ID: 1101910487

View in Genome Browser
Species Human (GRCh38)
Location 12:108857398-108857420
Sequence CAGGCCGGGCGCGGCGAGCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 390
Summary {0: 1, 1: 0, 2: 3, 3: 33, 4: 353}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101910466_1101910487 29 Left 1101910466 12:108857346-108857368 CCCCGCACGCGCGGCCCCAGCTC 0: 1
1: 0
2: 0
3: 14
4: 190
Right 1101910487 12:108857398-108857420 CAGGCCGGGCGCGGCGAGCCCGG 0: 1
1: 0
2: 3
3: 33
4: 353
1101910479_1101910487 0 Left 1101910479 12:108857375-108857397 CCTCGGCGCGGCGTCCGGCGGCC 0: 1
1: 0
2: 2
3: 12
4: 175
Right 1101910487 12:108857398-108857420 CAGGCCGGGCGCGGCGAGCCCGG 0: 1
1: 0
2: 3
3: 33
4: 353
1101910467_1101910487 28 Left 1101910467 12:108857347-108857369 CCCGCACGCGCGGCCCCAGCTCC 0: 1
1: 0
2: 5
3: 43
4: 464
Right 1101910487 12:108857398-108857420 CAGGCCGGGCGCGGCGAGCCCGG 0: 1
1: 0
2: 3
3: 33
4: 353
1101910473_1101910487 14 Left 1101910473 12:108857361-108857383 CCCAGCTCCGGCGGCCTCGGCGC 0: 1
1: 1
2: 0
3: 14
4: 149
Right 1101910487 12:108857398-108857420 CAGGCCGGGCGCGGCGAGCCCGG 0: 1
1: 0
2: 3
3: 33
4: 353
1101910468_1101910487 27 Left 1101910468 12:108857348-108857370 CCGCACGCGCGGCCCCAGCTCCG 0: 1
1: 0
2: 2
3: 20
4: 262
Right 1101910487 12:108857398-108857420 CAGGCCGGGCGCGGCGAGCCCGG 0: 1
1: 0
2: 3
3: 33
4: 353
1101910474_1101910487 13 Left 1101910474 12:108857362-108857384 CCAGCTCCGGCGGCCTCGGCGCG 0: 2
1: 0
2: 2
3: 30
4: 178
Right 1101910487 12:108857398-108857420 CAGGCCGGGCGCGGCGAGCCCGG 0: 1
1: 0
2: 3
3: 33
4: 353
1101910472_1101910487 15 Left 1101910472 12:108857360-108857382 CCCCAGCTCCGGCGGCCTCGGCG 0: 1
1: 1
2: 2
3: 22
4: 237
Right 1101910487 12:108857398-108857420 CAGGCCGGGCGCGGCGAGCCCGG 0: 1
1: 0
2: 3
3: 33
4: 353
1101910476_1101910487 7 Left 1101910476 12:108857368-108857390 CCGGCGGCCTCGGCGCGGCGTCC 0: 1
1: 0
2: 1
3: 18
4: 194
Right 1101910487 12:108857398-108857420 CAGGCCGGGCGCGGCGAGCCCGG 0: 1
1: 0
2: 3
3: 33
4: 353

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101910487 Original CRISPR CAGGCCGGGCGCGGCGAGCC CGG Intronic