ID: 1101910459

View in Genome Browser
Species Human (GRCh38)
Location 12:108857335-108857357
Sequence GCGCGTGCGGGGCAGGGGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1167
Summary {0: 1, 1: 1, 2: 3, 3: 110, 4: 1052}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101910459_1101910482 26 Left 1101910459 12:108857335-108857357 CCGCCCCCCTGCCCCGCACGCGC 0: 1
1: 1
2: 3
3: 110
4: 1052
Right 1101910482 12:108857384-108857406 GGCGTCCGGCGGCCCAGGCCGGG 0: 1
1: 0
2: 0
3: 36
4: 340
1101910459_1101910470 -6 Left 1101910459 12:108857335-108857357 CCGCCCCCCTGCCCCGCACGCGC 0: 1
1: 1
2: 3
3: 110
4: 1052
Right 1101910470 12:108857352-108857374 ACGCGCGGCCCCAGCTCCGGCGG 0: 1
1: 1
2: 1
3: 13
4: 110
1101910459_1101910481 25 Left 1101910459 12:108857335-108857357 CCGCCCCCCTGCCCCGCACGCGC 0: 1
1: 1
2: 3
3: 110
4: 1052
Right 1101910481 12:108857383-108857405 CGGCGTCCGGCGGCCCAGGCCGG 0: 1
1: 0
2: 1
3: 20
4: 219
1101910459_1101910475 5 Left 1101910459 12:108857335-108857357 CCGCCCCCCTGCCCCGCACGCGC 0: 1
1: 1
2: 3
3: 110
4: 1052
Right 1101910475 12:108857363-108857385 CAGCTCCGGCGGCCTCGGCGCGG 0: 1
1: 0
2: 0
3: 14
4: 172
1101910459_1101910477 12 Left 1101910459 12:108857335-108857357 CCGCCCCCCTGCCCCGCACGCGC 0: 1
1: 1
2: 3
3: 110
4: 1052
Right 1101910477 12:108857370-108857392 GGCGGCCTCGGCGCGGCGTCCGG 0: 1
1: 0
2: 1
3: 14
4: 175
1101910459_1101910480 21 Left 1101910459 12:108857335-108857357 CCGCCCCCCTGCCCCGCACGCGC 0: 1
1: 1
2: 3
3: 110
4: 1052
Right 1101910480 12:108857379-108857401 GGCGCGGCGTCCGGCGGCCCAGG 0: 1
1: 0
2: 2
3: 31
4: 292
1101910459_1101910469 -9 Left 1101910459 12:108857335-108857357 CCGCCCCCCTGCCCCGCACGCGC 0: 1
1: 1
2: 3
3: 110
4: 1052
Right 1101910469 12:108857349-108857371 CGCACGCGCGGCCCCAGCTCCGG 0: 1
1: 0
2: 0
3: 19
4: 131
1101910459_1101910478 15 Left 1101910459 12:108857335-108857357 CCGCCCCCCTGCCCCGCACGCGC 0: 1
1: 1
2: 3
3: 110
4: 1052
Right 1101910478 12:108857373-108857395 GGCCTCGGCGCGGCGTCCGGCGG 0: 1
1: 0
2: 0
3: 12
4: 164
1101910459_1101910471 0 Left 1101910459 12:108857335-108857357 CCGCCCCCCTGCCCCGCACGCGC 0: 1
1: 1
2: 3
3: 110
4: 1052
Right 1101910471 12:108857358-108857380 GGCCCCAGCTCCGGCGGCCTCGG 0: 1
1: 0
2: 2
3: 27
4: 276

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101910459 Original CRISPR GCGCGTGCGGGGCAGGGGGG CGG (reversed) Intronic