ID: 1101910462

View in Genome Browser
Species Human (GRCh38)
Location 12:108857339-108857361
Sequence GGCCGCGCGTGCGGGGCAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 419
Summary {0: 1, 1: 1, 2: 1, 3: 36, 4: 380}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101910462_1101910484 27 Left 1101910462 12:108857339-108857361 CCCCCTGCCCCGCACGCGCGGCC 0: 1
1: 1
2: 1
3: 36
4: 380
Right 1101910484 12:108857389-108857411 CCGGCGGCCCAGGCCGGGCGCGG 0: 1
1: 0
2: 3
3: 56
4: 563
1101910462_1101910470 -10 Left 1101910462 12:108857339-108857361 CCCCCTGCCCCGCACGCGCGGCC 0: 1
1: 1
2: 1
3: 36
4: 380
Right 1101910470 12:108857352-108857374 ACGCGCGGCCCCAGCTCCGGCGG 0: 1
1: 1
2: 1
3: 13
4: 110
1101910462_1101910471 -4 Left 1101910462 12:108857339-108857361 CCCCCTGCCCCGCACGCGCGGCC 0: 1
1: 1
2: 1
3: 36
4: 380
Right 1101910471 12:108857358-108857380 GGCCCCAGCTCCGGCGGCCTCGG 0: 1
1: 0
2: 2
3: 27
4: 276
1101910462_1101910480 17 Left 1101910462 12:108857339-108857361 CCCCCTGCCCCGCACGCGCGGCC 0: 1
1: 1
2: 1
3: 36
4: 380
Right 1101910480 12:108857379-108857401 GGCGCGGCGTCCGGCGGCCCAGG 0: 1
1: 0
2: 2
3: 31
4: 292
1101910462_1101910482 22 Left 1101910462 12:108857339-108857361 CCCCCTGCCCCGCACGCGCGGCC 0: 1
1: 1
2: 1
3: 36
4: 380
Right 1101910482 12:108857384-108857406 GGCGTCCGGCGGCCCAGGCCGGG 0: 1
1: 0
2: 0
3: 36
4: 340
1101910462_1101910478 11 Left 1101910462 12:108857339-108857361 CCCCCTGCCCCGCACGCGCGGCC 0: 1
1: 1
2: 1
3: 36
4: 380
Right 1101910478 12:108857373-108857395 GGCCTCGGCGCGGCGTCCGGCGG 0: 1
1: 0
2: 0
3: 12
4: 164
1101910462_1101910475 1 Left 1101910462 12:108857339-108857361 CCCCCTGCCCCGCACGCGCGGCC 0: 1
1: 1
2: 1
3: 36
4: 380
Right 1101910475 12:108857363-108857385 CAGCTCCGGCGGCCTCGGCGCGG 0: 1
1: 0
2: 0
3: 14
4: 172
1101910462_1101910481 21 Left 1101910462 12:108857339-108857361 CCCCCTGCCCCGCACGCGCGGCC 0: 1
1: 1
2: 1
3: 36
4: 380
Right 1101910481 12:108857383-108857405 CGGCGTCCGGCGGCCCAGGCCGG 0: 1
1: 0
2: 1
3: 20
4: 219
1101910462_1101910477 8 Left 1101910462 12:108857339-108857361 CCCCCTGCCCCGCACGCGCGGCC 0: 1
1: 1
2: 1
3: 36
4: 380
Right 1101910477 12:108857370-108857392 GGCGGCCTCGGCGCGGCGTCCGG 0: 1
1: 0
2: 1
3: 14
4: 175

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101910462 Original CRISPR GGCCGCGCGTGCGGGGCAGG GGG (reversed) Intronic