGCAAAGGG + Intergenic
1129690376 15:77709976-77709998 GGATGGAAAGAGATGGCAAAAGG + Intronic
1129748530 15:78042657-78042679 GGACTTAATCAGATGGCACAGGG + Intronic
1130309277 15:82738853-82738875 GCATATAAAAACATGACACAGGG - Intergenic
1131315314 15:91330516-91330538 TTAAGTAAACAGATGGCAGATGG - Intergenic
1133482926 16:6189123-6189145 GCATGACAACAGATGGAAAATGG - Intronic
1133537350 16:6714732-6714754 GCATCTACACAGCTGGGACATGG + Intronic
1135002057 16:18785032-18785054 GCATGCAAAGAGATGGAACAAGG + Intronic
1135760302 16:25132641-25132663 GCATCTAGGCAGATGGGACAGGG - Intronic
1136567111 16:31077123-31077145 TCCTTGAAACAGATGGCACAGGG - Exonic
1138786624 16:59854161-59854183 GGAGGTACACAAATGGCACAAGG - Intergenic
1139466734 16:67158061-67158083 TCATGTAAACAGATGGCAGCTGG - Intronic
1140552315 16:75880042-75880064 GCAGGTAAACTCATGTCACAGGG + Intergenic
1141244741 16:82295237-82295259 GCATCTAAACTGATGGAAAATGG + Intergenic
1142730580 17:1852975-1852997 TTATGTAAACAGATGACAAATGG + Intronic
1142733167 17:1876711-1876733 GCATGGAAAAAGGAGGCACAGGG - Intronic
1144950600 17:18991638-18991660 CCATGTGAGCAGCTGGCACAGGG + Intronic
1145010774 17:19366450-19366472 GGGTGTAAAGAGAGGGCACATGG - Intronic
1150674137 17:67230047-67230069 TCATTAAAACAGATGGCAGAAGG - Intronic
1150867104 17:68863992-68864014 GTATGTAAACAGATCTCACTAGG - Intergenic
1150992426 17:70275188-70275210 TCATGAAAACACATAGCACATGG - Intergenic
1154333108 18:13446128-13446150 GCATGTAAACAGTGAGCACTCGG - Intronic
1156221806 18:35060238-35060260 GAAAGTAAACAGAAGGCATATGG + Intronic
1160035322 18:75296305-75296327 GCATGGAAACCATTGGCACAAGG - Intergenic
1160586537 18:79916396-79916418 GCAGGTGAACAGAGGGCAAAAGG - Intronic
1162109616 19:8393078-8393100 GAAGGAAAACAAATGGCACACGG - Intronic
1166918828 19:46214275-46214297 GCATGCACACAGATGGCACCTGG + Intergenic
1168376067 19:55880650-55880672 GCACGCAAACAGATGCCAAATGG + Intronic
925674863 2:6351381-6351403 GCAATTAAACAGATGGTACCGGG - Intergenic
926000130 2:9323937-9323959 ACGTGTATACAAATGGCACATGG + Intronic
928625688 2:33137852-33137874 GTAAGAAAACAGATGGCATAAGG - Intronic
929259477 2:39848636-39848658 GCATGTAATTAGATGCTACAGGG - Intergenic
934042109 2:88136218-88136240 GCAGGTAAACAACTGGCACAAGG + Intergenic
935916979 2:107965139-107965161 TTAAGTAAATAGATGGCACATGG + Intergenic
937331680 2:121034481-121034503 GCATGTAGACTGATGGCGGAGGG + Intergenic
938234652 2:129695952-129695974 CCATGAAAACAGCTGGGACAGGG + Intergenic
938861802 2:135377113-135377135 TTAAGTAAACAGATGGCAGATGG + Intronic
939906774 2:147925918-147925940 GCATGTAAACAGTTGGGAATAGG + Intronic
944164236 2:196701331-196701353 GTATGTAAACAGAAGTCACCTGG - Intronic
946833355 2:223747240-223747262 GCATTTACACAGATCTCACATGG + Intergenic
1170270312 20:14520156-14520178 ACATGTAAACTCATGTCACAGGG - Intronic
1170716204 20:18833103-18833125 GGATGTTAACAGATATCACATGG + Intergenic
1171099297 20:22367702-22367724 GTCTGGAAACAGAGGGCACATGG - Intergenic
1174260927 20:49294595-49294617 GGATGTAAAGGGATCGCACAAGG + Intergenic
1174321371 20:49744242-49744264 GAATGTTGGCAGATGGCACAGGG - Intergenic
1175568396 20:59999318-59999340 CCATGTAAACTGATGGTAAAAGG - Intronic
1177059619 21:16354507-16354529 AAATGAAAACAGATGGTACAGGG - Intergenic
1179707442 21:43190150-43190172 GCATGAAAACAAATGGCCCATGG - Intergenic
1181378546 22:22480550-22480572 GCAGGTAAAAGGATGGCAGAAGG - Intergenic
1184702451 22:46185185-46185207 GAGTGAAAACAGATGGAACATGG - Intronic
