ID: 1101910476

View in Genome Browser
Species Human (GRCh38)
Location 12:108857368-108857390
Sequence GGACGCCGCGCCGAGGCCGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 214
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 194}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101910476_1101910493 28 Left 1101910476 12:108857368-108857390 CCGGCGGCCTCGGCGCGGCGTCC 0: 1
1: 0
2: 1
3: 18
4: 194
Right 1101910493 12:108857419-108857441 GGGGCTCACCTCGCTGTTGCTGG 0: 1
1: 0
2: 0
3: 10
4: 143
1101910476_1101910489 9 Left 1101910476 12:108857368-108857390 CCGGCGGCCTCGGCGCGGCGTCC 0: 1
1: 0
2: 1
3: 18
4: 194
Right 1101910489 12:108857400-108857422 GGCCGGGCGCGGCGAGCCCGGGG 0: 1
1: 0
2: 5
3: 52
4: 417
1101910476_1101910488 8 Left 1101910476 12:108857368-108857390 CCGGCGGCCTCGGCGCGGCGTCC 0: 1
1: 0
2: 1
3: 18
4: 194
Right 1101910488 12:108857399-108857421 AGGCCGGGCGCGGCGAGCCCGGG 0: 1
1: 1
2: 2
3: 26
4: 283
1101910476_1101910484 -2 Left 1101910476 12:108857368-108857390 CCGGCGGCCTCGGCGCGGCGTCC 0: 1
1: 0
2: 1
3: 18
4: 194
Right 1101910484 12:108857389-108857411 CCGGCGGCCCAGGCCGGGCGCGG 0: 1
1: 0
2: 3
3: 56
4: 563
1101910476_1101910481 -8 Left 1101910476 12:108857368-108857390 CCGGCGGCCTCGGCGCGGCGTCC 0: 1
1: 0
2: 1
3: 18
4: 194
Right 1101910481 12:108857383-108857405 CGGCGTCCGGCGGCCCAGGCCGG 0: 1
1: 0
2: 1
3: 20
4: 219
1101910476_1101910482 -7 Left 1101910476 12:108857368-108857390 CCGGCGGCCTCGGCGCGGCGTCC 0: 1
1: 0
2: 1
3: 18
4: 194
Right 1101910482 12:108857384-108857406 GGCGTCCGGCGGCCCAGGCCGGG 0: 1
1: 0
2: 0
3: 36
4: 340
1101910476_1101910487 7 Left 1101910476 12:108857368-108857390 CCGGCGGCCTCGGCGCGGCGTCC 0: 1
1: 0
2: 1
3: 18
4: 194
Right 1101910487 12:108857398-108857420 CAGGCCGGGCGCGGCGAGCCCGG 0: 1
1: 0
2: 3
3: 33
4: 353

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101910476 Original CRISPR GGACGCCGCGCCGAGGCCGC CGG (reversed) Intronic
900117488 1:1034772-1034794 GGAGGCCGCGGCGGGTCCGCGGG + Intronic
900135630 1:1115853-1115875 GGAGGCGGCGACGAGGACGCGGG + Intronic
900244011 1:1629466-1629488 GGGCGCCGCGCCGGGGCCCGAGG + Exonic
900369673 1:2326025-2326047 GGACGGCGGGAGGAGGCCGCGGG - Intronic
900677888 1:3900057-3900079 GGAGGCCGCTCCTAGGCCACAGG + Intronic
901066566 1:6497279-6497301 GGACCCCGCCCCGCGTCCGCCGG + Intronic
901109562 1:6784708-6784730 GGACGCGGCGCCGAGGGGGCGGG + Intergenic
901373063 1:8817236-8817258 GGAGGCCGCGCGGAGGCTGCGGG + Exonic
904199789 1:28812278-28812300 GGCCGCGGCCCCGACGCCGCCGG - Exonic
905819806 1:40980284-40980306 TGAGCCCGCGCCGAGGCCGGAGG - Intronic
906877637 1:49556652-49556674 GGATCCCGCGCAGGGGCCGCAGG + Intronic
908195540 1:61742861-61742883 GCAGGGCTCGCCGAGGCCGCGGG + Intronic
913469074 1:119171921-119171943 GGATCCCGCACCGGGGCCGCAGG - Intergenic
