ID: 1101910476

View in Genome Browser
Species Human (GRCh38)
Location 12:108857368-108857390
Sequence GGACGCCGCGCCGAGGCCGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 214
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 194}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101910476_1101910493 28 Left 1101910476 12:108857368-108857390 CCGGCGGCCTCGGCGCGGCGTCC 0: 1
1: 0
2: 1
3: 18
4: 194
Right 1101910493 12:108857419-108857441 GGGGCTCACCTCGCTGTTGCTGG 0: 1
1: 0
2: 0
3: 10
4: 143
1101910476_1101910487 7 Left 1101910476 12:108857368-108857390 CCGGCGGCCTCGGCGCGGCGTCC 0: 1
1: 0
2: 1
3: 18
4: 194
Right 1101910487 12:108857398-108857420 CAGGCCGGGCGCGGCGAGCCCGG 0: 1
1: 0
2: 3
3: 33
4: 353
1101910476_1101910489 9 Left 1101910476 12:108857368-108857390 CCGGCGGCCTCGGCGCGGCGTCC 0: 1
1: 0
2: 1
3: 18
4: 194
Right 1101910489 12:108857400-108857422 GGCCGGGCGCGGCGAGCCCGGGG 0: 1
1: 0
2: 5
3: 52
4: 417
1101910476_1101910482 -7 Left 1101910476 12:108857368-108857390 CCGGCGGCCTCGGCGCGGCGTCC 0: 1
1: 0
2: 1
3: 18
4: 194
Right 1101910482 12:108857384-108857406 GGCGTCCGGCGGCCCAGGCCGGG 0: 1
1: 0
2: 0
3: 36
4: 340
1101910476_1101910488 8 Left 1101910476 12:108857368-108857390 CCGGCGGCCTCGGCGCGGCGTCC 0: 1
1: 0
2: 1
3: 18
4: 194
Right 1101910488 12:108857399-108857421 AGGCCGGGCGCGGCGAGCCCGGG 0: 1
1: 1
2: 2
3: 26
4: 283
1101910476_1101910481 -8 Left 1101910476 12:108857368-108857390 CCGGCGGCCTCGGCGCGGCGTCC 0: 1
1: 0
2: 1
3: 18
4: 194
Right 1101910481 12:108857383-108857405 CGGCGTCCGGCGGCCCAGGCCGG 0: 1
1: 0
2: 1
3: 20
4: 219
1101910476_1101910484 -2 Left 1101910476 12:108857368-108857390 CCGGCGGCCTCGGCGCGGCGTCC 0: 1
1: 0
2: 1
3: 18
4: 194
Right 1101910484 12:108857389-108857411 CCGGCGGCCCAGGCCGGGCGCGG 0: 1
1: 0
2: 3
3: 56
4: 563

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101910476 Original CRISPR GGACGCCGCGCCGAGGCCGC CGG (reversed) Intronic