ID: 1101910431

View in Genome Browser
Species Human (GRCh38)
Location 12:108857225-108857247
Sequence CCCGCACAGCTCCCCAAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 134}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101910424_1101910431 9 Left 1101910424 12:108857193-108857215 CCCCCGATAGGGGTCACACCGCA 0: 1
1: 0
2: 0
3: 0
4: 19
Right 1101910431 12:108857225-108857247 CCCGCACAGCTCCCCAAGACAGG 0: 1
1: 0
2: 1
3: 19
4: 134
1101910418_1101910431 23 Left 1101910418 12:108857179-108857201 CCCTGCAAAGTCGCCCCCCGATA 0: 1
1: 0
2: 0
3: 0
4: 18
Right 1101910431 12:108857225-108857247 CCCGCACAGCTCCCCAAGACAGG 0: 1
1: 0
2: 1
3: 19
4: 134
1101910419_1101910431 22 Left 1101910419 12:108857180-108857202 CCTGCAAAGTCGCCCCCCGATAG 0: 1
1: 0
2: 0
3: 1
4: 19
Right 1101910431 12:108857225-108857247 CCCGCACAGCTCCCCAAGACAGG 0: 1
1: 0
2: 1
3: 19
4: 134
1101910426_1101910431 7 Left 1101910426 12:108857195-108857217 CCCGATAGGGGTCACACCGCACA 0: 1
1: 0
2: 0
3: 3
4: 52
Right 1101910431 12:108857225-108857247 CCCGCACAGCTCCCCAAGACAGG 0: 1
1: 0
2: 1
3: 19
4: 134
1101910425_1101910431 8 Left 1101910425 12:108857194-108857216 CCCCGATAGGGGTCACACCGCAC 0: 1
1: 0
2: 0
3: 1
4: 21
Right 1101910431 12:108857225-108857247 CCCGCACAGCTCCCCAAGACAGG 0: 1
1: 0
2: 1
3: 19
4: 134
1101910423_1101910431 10 Left 1101910423 12:108857192-108857214 CCCCCCGATAGGGGTCACACCGC 0: 1
1: 0
2: 0
3: 1
4: 16
Right 1101910431 12:108857225-108857247 CCCGCACAGCTCCCCAAGACAGG 0: 1
1: 0
2: 1
3: 19
4: 134
1101910427_1101910431 6 Left 1101910427 12:108857196-108857218 CCGATAGGGGTCACACCGCACAC 0: 1
1: 0
2: 1
3: 2
4: 32
Right 1101910431 12:108857225-108857247 CCCGCACAGCTCCCCAAGACAGG 0: 1
1: 0
2: 1
3: 19
4: 134
1101910428_1101910431 -9 Left 1101910428 12:108857211-108857233 CCGCACACAAAGTCCCCGCACAG 0: 1
1: 0
2: 2
3: 27
4: 322
Right 1101910431 12:108857225-108857247 CCCGCACAGCTCCCCAAGACAGG 0: 1
1: 0
2: 1
3: 19
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101910431 Original CRISPR CCCGCACAGCTCCCCAAGAC AGG Intronic
901636021 1:10670499-10670521 CCAGCACAGCACCCCAAAACTGG - Intronic
905749526 1:40450193-40450215 CTCGCCCAGCTCCCCAAGCCCGG - Intronic
907345368 1:53773810-53773832 CACCCACAACTCCCCCAGACTGG + Intronic
908127819 1:61048647-61048669 CCCGCGCACCTCCCAAACACTGG + Intronic
911788087 1:101976348-101976370 CCTGGACAGCTGCCCGAGACTGG + Intronic
912558252 1:110531665-110531687 ACAGCACAGCTCCCCAGGCCAGG + Intergenic
915166262 1:153949309-153949331 CCCATACAGCTCCCCAAGTCTGG - Exonic
915366543 1:155320132-155320154 ACAGAACAGCTCCCCCAGACAGG + Intronic