924052677 1:240093225-240093247 GGACGCCCCGCAGAGGCTGGGGG + Exonic
1063636465 10:7787733-7787755 GGACGCGGGGCTGAGGGCGCGGG - Intronic
1063929950 10:11018439-11018461 GGACGCCGCGCTCGGCCCGCTGG - Intronic
1067295894 10:44975090-44975112 GGGCGCGGCGCCGAGGCTCCGGG + Intronic
1067336991 10:45374231-45374253 GACCGCCGCGCCGAGGCTCCCGG + Exonic
1069486646 10:68827896-68827918 GGAAGCCGCGCGGCGGCCGCAGG - Exonic
1069486733 10:68828232-68828254 GGAAGCCGCGCGGCGGCCGCAGG - Intronic
1070302149 10:75211145-75211167 GGTCGCCATGGCGAGGCCGCGGG - Exonic
1070564017 10:77590225-77590247 GGATCCCGCACCGGGGCCGCAGG + Intronic
1071966588 10:90858087-90858109 GGACGCGGCGCGGCTGCCGCAGG - Intergenic
1073290058 10:102409101-102409123 GGCCGGCGCGCCGCGGCCCCCGG + Intronic
1075031905 10:119029644-119029666 GGCCGCGGCGGCGAGGCCGGGGG + Intergenic
1077076992 11:706417-706439 GGCGGCCGGGCCGAGGGCGCGGG + Intronic
1077253753 11:1571806-1571828 GGGCGCCGCGTCGGGGGCGCTGG - Intronic
1077285535 11:1763732-1763754 GGTCGCGGCGCCGAGGTCCCGGG - Intronic
1078800970 11:14643928-14643950 GGACCCCGGGCCGTGGCGGCCGG + Exonic
1078891418 11:15561339-15561361 GGATACCGCACCGGGGCCGCAGG - Intergenic
1080107426 11:28525741-28525763 GGATCCCGCACCGGGGCCGCAGG + Intergenic
1080836295 11:35944036-35944058 GGGGTCAGCGCCGAGGCCGCGGG + Intronic
1083920795 11:65780694-65780716 AGACGCCGCGCAGATGCCGGCGG + Exonic
1086397673 11:86433467-86433489 GGATCCCGCACCGGGGCCGCAGG + Intergenic
1090699152 11:129279159-129279181 GGACGCCGCGGCGGCGCGGCGGG - Intronic
1095581590 12:43806327-43806349 GGATGACGCGCCGGGGCCGGCGG - Intronic
1095875966 12:47080057-47080079 GGAGGAGGCGGCGAGGCCGCGGG - Intronic
1095998004 12:48105826-48105848 GGTGGCCGCGCTGTGGCCGCCGG - Intronic
1101605996 12:106248003-106248025 GGAGGCCGGGCCGAGGAGGCGGG + Intronic
1101910476 12:108857368-108857390 GGACGCCGCGCCGAGGCCGCCGG - Intronic
1103474811 12:121210435-121210457 AGCCGCCGCGCCGGGGCCCCGGG + Intronic
1105411858 13:20177527-20177549 GGAGGCGGCGCGGTGGCCGCGGG - Intergenic
1105454251 13:20525806-20525828 GGACGCGGCGCCGCGGGCGCTGG + Exonic
1106104430 13:26721841-26721863 GGTCGCCACGCTGAGCCCGCAGG - Intergenic
1106221248 13:27748257-27748279 GGATCCCGCGCCGGGGCTGCAGG + Intergenic
1107836192 13:44413991-44414013 GGATCCCGCACCGAGGCTGCAGG - Intergenic
1110195346 13:72782056-72782078 GGAAGCCCCGCCTAGGCCACGGG - Exonic
1111672763 13:91348995-91349017 GGTCGCCGCGCGGCTGCCGCCGG + Intergenic
1112461470 13:99606824-99606846 GGAGGCCGCGCCCGGCCCGCGGG - Intronic
1113768441 13:112894613-112894635 GGACGCTGGGCAGGGGCCGCGGG - Intronic
1114957843 14:27845790-27845812 GGATCCCGCGCTGGGGCCGCTGG - Intergenic
1115556151 14:34546502-34546524 GCACGGCGCGCGGAGGCTGCCGG + Intergenic
1115557757 14:34556579-34556601 GCACGGCGCGCGGAGGCTGCCGG - Intergenic
