ID: 1101910493

View in Genome Browser
Species Human (GRCh38)
Location 12:108857419-108857441
Sequence GGGGCTCACCTCGCTGTTGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 143}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101910476_1101910493 28 Left 1101910476 12:108857368-108857390 CCGGCGGCCTCGGCGCGGCGTCC 0: 1
1: 0
2: 1
3: 18
4: 194
Right 1101910493 12:108857419-108857441 GGGGCTCACCTCGCTGTTGCTGG 0: 1
1: 0
2: 0
3: 10
4: 143
1101910483_1101910493 7 Left 1101910483 12:108857389-108857411 CCGGCGGCCCAGGCCGGGCGCGG 0: 1
1: 0
2: 4
3: 72
4: 401
Right 1101910493 12:108857419-108857441 GGGGCTCACCTCGCTGTTGCTGG 0: 1
1: 0
2: 0
3: 10
4: 143
1101910486_1101910493 -1 Left 1101910486 12:108857397-108857419 CCAGGCCGGGCGCGGCGAGCCCG 0: 1
1: 0
2: 2
3: 25
4: 304
Right 1101910493 12:108857419-108857441 GGGGCTCACCTCGCTGTTGCTGG 0: 1
1: 0
2: 0
3: 10
4: 143
1101910490_1101910493 -6 Left 1101910490 12:108857402-108857424 CCGGGCGCGGCGAGCCCGGGGCT 0: 1
1: 0
2: 4
3: 35
4: 228
Right 1101910493 12:108857419-108857441 GGGGCTCACCTCGCTGTTGCTGG 0: 1
1: 0
2: 0
3: 10
4: 143
1101910485_1101910493 0 Left 1101910485 12:108857396-108857418 CCCAGGCCGGGCGCGGCGAGCCC 0: 1
1: 0
2: 1
3: 14
4: 248
Right 1101910493 12:108857419-108857441 GGGGCTCACCTCGCTGTTGCTGG 0: 1
1: 0
2: 0
3: 10
4: 143
1101910479_1101910493 21 Left 1101910479 12:108857375-108857397 CCTCGGCGCGGCGTCCGGCGGCC 0: 1
1: 0
2: 2
3: 12
4: 175
Right 1101910493 12:108857419-108857441 GGGGCTCACCTCGCTGTTGCTGG 0: 1
1: 0
2: 0
3: 10
4: 143

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101910493 Original CRISPR GGGGCTCACCTCGCTGTTGC TGG Exonic