ID: 1101910484

View in Genome Browser
Species Human (GRCh38)
Location 12:108857389-108857411
Sequence CCGGCGGCCCAGGCCGGGCG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 623
Summary {0: 1, 1: 0, 2: 3, 3: 56, 4: 563}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101910465_1101910484 24 Left 1101910465 12:108857342-108857364 CCTGCCCCGCACGCGCGGCCCCA 0: 1
1: 1
2: 4
3: 31
4: 396
Right 1101910484 12:108857389-108857411 CCGGCGGCCCAGGCCGGGCGCGG 0: 1
1: 0
2: 3
3: 56
4: 563
1101910461_1101910484 28 Left 1101910461 12:108857338-108857360 CCCCCCTGCCCCGCACGCGCGGC 0: 1
1: 0
2: 4
3: 24
4: 349
Right 1101910484 12:108857389-108857411 CCGGCGGCCCAGGCCGGGCGCGG 0: 1
1: 0
2: 3
3: 56
4: 563
1101910463_1101910484 26 Left 1101910463 12:108857340-108857362 CCCCTGCCCCGCACGCGCGGCCC 0: 1
1: 0
2: 5
3: 39
4: 370
Right 1101910484 12:108857389-108857411 CCGGCGGCCCAGGCCGGGCGCGG 0: 1
1: 0
2: 3
3: 56
4: 563
1101910468_1101910484 18 Left 1101910468 12:108857348-108857370 CCGCACGCGCGGCCCCAGCTCCG 0: 1
1: 0
2: 2
3: 20
4: 262
Right 1101910484 12:108857389-108857411 CCGGCGGCCCAGGCCGGGCGCGG 0: 1
1: 0
2: 3
3: 56
4: 563
1101910473_1101910484 5 Left 1101910473 12:108857361-108857383 CCCAGCTCCGGCGGCCTCGGCGC 0: 1
1: 1
2: 0
3: 14
4: 149
Right 1101910484 12:108857389-108857411 CCGGCGGCCCAGGCCGGGCGCGG 0: 1
1: 0
2: 3
3: 56
4: 563
1101910466_1101910484 20 Left 1101910466 12:108857346-108857368 CCCCGCACGCGCGGCCCCAGCTC 0: 1
1: 0
2: 0
3: 14
4: 190
Right 1101910484 12:108857389-108857411 CCGGCGGCCCAGGCCGGGCGCGG 0: 1
1: 0
2: 3
3: 56
4: 563
1101910464_1101910484 25 Left 1101910464 12:108857341-108857363 CCCTGCCCCGCACGCGCGGCCCC 0: 1
1: 0
2: 2
3: 38
4: 419
Right 1101910484 12:108857389-108857411 CCGGCGGCCCAGGCCGGGCGCGG 0: 1
1: 0
2: 3
3: 56
4: 563
1101910474_1101910484 4 Left 1101910474 12:108857362-108857384 CCAGCTCCGGCGGCCTCGGCGCG 0: 2
1: 0
2: 2
3: 30
4: 178
Right 1101910484 12:108857389-108857411 CCGGCGGCCCAGGCCGGGCGCGG 0: 1
1: 0
2: 3
3: 56
4: 563
1101910472_1101910484 6 Left 1101910472 12:108857360-108857382 CCCCAGCTCCGGCGGCCTCGGCG 0: 1
1: 1
2: 2
3: 22
4: 237
Right 1101910484 12:108857389-108857411 CCGGCGGCCCAGGCCGGGCGCGG 0: 1
1: 0
2: 3
3: 56
4: 563
1101910467_1101910484 19 Left 1101910467 12:108857347-108857369 CCCGCACGCGCGGCCCCAGCTCC 0: 1
1: 0
2: 5
3: 43
4: 464
Right 1101910484 12:108857389-108857411 CCGGCGGCCCAGGCCGGGCGCGG 0: 1
1: 0
2: 3
3: 56
4: 563
1101910479_1101910484 -9 Left 1101910479 12:108857375-108857397 CCTCGGCGCGGCGTCCGGCGGCC 0: 1
1: 0
2: 2
3: 12
4: 175
Right 1101910484 12:108857389-108857411 CCGGCGGCCCAGGCCGGGCGCGG 0: 1
1: 0
2: 3
3: 56
4: 563
1101910462_1101910484 27 Left 1101910462 12:108857339-108857361 CCCCCTGCCCCGCACGCGCGGCC 0: 1
1: 1
2: 1
3: 36
4: 380
Right 1101910484 12:108857389-108857411 CCGGCGGCCCAGGCCGGGCGCGG 0: 1
1: 0
2: 3
3: 56
4: 563
1101910476_1101910484 -2 Left 1101910476 12:108857368-108857390 CCGGCGGCCTCGGCGCGGCGTCC 0: 1
1: 0
2: 1
3: 18
4: 194
Right 1101910484 12:108857389-108857411 CCGGCGGCCCAGGCCGGGCGCGG 0: 1
1: 0
2: 3
3: 56
4: 563

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101910484 Original CRISPR CCGGCGGCCCAGGCCGGGCG CGG Intronic