1119357499 14:74019278-74019300 GGAGGTCGCGCCGAGGGCGGCGG - Exonic
1119520097 14:75278868-75278890 GTTCGCTGCGCCGCGGCCGCCGG - Exonic
1122517663 14:102319954-102319976 GGACGCGGCGCGGCGGCTGCGGG + Exonic
1122544981 14:102517165-102517187 GGGGGGCCCGCCGAGGCCGCGGG - Intergenic
1123710202 15:22980838-22980860 GGTCGGCGCGCAGAGCCCGCTGG + Intronic
1123716710 15:23039212-23039234 GGGCACCGCGCCGAGAGCGCTGG + Intronic
1124971486 15:34494383-34494405 GGAGGCCGCGGCGCGGCCCCGGG - Intergenic
1128423982 15:67521225-67521247 GCCCGCCGCGCCGGGGACGCAGG - Exonic
1128598495 15:68975613-68975635 GGACCCCGCACCGGGGCTGCAGG + Intronic
1130348017 15:83066898-83066920 GGTCGCGGCGCCGCCGCCGCTGG - Exonic
1131012630 15:89031643-89031665 GGATCCCGCACCGGGGCCGCAGG + Intergenic
1131113018 15:89776992-89777014 GGACGCCTCGGCGAGGACGGCGG - Exonic
1131912671 15:97224663-97224685 GGATTCCGCGCCGGGGCCGCGGG - Intergenic
1132481078 16:166403-166425 GCGCGCCGCGCTGAGCCCGCTGG + Exonic
1132662040 16:1065942-1065964 GGACCCGCCGCCGCGGCCGCAGG - Intergenic
1132719739 16:1309786-1309808 GGGGGCCGGGCCGGGGCCGCGGG + Intronic
1133164834 16:3939072-3939094 GGACGCCGCGTGGGGGACGCTGG + Intergenic
1133723556 16:8517046-8517068 GAAGGCCCCACCGAGGCCGCAGG + Intergenic
1137300505 16:47143915-47143937 GGATCCCGCGCCGGGGCCGCGGG - Exonic
1137442586 16:48509104-48509126 GGATCCCGCACCGGGGCCGCAGG - Intergenic
1137787651 16:51151633-51151655 GGACTCCGCGGCCCGGCCGCCGG + Intergenic
1139600357 16:67982639-67982661 GGATGCTGCACCGGGGCCGCAGG - Intergenic
1141386068 16:83623487-83623509 GCACACCGCTCCGAGGCCGAAGG - Intronic
1142120096 16:88382963-88382985 GGACGCCGGCCGGCGGCCGCGGG - Intergenic
1142363057 16:89636302-89636324 AGACGCCGTGCGGAGGACGCTGG + Exonic
1142672227 17:1492504-1492526 GGCCGCGGTGCCCAGGCCGCTGG - Exonic
1142811764 17:2398944-2398966 GGTCGCCCCGACTAGGCCGCCGG + Intronic
1142982614 17:3680534-3680556 GGACGCCGGGTGGAGGACGCTGG - Intronic
1146208308 17:30922774-30922796 GGTCGCCGCGCAGCGGCCGGTGG + Intronic
1147045061 17:37745555-37745577 GGAAGGGGCGCCGAGGCCACGGG + Intergenic
1147341243 17:39754375-39754397 GGTCGCCGCGGCCAGGCCTCCGG + Intergenic
1147871215 17:43588890-43588912 GGACTCCGTGCCGAGGGCACTGG - Intergenic
1148323679 17:46771635-46771657 GGCCGCCGGGCCCGGGCCGCCGG + Intronic
1148356495 17:46979020-46979042 GGACTGCGCGCCGAGACCCCCGG - Exonic
1148471462 17:47896342-47896364 GGAAGACGGGCAGAGGCCGCGGG + Intronic
1148562580 17:48614339-48614361 GGCCTCCTCGCCCAGGCCGCTGG + Exonic
1149099187 17:52883919-52883941 GGATGCCGCACCAGGGCCGCAGG + Intronic
1149916478 17:60614055-60614077 GGATCCCGCACCGGGGCCGCAGG - Intronic
1152361186 17:79833880-79833902 GGAGCCCGCCCCGAGGCCCCAGG + Exonic
1152834335 17:82519762-82519784 GGGGGCCGAGCGGAGGCCGCCGG - Exonic