949305797 3:2639306-2639328 GCATGTTAACAGGTGGGGCAGGG - Intronic
950252256 3:11475532-11475554 GCATGTAAACTGCTGGGAAAAGG + Intronic
953327872 3:42028200-42028222 GCATGTAAACACGTGGCCCACGG - Intronic
955355830 3:58231872-58231894 GAATGTTAACAGATGGCAGAGGG - Intergenic
958117058 3:89234322-89234344 ACATGAAAACAGCTGTCACATGG - Intronic
958271355 3:91503399-91503421 CCAAGTAAACTGATGCCACAAGG - Intergenic
960179527 3:114558969-114558991 GCATGTAAGGAGATGGCATTTGG - Intronic
960425147 3:117497681-117497703 TTATGTATACAGGTGGCACAGGG - Intergenic
962149810 3:132880866-132880888 GCATGTCAGCAGTTGGCACATGG - Intergenic
962514307 3:136135687-136135709 ATATGTAAACACCTGGCACATGG + Intronic
962810848 3:138958464-138958486 GCATGTTAAAGGATGTCACAGGG - Intergenic
963971636 3:151436822-151436844 GCAAGTAAAGAGAGGACACATGG - Exonic
964680604 3:159334263-159334285 GCATGTCAACTCATGACACAAGG + Intronic
966664466 3:182455152-182455174 GCATGTGAAGAGGTGACACATGG + Intergenic
971381486 4:26102825-26102847 TCATGCAAACAGATTCCACAGGG - Intergenic
972248339 4:37270974-37270996 TCTTTTTAACAGATGGCACAAGG - Intronic
974118666 4:57611707-57611729 GCATGTAAGCAGGTGTGACATGG + Intergenic
974456107 4:62130913-62130935 GCATGTAAACACAGTGGACAAGG - Intergenic
974790697 4:66684395-66684417 GCATGCAAACAGATGTCTCAGGG - Intergenic
974848441 4:67379725-67379747 CCATATAAACAGATGTCATAAGG + Intergenic
974905033 4:68044987-68045009 GCAGATAAACACATGTCACAGGG - Intergenic
975704392 4:77097652-77097674 CCATGTGAACATATGGCAAAAGG + Intergenic
975756216 4:77573916-77573938 GTCTCTAAACAGATGGCACATGG - Intronic
977249714 4:94676258-94676280 GCATGTAACAAAATTGCACATGG - Intergenic
978302853 4:107291292-107291314 GAAACTAAACAGAAGGCACAAGG + Intergenic
979746732 4:124224095-124224117 GCAAGTATACTGATTGCACATGG - Intergenic
979804155 4:124950136-124950158 GCATGTATACATATGTAACAAGG - Intergenic
981045713 4:140263226-140263248 GCAAGTAAACATAAGTCACAAGG - Intronic
981110032 4:140924859-140924881 GCATGGAGGCAGCTGGCACAGGG + Intronic
981887886 4:149699772-149699794 GTAAGTAAATAAATGGCACAAGG - Intergenic
984037387 4:174686488-174686510 ACATGTAAACCAATGGCTCAGGG + Intronic
985690064 5:1303456-1303478 GCATAAAAACAGATGAGACATGG - Intergenic
985852096 5:2396542-2396564 GCATGTATACATGTGGGACATGG - Intergenic
985877658 5:2612585-2612607 GCATGTAAAATGAAGGCCCAGGG - Intergenic
987216297 5:15741088-15741110 CAATGCAAACAGGTGGCACAAGG + Intronic
991104757 5:62831804-62831826 GGATGTAAACAGATCTCATATGG + Intergenic
991235765 5:64395098-64395120 CCATATTTACAGATGGCACATGG + Intergenic
993175146 5:84474386-84474408 GCATGTCAACAGATGACTAAGGG + Intergenic
994953271 5:106493912-106493934 TCAAGTAAACAGATTACACAAGG + Intergenic
995183218 5:109248071-109248093 GCATGTAAATAGCTGGCCCTTGG + Intergenic
995504419 5:112844108-112844130 TCTTTTAAACAGATGTCACAAGG - Exonic
995775188 5:115717469-115717491 GCATGTGAACAGATGACATCAGG + Intergenic
996421562 5:123268482-123268504 GCATGGAAACTGATTGCACATGG - Intergenic
996523917 5:124457294-124457316 CAATGTAAACAGATGGCCCGTGG - Intergenic
999566458 5:152867818-152867840 GCATGTACAGAGATATCACATGG - Intergenic
999834719 5:155356915-155356937 GCTTGTAAACTCATGTCACAGGG - Intergenic
999921595 5:156327367-156327389 TCATGTAAACAGTTGGCATGGGG + Intronic
1000996905 5:167968751-167968773 ACATGTAATGAGAAGGCACAGGG + Intronic
1001069558 5:168573021-168573043 GAAACTAAACAGAAGGCACAAGG + Intronic
