ID: 1101910479

View in Genome Browser
Species Human (GRCh38)
Location 12:108857375-108857397
Sequence GGCCGCCGGACGCCGCGCCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 175}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101910479_1101910488 1 Left 1101910479 12:108857375-108857397 CCTCGGCGCGGCGTCCGGCGGCC 0: 1
1: 0
2: 2
3: 12
4: 175
Right 1101910488 12:108857399-108857421 AGGCCGGGCGCGGCGAGCCCGGG 0: 1
1: 1
2: 2
3: 26
4: 283
1101910479_1101910493 21 Left 1101910479 12:108857375-108857397 CCTCGGCGCGGCGTCCGGCGGCC 0: 1
1: 0
2: 2
3: 12
4: 175
Right 1101910493 12:108857419-108857441 GGGGCTCACCTCGCTGTTGCTGG 0: 1
1: 0
2: 0
3: 10
4: 143
1101910479_1101910489 2 Left 1101910479 12:108857375-108857397 CCTCGGCGCGGCGTCCGGCGGCC 0: 1
1: 0
2: 2
3: 12
4: 175
Right 1101910489 12:108857400-108857422 GGCCGGGCGCGGCGAGCCCGGGG 0: 1
1: 0
2: 5
3: 52
4: 417
1101910479_1101910494 27 Left 1101910479 12:108857375-108857397 CCTCGGCGCGGCGTCCGGCGGCC 0: 1
1: 0
2: 2
3: 12
4: 175
Right 1101910494 12:108857425-108857447 CACCTCGCTGTTGCTGGCCGAGG 0: 1
1: 0
2: 0
3: 8
4: 157
1101910479_1101910487 0 Left 1101910479 12:108857375-108857397 CCTCGGCGCGGCGTCCGGCGGCC 0: 1
1: 0
2: 2
3: 12
4: 175
Right 1101910487 12:108857398-108857420 CAGGCCGGGCGCGGCGAGCCCGG 0: 1
1: 0
2: 3
3: 33
4: 353
1101910479_1101910484 -9 Left 1101910479 12:108857375-108857397 CCTCGGCGCGGCGTCCGGCGGCC 0: 1
1: 0
2: 2
3: 12
4: 175
Right 1101910484 12:108857389-108857411 CCGGCGGCCCAGGCCGGGCGCGG 0: 1
1: 0
2: 3
3: 56
4: 563
1101910479_1101910496 30 Left 1101910479 12:108857375-108857397 CCTCGGCGCGGCGTCCGGCGGCC 0: 1
1: 0
2: 2
3: 12
4: 175
Right 1101910496 12:108857428-108857450 CTCGCTGTTGCTGGCCGAGGAGG 0: 1
1: 0
2: 0
3: 14
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101910479 Original CRISPR GGCCGCCGGACGCCGCGCCG AGG (reversed) Intronic