1152924083 17:83079673-83079695 GGCGGCCGCGCGGAGGACGCGGG + Exonic
1153949471 18:10045869-10045891 GGAGGCCGGGCCGAGGAGGCTGG + Intergenic
1154125689 18:11689975-11689997 GGACAGCGCGCCGGGCCCGCGGG + Intronic
1154303969 18:13217703-13217725 GGACGCGGCGCTGCGGCCGCCGG - Intronic
1157856833 18:51111787-51111809 GGATCCCGCACCGGGGCCGCAGG + Intergenic
1158434949 18:57428799-57428821 GGCTGCGGCGTCGAGGCCGCGGG - Intergenic
1160773250 19:843303-843325 GGACTCAGCGCCCAGGCCGGGGG - Intronic
1162817825 19:13207231-13207253 AGGAGCCGCGCAGAGGCCGCGGG - Exonic
1163123829 19:15233436-15233458 CGGCGCCGGGCCGAGGCCGCTGG - Intergenic
1163138647 19:15331960-15331982 GGGCGCCGCGGCGGGGCCGGCGG - Intronic
1163777116 19:19225154-19225176 AGACGCCGCGCCGGCGCTGCGGG + Exonic
1167268250 19:48493882-48493904 GGGCGCGGCGGCGGGGCCGCGGG - Exonic
1168412186 19:56146995-56147017 GGGCGACGCGCCGGGCCCGCGGG + Exonic
1168604410 19:57747064-57747086 GGCGGCCGCGCTGAGGCCCCCGG + Exonic
1168609261 19:57786285-57786307 GGCCACCGCGGCGAGGACGCAGG - Intronic
927714203 2:25341864-25341886 GGACGCGGCGCCGCGGCACCAGG - Intronic
929701901 2:44169317-44169339 GGCCGCGCCGCCGAGGCCCCGGG + Intronic
931737023 2:65205095-65205117 GGTCGCCATGGCGAGGCCGCGGG - Intergenic
932036443 2:68251892-68251914 GGGCGCCCCGCAGAGGCCGGGGG + Intronic
933506386 2:83181416-83181438 GGATCCCGCACCGGGGCCGCAGG - Intergenic
933658307 2:84906532-84906554 GCACTCCGCGCCGATGCCACCGG + Exonic
934479460 2:94622144-94622166 GGATCCCGCGCTGGGGCCGCTGG + Intergenic
934846381 2:97663746-97663768 GGAGGACGCGCCGAGGCGGGCGG + Intronic
935149065 2:100417509-100417531 GGCCGCGGCGCGGAGGCCTCGGG - Exonic
935396943 2:102619480-102619502 GGGCGCGGCGCCCAAGCCGCAGG - Intergenic
940640776 2:156342445-156342467 GGCCGCGGGGCCGAGTCCGCGGG - Intergenic
942276380 2:174326719-174326741 GGGCGCTCCGCCGAGGGCGCGGG + Intergenic
943790104 2:191922004-191922026 GGATCCCGCACCGGGGCCGCAGG - Intergenic
944413571 2:199463472-199463494 TGACGCCAAGCCGAGGCCTCGGG - Intronic
946178761 2:217937654-217937676 GGACGCCCAGCAGAGGCCCCGGG + Intronic
948643736 2:239391061-239391083 CGAGGCCGAGCCGAGGCCCCTGG - Intronic
1169483442 20:6006221-6006243 AGACCCCGCGGCGCGGCCGCAGG + Exonic
1172335526 20:34112425-34112447 AGACGCCGCGCACAGGTCGCTGG - Intergenic
1178922540 21:36747965-36747987 GGTCGCCGCCTCGGGGCCGCCGG - Exonic
1178961793 21:37072866-37072888 GGTCGCGGCGCCCAGGCCCCGGG + Intronic
1178992134 21:37365987-37366009 GGACGCTGCGCCGGGCCCGGCGG - Intronic
1180001085 21:44995855-44995877 GGACGCAGCGGCAAGGCAGCTGG + Intergenic
1180876726 22:19178327-19178349 GGCCGCCGCGCCAGTGCCGCGGG + Intronic
1180940301 22:19656512-19656534 GGGAGCCGGGCTGAGGCCGCGGG - Intergenic
1181077601 22:20392354-20392376 GGATCCCGCACCGGGGCCGCAGG + Intergenic