1001296189 5:170500809-170500831 GCATGTAAATATCTGGTACATGG + Intronic
1001679094 5:173543266-173543288 GCCTGTAAACAGATGGCGGGCGG - Intergenic
1003964268 6:11238140-11238162 GCTTGTAAACATCTGGCACAGGG - Intronic
1008983779 6:57517911-57517933 CCAAGTAAACTGATGCCACAAGG + Intronic
1009171838 6:60410818-60410840 CCAAGTAAACTGATGCCACAAGG + Intergenic
1009424818 6:63502336-63502358 GCAGGTAAGCAGTTGGCATAAGG - Intergenic
1012075718 6:94682372-94682394 GCATGTAAAGACATGGGACTTGG + Intergenic
1013066593 6:106689843-106689865 GCATGTTCACTGTTGGCACACGG - Intergenic
1014939982 6:127426543-127426565 GAAAGTAAACAGATGGAAAAAGG + Intergenic
1015866717 6:137734500-137734522 GCATGCAAACAGCTAGCCCAGGG + Intergenic
1018542243 6:164894841-164894863 AGATGTAAATACATGGCACATGG - Intergenic
1018854499 6:167666042-167666064 GCACGTACACAGGTGACACACGG - Intergenic
1023215744 7:37860901-37860923 TGATGTAAAGAGATGTCACAAGG - Intronic
1024909612 7:54430424-54430446 GGATGTAAAAAGATGGAAGAAGG + Intergenic
1026100535 7:67380520-67380542 GCATGTGTACATGTGGCACATGG + Intergenic
1026100555 7:67381137-67381159 GCATGTGTACATGTGGCACATGG + Intergenic
1026765643 7:73157825-73157847 AAAAGTAAACAGGTGGCACAGGG - Intergenic
1027042117 7:74967518-74967540 AAAAGTAAACAGGTGGCACAGGG - Intronic
1027081525 7:75234836-75234858 AAAAGTAAACAGGTGGCACAGGG + Intergenic
1029390111 7:100269421-100269443 AAAAGTAAACAGGTGGCACAGGG + Intronic
1033460116 7:141539276-141539298 TAATTTAAACAGATGGCTCAGGG + Intergenic
1034678398 7:152909466-152909488 CCATGTGAAGAGACGGCACAGGG + Intergenic
1035319446 7:158019330-158019352 GCATGTAATTAAATAGCACATGG + Intronic
1036209258 8:6828736-6828758 GCCTGTAGACAGATGGCACCAGG - Intronic
1039258325 8:35743232-35743254 GCATGAAAATAGAAGGCCCAGGG - Intronic
1039407712 8:37327230-37327252 AGTTGTAAACAGATGGAACAAGG - Intergenic
1040707574 8:50148223-50148245 GAATATAAATATATGGCACAGGG + Intronic
1040933424 8:52759020-52759042 GCATGTAACAAAATGTCACATGG + Intergenic
1041379840 8:57243439-57243461 GCATGCATACAAATGGCATATGG - Intergenic
1041559445 8:59198412-59198434 TTAAGTAAACAGATGGCAGATGG + Intergenic
1041616563 8:59914407-59914429 GCATGCAATCAGATGGCATCAGG + Intergenic
1042129815 8:65577003-65577025 GAAAGTAAACAGATGGAAAAAGG - Intergenic
1047784710 8:128142446-128142468 TCATCTAATCAGATGGCACTTGG - Intergenic
1050114532 9:2250047-2250069 ACATGTAAACAGTTTGCATATGG - Intergenic
1055685540 9:78769785-78769807 GCCTGTAAGAAGAGGGCACAGGG + Intergenic
1059752418 9:117260278-117260300 TCATGTGAACAGAGGGCAAAAGG + Intronic
1187375088 X:18744813-18744835 GCACTTAAATACATGGCACATGG - Intronic
1189357160 X:40318820-40318842 TCAGGAAAACAGATGGCACTTGG + Intergenic
1191649117 X:63517892-63517914 GCAGGGAAACAGATGACCCAGGG - Intergenic
1194088557 X:89558517-89558539 ACATGTATACATATGGCACATGG + Intergenic
1194944190 X:100048613-100048635 GCAGGTGAACAGAAGGCAGAAGG + Intergenic
1195614535 X:106902105-106902127 GCATGTGAACACACGTCACAAGG + Intronic
1196815383 X:119661631-119661653 GCATTTAACCAGAAGTCACATGG - Intronic
1197586685 X:128356701-128356723 GAATGTAAATAGTTGGCACATGG + Intergenic
1199712128 X:150477018-150477040 GCCTGAAGATAGATGGCACAGGG + Intronic
1200441232 Y:3214564-3214586 ACATGTATACATATGGCACATGG + Intergenic
1201797579 Y:17915157-17915179 GTTTGCAAACAGTTGGCACAAGG - Intergenic
1201803974 Y:17990802-17990824 GTTTGCAAACAGTTGGCACAAGG + Intergenic