917433915 1:174999939-174999961 CACGCACAGCCCGCCAAGCCTGG - Exonic
920255158 1:204649743-204649765 CCCACACTGATCCCCATGACTGG + Intronic
920851476 1:209630960-209630982 CCCGCACTGCTCCCCTAGTGAGG + Intronic
922801393 1:228366279-228366301 CCCCCACATCCCCCCTAGACTGG + Intronic
923015128 1:230120645-230120667 GACGCACAGCTCCCCAGGGCTGG + Intronic
1062786390 10:268834-268856 ATCCCACAGCTCCCCAAGTCTGG - Intergenic
1065875388 10:29993357-29993379 CCCCCAGCGCTCCCCAGGACAGG + Intergenic
1067039814 10:42943293-42943315 CCCGCACAGCTCCCGGAGAAGGG - Intergenic
1067205150 10:44206665-44206687 CCGGCAAGGCTCCCCAAGCCCGG + Intergenic
1067240893 10:44492149-44492171 CCAGCACTCCACCCCAAGACAGG - Intergenic
1068170422 10:53386258-53386280 CCCTCAGAGATCCCCAAGAGTGG + Intergenic
1076354852 10:129844195-129844217 ACCGCAGAGCTCTCCTAGACCGG - Intronic
1076388134 10:130074102-130074124 CCGGCATCACTCCCCAAGACTGG - Intergenic
1077169375 11:1159452-1159474 CCCGCACAGCACCCCAGCATGGG - Intronic
1077366227 11:2162411-2162433 CCCTCCCAGCTCCCCAGAACAGG + Intergenic
1078621081 11:12908474-12908496 CACTCAAAGGTCCCCAAGACAGG - Intronic
1083571866 11:63765431-63765453 CACCCACACCTCCCCCAGACTGG + Intronic
1084218755 11:67665387-67665409 CCCCCAGAGCTCCCCAAACCTGG - Exonic
1084269559 11:68021747-68021769 CCCCCAGAGCTCCCCAAACCTGG + Exonic
1085681012 11:78574897-78574919 CCCGCACGCCTCCCTAAGCCTGG - Intergenic
1087701542 11:101441358-101441380 GCCCCCCATCTCCCCAAGACTGG + Intergenic
1090884158 11:130861593-130861615 CCCGCCCAGCTTCCCCAGGCTGG + Intergenic
1091201927 11:133787762-133787784 CCCGCACAGCTCCTGCAGCCCGG + Intergenic
1094851427 12:34383999-34384021 CCAGCAGAGGTCCCCACGACGGG - Intergenic
1100565431 12:95790293-95790315 CGCGCGCAGCTCCCCATGGCCGG + Exonic
1101910431 12:108857225-108857247 CCCGCACAGCTCCCCAAGACAGG + Intronic
1102111755 12:110370667-110370689 CCTGCACTGCACCCCAAGACGGG + Intergenic
1104683848 12:130771540-130771562 CCCTCACAGCTCCCACAGCCAGG + Intergenic
1105345219 13:19565078-19565100 CCCGCTCCGCTCCCCAACTCAGG + Intergenic
1106197631 13:27507975-27507997 CACACAAAGCTCCCCAAGGCAGG - Intergenic
1107735093 13:43391065-43391087 TCCCCACAGCTCCCCCAGAACGG + Intronic
1113492128 13:110700378-110700400 CCCGCACAGCCCTCCCAGTCAGG - Intronic
1113902033 13:113802839-113802861 CCCGCACACCAACACAAGACAGG + Intronic
1115165043 14:30438759-30438781 CCCTCTCTGCTCCCCAAGAGAGG + Intergenic
1115664965 14:35535386-35535408 CCCGGACAGCGCCCCGAGGCAGG + Exonic
1117347766 14:54850629-54850651 CCCTCCCTGCTCCCCACGACAGG + Intronic
