ID: 1101902905

View in Genome Browser
Species Human (GRCh38)
Location 12:108804512-108804534
Sequence GAGCTACAGGACCCGGGTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 129}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101902896_1101902905 13 Left 1101902896 12:108804476-108804498 CCGTGGAGGTGCACAGAAATCAG 0: 1
1: 0
2: 1
3: 20
4: 246
Right 1101902905 12:108804512-108804534 GAGCTACAGGACCCGGGTGAGGG 0: 1
1: 0
2: 1
3: 5
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101902905 Original CRISPR GAGCTACAGGACCCGGGTGA GGG Intronic
901579337 1:10227898-10227920 GAGCCACAGCACCCGGCTGAGGG - Intronic
903947539 1:26973109-26973131 GAGCCATCGGACCCGGCTGAAGG - Intergenic
903999210 1:27328948-27328970 GCCCTACAGGACCTGGGTGCTGG - Intronic
905486646 1:38302039-38302061 GAGCCACCGCACCCGGCTGAGGG + Intergenic
906535433 1:46548586-46548608 GAGGTATAGGACCTGGGGGAGGG + Intronic
906672563 1:47667150-47667172 GAGCCACTGCACCCGGCTGATGG + Intergenic
908529831 1:65023765-65023787 GAGCTACTGCACCCTGCTGAGGG + Intergenic
910803045 1:91164425-91164447 GAGCTGCAGGACCCAGGTGAAGG + Intergenic
911122693 1:94311897-94311919 GAGACACAGGGCCCAGGTGAGGG - Intergenic
922029415 1:221783576-221783598 GGTCTGCAGGACCCGGGTGCGGG - Intergenic
922071052 1:222193834-222193856 AAGGGACAGGACCCTGGTGAGGG - Intergenic
1065629136 10:27659781-27659803 CAGGTAAAGGACCCTGGTGAAGG - Intergenic
1067173882 10:43929003-43929025 GAGCTTCAGGGATCGGGTGAAGG + Intergenic
1068386706 10:56338400-56338422 AAGGTACACTACCCGGGTGATGG - Intergenic
1070283815 10:75069510-75069532 GAGCGGCAGGACCATGGTGAGGG - Intergenic
1071573052 10:86708457-86708479 GAGCTACAGGTCCTGAGTCAGGG - Intronic
1079990811 11:27244567-27244589 GACCTACAGGAGCCAAGTGACGG + Intergenic
1080741117 11:35065119-35065141 GTGCTCTAGGACCCGGTTGAGGG - Intergenic
1083883077 11:65557963-65557985 GGGCCGCAGGACCCGGGGGAGGG + Exonic
1089541563 11:119192258-119192280 GAGCCACCGCACCCGGTTGAAGG + Intronic
1090077806 11:123590526-123590548 AAGTTACAGGATCTGGGTGATGG - Intronic
1090778627 11:129986753-129986775 CAGCTCCATGACCCAGGTGAGGG + Intronic
1091368950 11:135042998-135043020 GAGCCACAGGCCCTGGGTCAGGG - Intergenic
1091687858 12:2576339-2576361 GCTCTACAGCACCCGGGTGCCGG - Intronic
1091717582 12:2790644-2790666 GAGCCACAGGACCCGGGCCTTGG - Intergenic
1092027768 12:5257444-5257466 GATATACACTACCCGGGTGACGG + Intergenic
1092128947 12:6095080-6095102 GAGCCACAGGACCCGGCTTCAGG + Intronic
1092238991 12:6826256-6826278 GAGCCACAGGACCAGGGAGCCGG + Exonic
1092847921 12:12601356-12601378 GATCTACAGGAACTTGGTGAAGG - Intergenic
1092925663 12:13269874-13269896 AAGCAGCAGCACCCGGGTGAGGG + Intergenic
1094236352 12:28171486-28171508 GAAATACAGGACCCAGGCGAAGG - Intronic
1095393691 12:41739659-41739681 GAGCTACAGGACAATGCTGAAGG - Intergenic
1095984142 12:47988548-47988570 GAGGTCCCGGAGCCGGGTGAAGG - Intronic
1096556170 12:52405363-52405385 GAGCTAGAGGCACAGGGTGACGG - Intronic
1097541636 12:60951494-60951516 GAGCCACATGACCCAGGAGAAGG + Intergenic
1101902905 12:108804512-108804534 GAGCTACAGGACCCGGGTGAGGG + Intronic
1102701502 12:114843353-114843375 CAGCTCCAGGACCCAGGTCAGGG + Intergenic
1104624058 12:130338318-130338340 GAGATGCAGGAGCCGGGTGCGGG + Intronic
1104624072 12:130338360-130338382 GAGATGCAGGAGCCGGGTGCGGG + Intronic
1104624100 12:130338444-130338466 GAGATGCAGGAGCCGGGTGCGGG + Intronic