1181450470 22:23016996-23017018 GGATCCCGCGCCGGGGCTGCAGG + Intergenic
1184035258 22:41915001-41915023 GGAGGCCGCGCCGGGGCCGCGGG + Intergenic
1184046770 22:41976902-41976924 GGGCGGCGCGGCGGGGCCGCGGG + Exonic
1184152985 22:42649264-42649286 GGAGGGGGCGCCGGGGCCGCGGG - Intronic
1185056274 22:48580052-48580074 GTACACCGTGCCGCGGCCGCTGG - Intronic
1185375539 22:50481336-50481358 GGACGCAGCCCCGAGCCTGCGGG - Intergenic
950601305 3:14037622-14037644 GGATCCCGTGCCGGGGCCGCGGG - Intronic
952058016 3:29473448-29473470 GGATCCCGCACGGAGGCCGCAGG + Intronic
952076377 3:29701956-29701978 GGATCCCGCGCCACGGCCGCGGG - Intronic
953002963 3:38951568-38951590 GGATCCCGCACCGGGGCCGCAGG - Intergenic
954540746 3:51391679-51391701 GGACGCGGCGGCAAGGCCTCGGG + Exonic
956632672 3:71331514-71331536 GGATCCCGCACCGGGGCCGCAGG - Intronic
961329655 3:126131054-126131076 GGATGCAGGGCTGAGGCCGCAGG - Intronic
964983081 3:162710451-162710473 GGATCCCGCGCCAGGGCCGCAGG + Intergenic
966355100 3:179071613-179071635 GGACGCGGCGCGGAGACTGCCGG - Exonic
966696298 3:182793579-182793601 GGACTCGGGGCCGACGCCGCGGG + Exonic
967904279 3:194487513-194487535 GGACTCTGCGCCCCGGCCGCAGG + Intronic
968412738 4:403943-403965 GGATCCCGCGCCGGGGCTGCAGG + Intergenic
968518488 4:1024708-1024730 GGACGCCGGGCCCAGGGGGCGGG - Intronic
968653883 4:1770465-1770487 GGACCCCGTGCCCGGGCCGCAGG - Intergenic
976390398 4:84499377-84499399 GGACGTCACTCCGAGGCTGCGGG + Intergenic
978503650 4:109434132-109434154 GGGCGCGGTGCGGAGGCCGCGGG + Intronic
980075438 4:128288346-128288368 GGACGCCTGGCGGAGGACGCGGG + Exonic
983296339 4:165873533-165873555 GCTCGCCGAGCCGCGGCCGCGGG + Exonic
984167531 4:176320297-176320319 GGCTGCCGTGCCGGGGCCGCGGG + Intronic
984206331 4:176792369-176792391 GGGCGCCCCTGCGAGGCCGCGGG + Exonic
984699083 4:182807110-182807132 GGAGGCCAGGCCGAGGCGGCTGG - Intergenic
984734797 4:183099165-183099187 GGTCGCGGCGCCCAGGCTGCCGG - Intergenic
986449217 5:7849917-7849939 GGGAGCCGCGCCCAGCCCGCTGG + Intronic
987050470 5:14143766-14143788 GGCCGCCGCGGCGGGGCCGGAGG - Exonic
996329429 5:122312304-122312326 GGACGCCGCGGGGAGGCGGGAGG + Intronic
999809639 5:155115213-155115235 GGATCCTGCGCCAAGGCCGCAGG - Intergenic
1000084821 5:157879695-157879717 GGATCCCACACCGAGGCCGCAGG - Intergenic
1000463408 5:161548177-161548199 GGCCGCCTCGCCGTGGCCGCCGG + Intronic
1002029390 5:176416619-176416641 GGTCGCCGAGCAGCGGCCGCAGG + Intergenic
1004216930 6:13711746-13711768 GGACGAGGCGCCGAGGGCGGGGG + Intergenic
1004694254 6:18019619-18019641 GGATCCCGCACCGGGGCCGCAGG + Intergenic
1005332805 6:24765878-24765900 GGATCCCGCGCCGGGGCTGCAGG + Intergenic
1005600792 6:27424770-27424792 GGACCCCGCGCTGGGGCTGCAGG + Intergenic
1005712083 6:28512204-28512226 GGATGCCGCACCACGGCCGCAGG - Intronic
1006008386 6:31021138-31021160 GGATCCCGCCCCGGGGCCGCAGG - Intronic