1119610254 14:76055925-76055947 CCCGCATTGCTCCCAAACACTGG - Intronic
1119766871 14:77195905-77195927 CCATCACAGCTCCCCAAGGCAGG + Intronic
1122621058 14:103057754-103057776 CCCGCGCCGCTCCCCAGGCCCGG - Intergenic
1122645120 14:103189120-103189142 CCCACAGAGCTCCCCAGGCCTGG + Intergenic
1122649960 14:103220768-103220790 CGCGCAGAGCTCCCCAAGCCTGG - Intergenic
1122782410 14:104149303-104149325 CACGCACCCCTCCCCAGGACGGG - Intronic
1128802430 15:70505197-70505219 CCCCCACGGCACCCCAACACGGG + Intergenic
1133210714 16:4262024-4262046 CCCCCAAAGCTGCCCAACACAGG + Intronic
1133270347 16:4608288-4608310 GCCTCACAGCTCCCCAAGAGTGG - Intergenic
1135312888 16:21419444-21419466 CCCACACTCCTCCCAAAGACAGG + Intronic
1135365811 16:21851724-21851746 CCCACACTCCTCCCAAAGACAGG + Intronic
1135446003 16:22519438-22519460 CCCACACTCCTCCCAAAGACAGG - Intronic
1136323001 16:29499952-29499974 CCCACACTCCTCCCAAAGACAGG + Intronic
1136437685 16:30239920-30239942 CCCACACTCCTCCCAAAGACAGG + Intronic
1139739467 16:69022921-69022943 CTGGCACAGCTCCCCAAGGTTGG - Exonic
1142179930 16:88663427-88663449 CCCGCACAGCACCAGCAGACAGG - Intergenic
1142978073 17:3656952-3656974 CCCTCAGAGCCCCCCAAGTCTGG + Intronic
1147741243 17:42672111-42672133 CCCGCACAGCTCCCCCAGGTCGG + Exonic
1148662503 17:49346207-49346229 CCCTCACAGGTCTCCAAGTCTGG + Intronic
1148838531 17:50479479-50479501 GCCACACAACTCCCCAAGGCAGG - Intronic
1149845366 17:60006428-60006450 CCCCCACACCTCCCCCAGCCTGG + Intergenic
1152363370 17:79842419-79842441 TCCGCACAGGTCCCCGAGAAGGG + Intergenic
1152905460 17:82968234-82968256 CACGCACAGCAGCCCCAGACTGG + Intronic
1154118687 18:11633801-11633823 CCCACACTCCTCCCGAAGACAGG + Intergenic
1158541171 18:58355968-58355990 CCCGCCCCGGTCCCCAAGACAGG + Intronic
1160250899 18:77202774-77202796 CCCCCACAGCCTCCCATGACAGG + Intergenic
1160738314 19:674730-674752 CCTGCCCTGCTCCCCAAGCCGGG + Intergenic
1160738350 19:674837-674859 CCTGCCCTGCTCCCCAAGCCGGG + Intergenic
1160831558 19:1106910-1106932 CCAGCACAGCCCCCCGAGCCTGG - Intergenic
1162129633 19:8518249-8518271 CATGCTCAGCTTCCCAAGACAGG + Intergenic
1162450420 19:10750990-10751012 CACACACAGCTCCCCAAGGTGGG - Intronic
1163154514 19:15432578-15432600 CCCGCCCAGCCCCCCGAGCCCGG - Intronic
1163437114 19:17302566-17302588 CTTGCTCAGCTCCCCTAGACCGG + Intronic
1163819424 19:19487554-19487576 CCCCCAGAGCTTCCCAAGAAGGG - Intronic
1166684631 19:44788958-44788980 CCTGCACTGCTCCACATGACAGG + Intronic
1167580349 19:50337589-50337611 CCAGCAGAGCTCCCCAAGTTGGG - Intronic
1167583912 19:50362227-50362249 CCAGCAGAGCTCCCCAAGTTGGG - Exonic