1104624114 12:130338486-130338508 GAGATGCAGGAGCCGGGTGCGGG + Intronic
1104624141 12:130338570-130338592 GAGATGCAGGAGCCGGGTGCGGG + Intronic
1104624171 12:130338654-130338676 GAGATGCAGGAGCCGGGTGCGGG + Intronic
1113835203 13:113324499-113324521 GAGCTGCAGGGCCCGGCTGCTGG - Intronic
1113839043 13:113348087-113348109 GTGCTACTGGACCTGGGAGAGGG + Intronic
1114131270 14:19796161-19796183 TGGCTTCAGGACCCGGGTGTTGG + Intronic
1114318358 14:21526404-21526426 GAGCTAGAGGAGGCGGGAGAAGG + Intronic
1114494001 14:23120135-23120157 GAGCCTCAGGCCCAGGGTGAGGG - Intergenic
1120525822 14:85575771-85575793 GGGCTTCAGGAGCTGGGTGAAGG - Intronic
1122441549 14:101735561-101735583 GAACTACAGGGCACGGGTTATGG - Intergenic
1126809045 15:52382184-52382206 GAGCCACTGCACCCGGCTGACGG + Intronic
1129108304 15:73323427-73323449 GAGCCACAGGCCCCGGGGGGTGG + Exonic
1129761592 15:78131831-78131853 GAGGGACAGGGCCCGGGTAAGGG - Intronic
1129807835 15:78479242-78479264 GAGCCACTGGACCTGGCTGAGGG + Intronic
1129977098 15:79831503-79831525 AAGCTTCAGGACCCCTGTGAGGG + Intergenic
1130372867 15:83301535-83301557 GAGCAACCGTACCCGGCTGATGG + Intergenic
1130684155 15:86022383-86022405 GAGAAACAGGACCCAAGTGAAGG + Intergenic
1132093039 15:98960929-98960951 GAGCAGCAGGACCAGGGAGACGG - Exonic
1136620063 16:31422767-31422789 GAGCTAGTGGATCTGGGTGATGG + Intronic
1138216274 16:55207749-55207771 GGGCAACAGGACCTGGGTGGTGG - Intergenic
1138327632 16:56189531-56189553 GGGATACAGGACCTGGGTGAGGG + Intergenic
1143162461 17:4880569-4880591 GAGCCACAGCGCCCGGCTGAGGG + Intronic
1143382385 17:6504429-6504451 GGGCTACAGAAACAGGGTGATGG - Intronic
1146525942 17:33566982-33567004 GAGCTACAGGAGCTGGGTTCTGG - Intronic
1147023128 17:37555409-37555431 GAGCTACAGCACCCGGCCCAAGG + Intronic
1147725170 17:42562468-42562490 GACCGACAGGAGCCGGGGGAGGG - Exonic
1150118689 17:62579882-62579904 GAGCCACAGGACTTGGGTGCTGG - Intronic
1150731587 17:67699683-67699705 GAGCCACTGAACCCGGCTGAGGG - Intergenic
1151619782 17:75238667-75238689 CAGCAACATGACCTGGGTGATGG + Exonic
1152756333 17:82088593-82088615 GAGCCCCTGGACCCCGGTGACGG - Intronic
1157753285 18:50196390-50196412 GAGCTACAGGAATCCGGGGAAGG - Intergenic
1160952333 19:1673766-1673788 GAGCTGCTGGGCCCGGCTGAAGG - Intergenic
1162765779 19:12918548-12918570 GACCTAGAGGGGCCGGGTGAGGG + Intronic
1163988045 19:20971246-20971268 GAGCTACATCACCTAGGTGATGG - Intergenic
1168128144 19:54298586-54298608 GAGCTTCAGGACCCATGTGCAGG - Intergenic
1168134117 19:54338869-54338891 GGGCCCCAGGACCCGGGTGCAGG - Exonic
933713489 2:85344213-85344235 GGGCTGCACGTCCCGGGTGAGGG - Intronic
935634909 2:105242772-105242794 GAGCCACAGGACGCAGGTGCTGG - Exonic
938585720 2:132688642-132688664 GAGCTACATCACCTGGGGGAAGG + Intronic
946166873 2:217869786-217869808 GAGCCCCAGGACTCTGGTGAGGG + Intronic
947720783 2:232368108-232368130 GAGCTACAGGAAGGGGGTGGGGG - Intergenic
948234672 2:236379310-236379332 GAGCGACAGGACCAAGGGGAGGG + Intronic
1171276284 20:23858960-23858982 GAGCCACTGGACCCTGGTCAGGG + Intergenic
1171278951 20:23880765-23880787 GTGCTACTGGACCCTGGTCAGGG + Intergenic
1175285796 20:57836057-57836079 GAGGGACAGGAACCGGCTGAAGG - Intergenic
1178118694 21:29444637-29444659 AAGGTACAGTACTCGGGTGATGG + Intronic
1178364277 21:31975582-31975604 GTGCAACAGGCCCAGGGTGAAGG - Intronic
1181435657 22:22909143-22909165 GAGCTACAGGAGCTGGGGGTTGG + Intergenic
