ID: 1101910472

View in Genome Browser
Species Human (GRCh38)
Location 12:108857360-108857382
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 263
Summary {0: 1, 1: 1, 2: 2, 3: 22, 4: 237}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101910472_1101910489 17 Left 1101910472 12:108857360-108857382 CCCCAGCTCCGGCGGCCTCGGCG 0: 1
1: 1
2: 2
3: 22
4: 237
Right 1101910489 12:108857400-108857422 GGCCGGGCGCGGCGAGCCCGGGG 0: 1
1: 0
2: 5
3: 52
4: 417
1101910472_1101910484 6 Left 1101910472 12:108857360-108857382 CCCCAGCTCCGGCGGCCTCGGCG 0: 1
1: 1
2: 2
3: 22
4: 237
Right 1101910484 12:108857389-108857411 CCGGCGGCCCAGGCCGGGCGCGG 0: 1
1: 0
2: 3
3: 56
4: 563
1101910472_1101910480 -4 Left 1101910472 12:108857360-108857382 CCCCAGCTCCGGCGGCCTCGGCG 0: 1
1: 1
2: 2
3: 22
4: 237
Right 1101910480 12:108857379-108857401 GGCGCGGCGTCCGGCGGCCCAGG 0: 1
1: 0
2: 2
3: 31
4: 292
1101910472_1101910482 1 Left 1101910472 12:108857360-108857382 CCCCAGCTCCGGCGGCCTCGGCG 0: 1
1: 1
2: 2
3: 22
4: 237
Right 1101910482 12:108857384-108857406 GGCGTCCGGCGGCCCAGGCCGGG 0: 1
1: 0
2: 0
3: 36
4: 340
1101910472_1101910488 16 Left 1101910472 12:108857360-108857382 CCCCAGCTCCGGCGGCCTCGGCG 0: 1
1: 1
2: 2
3: 22
4: 237
Right 1101910488 12:108857399-108857421 AGGCCGGGCGCGGCGAGCCCGGG 0: 1
1: 1
2: 2
3: 26
4: 283
1101910472_1101910481 0 Left 1101910472 12:108857360-108857382 CCCCAGCTCCGGCGGCCTCGGCG 0: 1
1: 1
2: 2
3: 22
4: 237
Right 1101910481 12:108857383-108857405 CGGCGTCCGGCGGCCCAGGCCGG 0: 1
1: 0
2: 1
3: 20
4: 219
1101910472_1101910487 15 Left 1101910472 12:108857360-108857382 CCCCAGCTCCGGCGGCCTCGGCG 0: 1
1: 1
2: 2
3: 22
4: 237
Right 1101910487 12:108857398-108857420 CAGGCCGGGCGCGGCGAGCCCGG 0: 1
1: 0
2: 3
3: 33
4: 353
1101910472_1101910478 -10 Left 1101910472 12:108857360-108857382 CCCCAGCTCCGGCGGCCTCGGCG 0: 1
1: 1
2: 2
3: 22
4: 237
Right 1101910478 12:108857373-108857395 GGCCTCGGCGCGGCGTCCGGCGG 0: 1
1: 0
2: 0
3: 12
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101910472 Original CRISPR CGCCGAGGCCGCCGGAGCTG GGG (reversed) Intronic