1168269699 19:55242680-55242702 CCCGGAAGGCTCCCCAGGACAGG + Intronic
926420779 2:12695130-12695152 CCCTCACTGCTACTCAAGACTGG - Intergenic
927893534 2:26767161-26767183 CTCTCACAGCTCCCCAGGCCAGG + Intronic
927904374 2:26846864-26846886 CCCGCAGAGCCCGCCAAGGCGGG - Intergenic
929713328 2:44286831-44286853 ACCGCACAGCTCACCATCACAGG - Intronic
934860571 2:97760960-97760982 GCCCCACACCTCCCCGAGACAGG - Intronic
934861044 2:97763753-97763775 CCCGCACCTTTCCCCAGGACAGG - Intronic
935652477 2:105393977-105393999 AACGCACAGATCCCCAACACGGG + Intronic
936004027 2:108866012-108866034 CTTGCACAGCTCCATAAGACAGG - Intronic
938089998 2:128425187-128425209 CCCGCACCCCTCACAAAGACAGG - Intergenic
938413395 2:131084193-131084215 CCCCCACCCCACCCCAAGACAGG + Intronic
947712902 2:232326049-232326071 CTAGCACAGCTCCCCAGGAGAGG + Intronic
948430180 2:237913725-237913747 CCAGCACAGCCCCCCAACCCAGG - Intergenic
1169065781 20:2693427-2693449 CCCGCCCAGCGCCCCAGGAGGGG + Intronic
1173712167 20:45168333-45168355 CCCTCCCCGCTCCCCATGACAGG - Intergenic
1174107977 20:48176556-48176578 CTTGCTCAGCTCCCCCAGACAGG - Intergenic
1175117690 20:56694607-56694629 CCCCAACACCTCCCAAAGACTGG - Intergenic
1176214475 20:63941717-63941739 CCCGCCCCGCTGCCCAAGCCTGG + Intronic
1178438482 21:32580022-32580044 CTCGCAGAGCTCCCGAAGAGTGG + Intronic
1179573325 21:42291333-42291355 CCGCCACAGCTCCCGAAGTCAGG - Intronic
1179899225 21:44380347-44380369 GCCGCTCAGCTCCCCATGTCAGG + Intronic
1183658932 22:39207106-39207128 CCCTCCCAGCCCCCCAGGACAGG - Intergenic
953955310 3:47227449-47227471 CTCTCACAGCTTCCCATGACAGG + Intergenic
954581957 3:51707696-51707718 CCCCCTCAGCTCCCCAGGGCAGG - Intronic
955870561 3:63433958-63433980 ACCACACACCTCCCTAAGACTGG + Intronic
958942067 3:100327746-100327768 CCCGCCCTGCACCCCACGACAGG - Intergenic
960970878 3:123139323-123139345 CACCCACGGCTCCCCAAGACAGG + Intronic
961524593 3:127488687-127488709 CCCCCACAGCACCCCATCACAGG - Intergenic
962718865 3:138153675-138153697 GACTCACAGTTCCCCAAGACTGG + Intergenic
967527756 3:190514198-190514220 CCCTCTCAGCTTCCCAAGAAAGG + Exonic
967782083 3:193450945-193450967 CCTGCACAGCTCACCACCACTGG + Intronic
973563989 4:52165362-52165384 CCCTCACACCACCCCATGACAGG + Intergenic
974328303 4:60444095-60444117 CCCACACAGCTCCCCAATTCAGG - Intergenic
982130439 4:152224334-152224356 CCCGCACAGCTACCCCTGGCAGG - Intergenic
983637193 4:169909825-169909847 CCAGCACTGCTCCCCAGGGCTGG - Intergenic
989101391 5:37826511-37826533 CTCACACAGCCTCCCAAGACGGG - Intronic
989372016 5:40720801-40720823 CCAGCACAGCTCCACAGGATTGG + Intronic