1182654653 22:31880356-31880378 GAGCTAGAGGACCTGACTGATGG + Intronic
1185121439 22:48973986-48974008 GAGCTGCAGGGCCGGGGTGGAGG - Intergenic
949807829 3:7974856-7974878 GAGCCACTGCACCCGGGAGATGG - Intergenic
957330254 3:78754374-78754396 GAGCTACGGGACCCTGATTAGGG + Intronic
967918294 3:194595907-194595929 GAGCCACCGCACCCGGCTGATGG + Intronic
969669104 4:8580009-8580031 GGGCTCCAGGAGCCAGGTGAAGG + Intronic
970208432 4:13680537-13680559 GAGCTGCAGGACCTGGGGAATGG + Intergenic
975191406 4:71467097-71467119 GAGCTACCAGAGCCTGGTGAGGG - Intronic
976743372 4:88379208-88379230 GAGCGCTGGGACCCGGGTGAGGG + Intronic
978857049 4:113405169-113405191 GAGCTACAGGACACAGTTGAAGG - Intergenic
985193974 4:187408038-187408060 GAGATACAGCACCTGGGGGAAGG - Intergenic
986223728 5:5793764-5793786 GACCTTCAGGACCTTGGTGAAGG - Intergenic
988822081 5:34897099-34897121 GAGCTACAGCACCCAGCCGAAGG - Intronic
992763051 5:79968667-79968689 GAGCTGGAGGACCCAGGGGAAGG + Intergenic
993581615 5:89668857-89668879 GAGCCAAAGAACCCGGATGAGGG - Intergenic
997589432 5:135063835-135063857 GAGCTACAGGGCCCTGGAAAGGG - Intronic
998096227 5:139396868-139396890 GAGCTACATGGCCCAGGTGCTGG - Exonic
1001120494 5:168976018-168976040 GAGCTACTGGGCCAGGGTAAGGG - Intronic
1001794011 5:174486711-174486733 GAGCCACCGCACCCGGCTGAAGG - Intergenic
1002530459 5:179841411-179841433 GAGCCACTGTACCCGGATGAAGG + Intronic
1005500028 6:26421643-26421665 GCGCTACAGCTCCGGGGTGAAGG + Intergenic
1011997288 6:93608383-93608405 GAGCTACAGAACCTGGGGGAAGG + Intergenic
1016178935 6:141119764-141119786 GAGCTACAGTATCAGGGTAATGG + Intergenic
1018029754 6:159832507-159832529 GAGCTGCAGGGCCAGGCTGAGGG + Intergenic
1025000292 7:55310351-55310373 GAGCTGCAGGAGCAGAGTGAAGG + Intergenic
1025032901 7:55572094-55572116 GAGGTGCGGGACCCTGGTGACGG - Intronic
1035493100 7:159296856-159296878 GGGCTACAGGACCCGGGCTCTGG + Intergenic
1038018699 8:23535298-23535320 GGGCAACAGGACCCTCGTGAAGG - Intronic
1040374813 8:46814799-46814821 GAGCCACATCACCTGGGTGATGG - Intergenic
1043470457 8:80557119-80557141 GAGCCACTGCACCCGGCTGATGG - Intergenic
1049417871 8:142503786-142503808 GAGCTGCTGGACCCTGGGGAGGG + Intronic
1049936610 9:505556-505578 GTTCCACGGGACCCGGGTGAAGG - Intronic
1052901453 9:33797748-33797770 GAGCTTGAGGACCCTGGGGAAGG + Intronic
1053034247 9:34810526-34810548 GAGCTGCAGGAGCCTCGTGATGG + Intergenic
1054938648 9:70715944-70715966 GAGCTGCAGGACGTGGGAGACGG + Intronic
1054940339 9:70733937-70733959 GAGCTGCAGGACGTGGGAGACGG + Intronic
1057740385 9:97706194-97706216 GGGCTACAGGAACCAGGTGATGG - Intergenic
1060055634 9:120410454-120410476 GAACTGCAGGACCCTGGAGAAGG - Intronic
1061306370 9:129735491-129735513 GAGCTGGAGGACCCAGGTGCGGG - Intergenic
1061432916 9:130542741-130542763 GTGCAGCAGGACCCAGGTGAGGG - Intergenic
1062212677 9:135373132-135373154 GAGCAACAGGGCCTGGGTGGAGG + Intergenic
1062424163 9:136498332-136498354 GAGCTGCAGGGCCAGGATGAGGG + Intronic
1186046678 X:5544239-5544261 GAGCTACAGGACCCCCAGGAAGG + Intergenic
1186686447 X:11929821-11929843 GAGCCACCGCACCCGGCTGATGG - Intergenic
1188115632 X:26239057-26239079 GAGCAGCAGGACCCTGGTGCTGG + Intergenic
1189439781 X:41024942-41024964 GTGCTACAGGAGCCTGGTGCTGG - Intergenic
1190092558 X:47452251-47452273 GAGCTGCAGGAGCTGGGTGCTGG - Intronic
1190280331 X:48924992-48925014 GAGCCACCGCACCCGGCTGAAGG - Intronic