ID: 1101910474

View in Genome Browser
Species Human (GRCh38)
Location 12:108857362-108857384
Sequence CGCGCCGAGGCCGCCGGAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 212
Summary {0: 2, 1: 0, 2: 2, 3: 30, 4: 178}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101910474_1101910481 -2 Left 1101910474 12:108857362-108857384 CCAGCTCCGGCGGCCTCGGCGCG 0: 2
1: 0
2: 2
3: 30
4: 178
Right 1101910481 12:108857383-108857405 CGGCGTCCGGCGGCCCAGGCCGG 0: 1
1: 0
2: 1
3: 20
4: 219
1101910474_1101910482 -1 Left 1101910474 12:108857362-108857384 CCAGCTCCGGCGGCCTCGGCGCG 0: 2
1: 0
2: 2
3: 30
4: 178
Right 1101910482 12:108857384-108857406 GGCGTCCGGCGGCCCAGGCCGGG 0: 1
1: 0
2: 0
3: 36
4: 340
1101910474_1101910484 4 Left 1101910474 12:108857362-108857384 CCAGCTCCGGCGGCCTCGGCGCG 0: 2
1: 0
2: 2
3: 30
4: 178
Right 1101910484 12:108857389-108857411 CCGGCGGCCCAGGCCGGGCGCGG 0: 1
1: 0
2: 3
3: 56
4: 563
1101910474_1101910487 13 Left 1101910474 12:108857362-108857384 CCAGCTCCGGCGGCCTCGGCGCG 0: 2
1: 0
2: 2
3: 30
4: 178
Right 1101910487 12:108857398-108857420 CAGGCCGGGCGCGGCGAGCCCGG 0: 1
1: 0
2: 3
3: 33
4: 353
1101910474_1101910489 15 Left 1101910474 12:108857362-108857384 CCAGCTCCGGCGGCCTCGGCGCG 0: 2
1: 0
2: 2
3: 30
4: 178
Right 1101910489 12:108857400-108857422 GGCCGGGCGCGGCGAGCCCGGGG 0: 1
1: 0
2: 5
3: 52
4: 417
1101910474_1101910480 -6 Left 1101910474 12:108857362-108857384 CCAGCTCCGGCGGCCTCGGCGCG 0: 2
1: 0
2: 2
3: 30
4: 178
Right 1101910480 12:108857379-108857401 GGCGCGGCGTCCGGCGGCCCAGG 0: 1
1: 0
2: 2
3: 31
4: 292
1101910474_1101910488 14 Left 1101910474 12:108857362-108857384 CCAGCTCCGGCGGCCTCGGCGCG 0: 2
1: 0
2: 2
3: 30
4: 178
Right 1101910488 12:108857399-108857421 AGGCCGGGCGCGGCGAGCCCGGG 0: 1
1: 1
2: 2
3: 26
4: 283

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101910474 Original CRISPR CGCGCCGAGGCCGCCGGAGC TGG (reversed) Intronic