1006366750 6:33620878-33620900 GGAGACCGCGCGGTGGCCGCAGG + Exonic
1011470230 6:87701424-87701446 GGACCCGGCCCCGCGGCCGCCGG - Intronic
1011974834 6:93283023-93283045 GGATCCCGCACCGGGGCCGCAGG - Intronic
1012474144 6:99603139-99603161 GGACGCAGCCCGGACGCCGCTGG - Intergenic
1015149274 6:130020001-130020023 GGCGGCCGCGCCGGGGCGGCGGG + Intronic
1015799195 6:137044202-137044224 GGATGCCGCGTCTCGGCCGCCGG - Intronic
1017282127 6:152636842-152636864 GGGCGCCGGGCCGCGGCCGCCGG - Intronic
1017793650 6:157823108-157823130 GGAGGCCGGGCCGCGGCCGAGGG + Intronic
1017929408 6:158939173-158939195 GGCCGCAGTGCCGGGGCCGCAGG - Intergenic
1019172697 6:170142962-170142984 GGACGAGGCACCGAGGCCCCTGG + Intergenic
1019681813 7:2354791-2354813 GGAGGCCGCACCAAGGCCGCGGG - Intronic
1019719462 7:2559456-2559478 GGACGCCGCGCCCTCGCCTCTGG + Intronic
1020008072 7:4792677-4792699 GGCCGCTGAGCCGGGGCCGCAGG + Intronic
1020278330 7:6637568-6637590 GGAGGCCGCGGGGAGGCGGCGGG + Intronic
1024748127 7:52431184-52431206 GGATCCCGCGCCGGGGCCGCAGG + Intergenic
1027654944 7:80919122-80919144 GGGCGGCGCGCCGGGGCAGCCGG - Exonic
1027674552 7:81142156-81142178 GGATCCCGCACCGGGGCCGCAGG - Intergenic
1033866573 7:145697355-145697377 GGATCCCGCACCGGGGCCGCAGG + Intergenic
1034441099 7:151086487-151086509 GGAGGCTGCTCCGAGGCAGCGGG + Intronic
1034486523 7:151368244-151368266 GGACGCCTCGCTGAGGCTGGCGG - Intronic
1038017714 8:23529285-23529307 GGACGCTGCCCCGAGGCTGCCGG - Intronic
1038543981 8:28411912-28411934 GGACGCCGGGCTGAAGCCGCGGG - Intronic
1041449797 8:57994648-57994670 GGTCGCCGCCGCGGGGCCGCGGG - Exonic
1043073269 8:75665408-75665430 GGATCCCGCACCGGGGCCGCAGG + Intergenic
1049718207 8:144103660-144103682 GCACGCCGCGGTGAGGCCGCTGG - Exonic
1053372724 9:37576234-37576256 GGAGTCCGGGCCGCGGCCGCCGG + Exonic
1053928352 9:43089780-43089802 GGATCCCGCGCTGGGGCCGCTGG - Intergenic
1055090968 9:72364747-72364769 TGAGGCCGGGCCGAGGCCTCCGG + Intronic
1056126231 9:83538383-83538405 GCCCGCCGCGCCCCGGCCGCTGG - Exonic
1061181710 9:129028331-129028353 GGGCGGGGCGCGGAGGCCGCGGG + Intergenic
1061490142 9:130939918-130939940 CGCCGCCCCGCCGAGCCCGCCGG + Intergenic
1062325694 9:136011544-136011566 GGCCTCCGGGCCGCGGCCGCCGG + Exonic
1062600318 9:137316303-137316325 GGCCGGCGCGCGAAGGCCGCGGG - Intronic
1062659147 9:137619209-137619231 CGAGGCCGGGCCGAGGCCGCCGG + Intronic
1185610737 X:1392520-1392542 GGAGGCCGCGGCGACCCCGCCGG + Exonic
1187419543 X:19122527-19122549 GGGGGCGGCGCCGAGGCCGCGGG - Exonic
1190266964 X:48832315-48832337 AGACGCTGCGCTTAGGCCGCGGG + Exonic
1192481843 X:71492681-71492703 GGACTGCGCGCAGAAGCCGCGGG - Intronic
1199134103 X:144231195-144231217 GGATCCCGCACCGAGGCTGCAGG + Intergenic
1199724554 X:150568285-150568307 GGGCGCCGGGCGGAGGCGGCTGG - Intergenic