ID: 1101910478

View in Genome Browser
Species Human (GRCh38)
Location 12:108857373-108857395
Sequence GGCCTCGGCGCGGCGTCCGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 164}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101910464_1101910478 9 Left 1101910464 12:108857341-108857363 CCCTGCCCCGCACGCGCGGCCCC 0: 1
1: 0
2: 2
3: 38
4: 419
Right 1101910478 12:108857373-108857395 GGCCTCGGCGCGGCGTCCGGCGG 0: 1
1: 0
2: 0
3: 12
4: 164
1101910465_1101910478 8 Left 1101910465 12:108857342-108857364 CCTGCCCCGCACGCGCGGCCCCA 0: 1
1: 1
2: 4
3: 31
4: 396
Right 1101910478 12:108857373-108857395 GGCCTCGGCGCGGCGTCCGGCGG 0: 1
1: 0
2: 0
3: 12
4: 164
1101910468_1101910478 2 Left 1101910468 12:108857348-108857370 CCGCACGCGCGGCCCCAGCTCCG 0: 1
1: 0
2: 2
3: 20
4: 262
Right 1101910478 12:108857373-108857395 GGCCTCGGCGCGGCGTCCGGCGG 0: 1
1: 0
2: 0
3: 12
4: 164
1101910466_1101910478 4 Left 1101910466 12:108857346-108857368 CCCCGCACGCGCGGCCCCAGCTC 0: 1
1: 0
2: 0
3: 14
4: 190
Right 1101910478 12:108857373-108857395 GGCCTCGGCGCGGCGTCCGGCGG 0: 1
1: 0
2: 0
3: 12
4: 164
1101910457_1101910478 24 Left 1101910457 12:108857326-108857348 CCCGCGCAGCCGCCCCCCTGCCC 0: 1
1: 0
2: 3
3: 85
4: 883
Right 1101910478 12:108857373-108857395 GGCCTCGGCGCGGCGTCCGGCGG 0: 1
1: 0
2: 0
3: 12
4: 164
1101910459_1101910478 15 Left 1101910459 12:108857335-108857357 CCGCCCCCCTGCCCCGCACGCGC 0: 1
1: 1
2: 3
3: 110
4: 1052
Right 1101910478 12:108857373-108857395 GGCCTCGGCGCGGCGTCCGGCGG 0: 1
1: 0
2: 0
3: 12
4: 164
1101910472_1101910478 -10 Left 1101910472 12:108857360-108857382 CCCCAGCTCCGGCGGCCTCGGCG 0: 1
1: 1
2: 2
3: 22
4: 237
Right 1101910478 12:108857373-108857395 GGCCTCGGCGCGGCGTCCGGCGG 0: 1
1: 0
2: 0
3: 12
4: 164
1101910467_1101910478 3 Left 1101910467 12:108857347-108857369 CCCGCACGCGCGGCCCCAGCTCC 0: 1
1: 0
2: 5
3: 43
4: 464
Right 1101910478 12:108857373-108857395 GGCCTCGGCGCGGCGTCCGGCGG 0: 1
1: 0
2: 0
3: 12
4: 164
1101910461_1101910478 12 Left 1101910461 12:108857338-108857360 CCCCCCTGCCCCGCACGCGCGGC 0: 1
1: 0
2: 4
3: 24
4: 349
Right 1101910478 12:108857373-108857395 GGCCTCGGCGCGGCGTCCGGCGG 0: 1
1: 0
2: 0
3: 12
4: 164
1101910463_1101910478 10 Left 1101910463 12:108857340-108857362 CCCCTGCCCCGCACGCGCGGCCC 0: 1
1: 0
2: 5
3: 39
4: 370
Right 1101910478 12:108857373-108857395 GGCCTCGGCGCGGCGTCCGGCGG 0: 1
1: 0
2: 0
3: 12
4: 164
1101910458_1101910478 23 Left 1101910458 12:108857327-108857349 CCGCGCAGCCGCCCCCCTGCCCC 0: 1
1: 1
2: 5
3: 135
4: 1281
Right 1101910478 12:108857373-108857395 GGCCTCGGCGCGGCGTCCGGCGG 0: 1
1: 0
2: 0
3: 12
4: 164
1101910462_1101910478 11 Left 1101910462 12:108857339-108857361 CCCCCTGCCCCGCACGCGCGGCC 0: 1
1: 1
2: 1
3: 36
4: 380
Right 1101910478 12:108857373-108857395 GGCCTCGGCGCGGCGTCCGGCGG 0: 1
1: 0
2: 0
3: 12
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101910478 Original CRISPR GGCCTCGGCGCGGCGTCCGG CGG Intronic