1001989251 5:176102606-176102628 CCCTCGCTGCTCCCCATGACAGG + Intronic
1001989927 5:176107926-176107948 CCCTCGCTGCTCCCCATGACAGG + Intronic
1002226944 5:177730212-177730234 CCCTCGCTGCTCCCCATGACAGG - Intronic
1002227619 5:177735532-177735554 CCCTCGCTGCTCCCCATGACAGG - Intronic
1002286495 5:178165941-178165963 CCCGGCCAGCTCCACAAGTCGGG - Intergenic
1002575726 5:180172690-180172712 CACGCCCAGCTCCCCAAGAGGGG + Intronic
1006014868 6:31072448-31072470 CCAGCATAACTCCCCAAGATAGG - Intergenic
1006067847 6:31475132-31475154 GCCGCACAAATCCCCAAGAATGG + Intergenic
1006166857 6:32070359-32070381 CACCCACAGCTCCCCAAGGCGGG + Intronic
1007631340 6:43275177-43275199 CCCCCGCAGGTCCCCAAGCCAGG + Intronic
1007682539 6:43644576-43644598 CCCGCACCCCACCCCAAGCCAGG - Intergenic
1016210908 6:141532139-141532161 ACCGAAAAGCTCCCCAAGCCAGG + Intergenic
1016624752 6:146153628-146153650 CCTGCACCGCTTCCCATGACAGG - Intronic
1018044658 6:159955085-159955107 CCTGCATACCTCCCCAAGAGTGG + Intergenic
1018794559 6:167175767-167175789 CTCGCAGAGCTCCCGAAGACTGG - Intronic
1018821762 6:167379300-167379322 CTCGCAGAGCTCCCGAAGACTGG + Intronic
1018841106 6:167517784-167517806 CCTGCACGGCTACCGAAGACTGG + Intergenic
1019729347 7:2621973-2621995 CCAGAACGGCTCCCCAACACTGG - Intergenic
1020257254 7:6509116-6509138 CCCCGACAGCCCCCCAAGCCCGG - Exonic
1022112647 7:27240789-27240811 CCTGGACAGCTCTCCAAGGCAGG + Intergenic
1024576258 7:50767230-50767252 CCCGCACAGATGCCCAAGGCAGG + Intronic
1034376427 7:150648987-150649009 CCTGCACAGCTACCCAAAATTGG + Intergenic
1034405792 7:150901667-150901689 CCTCCACAGTTCCCCAAGCCTGG - Intergenic
1037913650 8:22759045-22759067 CCATCACAGCTGCCCAAAACAGG - Intronic
1038287156 8:26215593-26215615 GCAGCACAGCTCCACAAGAGTGG - Intergenic
1041021668 8:53644150-53644172 CGCGCACAGCTCTCCCAGGCAGG - Intergenic
1049112524 8:140656608-140656630 CCCGCACTGCTCCCCAAGAAGGG - Intergenic
1050581678 9:7063951-7063973 ACAGCACAGCTCCAAAAGACGGG - Intronic
1053010113 9:34628124-34628146 CCCCCAGAGCCCCCCAACACAGG + Intergenic
1057251687 9:93508403-93508425 CCCTGACAGGTCCCCAAGGCTGG + Intronic
1058053438 9:100427671-100427693 CCCGAGCAGCTCCCCGAGCCCGG - Intronic
1059194149 9:112354980-112355002 CACCCACATCTCCCAAAGACAGG - Intergenic
1062414731 9:136442521-136442543 CCCGCTCAGCTCCCCTACACTGG + Intronic
1062564307 9:137157114-137157136 CCCGCCCACCTCCCCAAGAGCGG - Intronic
1190980558 X:55453765-55453787 CCCGGCCCACTCCCCAAGACAGG - Intergenic
1190988139 X:55519415-55519437 CCCGGCCCACTCCCCAAGACAGG + Intergenic
1201524774 Y:14919894-14919916 CACTCACAGCTCCCCATGGCTGG - Intergenic