ID: 1101919297

View in Genome Browser
Species Human (GRCh38)
Location 12:108919426-108919448
Sequence CCCACACCTGTGCCCACACT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 416
Summary {0: 1, 1: 0, 2: 3, 3: 49, 4: 363}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101919292_1101919297 -5 Left 1101919292 12:108919408-108919430 CCCACACCTGGGCCTATACCCAC 0: 2
1: 1
2: 4
3: 15
4: 312
Right 1101919297 12:108919426-108919448 CCCACACCTGTGCCCACACTTGG 0: 1
1: 0
2: 3
3: 49
4: 363
1101919282_1101919297 25 Left 1101919282 12:108919378-108919400 CCTGGGCCTATACCCACACCTGG 0: 1
1: 1
2: 3
3: 18
4: 217
Right 1101919297 12:108919426-108919448 CCCACACCTGTGCCCACACTTGG 0: 1
1: 0
2: 3
3: 49
4: 363
1101919288_1101919297 7 Left 1101919288 12:108919396-108919418 CCTGGGCCTGCACCCACACCTGG 0: 2
1: 1
2: 10
3: 88
4: 702
Right 1101919297 12:108919426-108919448 CCCACACCTGTGCCCACACTTGG 0: 1
1: 0
2: 3
3: 49
4: 363
1101919293_1101919297 -6 Left 1101919293 12:108919409-108919431 CCACACCTGGGCCTATACCCACA 0: 2
1: 2
2: 5
3: 55
4: 464
Right 1101919297 12:108919426-108919448 CCCACACCTGTGCCCACACTTGG 0: 1
1: 0
2: 3
3: 49
4: 363
1101919287_1101919297 12 Left 1101919287 12:108919391-108919413 CCACACCTGGGCCTGCACCCACA 0: 2
1: 0
2: 9
3: 97
4: 522
Right 1101919297 12:108919426-108919448 CCCACACCTGTGCCCACACTTGG 0: 1
1: 0
2: 3
3: 49
4: 363
1101919285_1101919297 19 Left 1101919285 12:108919384-108919406 CCTATACCCACACCTGGGCCTGC 0: 2
1: 0
2: 6
3: 42
4: 373
Right 1101919297 12:108919426-108919448 CCCACACCTGTGCCCACACTTGG 0: 1
1: 0
2: 3
3: 49
4: 363
1101919286_1101919297 13 Left 1101919286 12:108919390-108919412 CCCACACCTGGGCCTGCACCCAC 0: 2
1: 0
2: 11
3: 49
4: 435
Right 1101919297 12:108919426-108919448 CCCACACCTGTGCCCACACTTGG 0: 1
1: 0
2: 3
3: 49
4: 363
1101919291_1101919297 1 Left 1101919291 12:108919402-108919424 CCTGCACCCACACCTGGGCCTAT 0: 1
1: 1
2: 2
3: 41
4: 336
Right 1101919297 12:108919426-108919448 CCCACACCTGTGCCCACACTTGG 0: 1
1: 0
2: 3
3: 49
4: 363
1101919281_1101919297 30 Left 1101919281 12:108919373-108919395 CCACACCTGGGCCTATACCCACA 0: 2
1: 2
2: 5
3: 55
4: 464
Right 1101919297 12:108919426-108919448 CCCACACCTGTGCCCACACTTGG 0: 1
1: 0
2: 3
3: 49
4: 363

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101919297 Original CRISPR CCCACACCTGTGCCCACACT TGG Intronic
900031437 1:375700-375722 TCCAGACCTGGGGCCACACTTGG + Intergenic
900051988 1:603900-603922 TCCAGACCTGGGGCCACACTTGG + Intergenic
900137429 1:1124144-1124166 CACACACCTGCACACACACTTGG + Intergenic
900390996 1:2433856-2433878 TCCACGGATGTGCCCACACTGGG + Intronic
900401255 1:2473854-2473876 CCCACACCAGAGGCCAGACTGGG - Intronic
900946829 1:5835500-5835522 CCCAGGCCTGTGCCCAGCCTGGG + Intergenic
901001109 1:6149174-6149196 CCCACCCCTGTGCCCTCATTTGG - Intronic
901023855 1:6268959-6268981 CCCACCCCTTTGCCCCCACATGG + Intronic
901039474 1:6355300-6355322 CCCACAGCTGTTTCCACACACGG + Intronic
902580345 1:17404004-17404026 CCCTCAGCTGCCCCCACACTGGG - Intergenic
902695855 1:18140467-18140489 CCCACAGCTGCCCCCACTCTAGG - Intronic
902771508 1:18647824-18647846 ACCCCACCTGCGCCCACATTTGG - Intronic
903339086 1:22643054-22643076 CCCATCCCAGTGGCCACACTTGG - Intergenic
904316499 1:29669594-29669616 CCCAGGGCTGTTCCCACACTAGG - Intergenic
905898857 1:41567438-41567460 CCATCACATGAGCCCACACTGGG - Intronic
905968693 1:42122617-42122639 TCCACATCTTTGCCAACACTTGG - Intergenic
906193246 1:43912681-43912703 CCCAGACCTGTGAGCACACCAGG + Intronic
907841836 1:58165718-58165740 CCAAAACCTCTGCCCACTCTGGG - Intronic
907865332 1:58394215-58394237 TCCACATCTCTGCCAACACTTGG - Intronic
908727933 1:67196983-67197005 CGCATACCTGTGCCCTCACTGGG - Intronic
909495780 1:76276803-76276825 TCCACATCTTTGCCAACACTTGG + Intronic
910477272 1:87620496-87620518 TCCACATCTTTGCCAACACTTGG - Intergenic
911168112 1:94743216-94743238 CTCACACCTGGCCCCACATTGGG + Intergenic
912013629 1:105004761-105004783 CCCACACCTGTGCTGGCACCTGG - Intergenic
912755924 1:112324939-112324961 CCCCCACCTCTTCCCACACTGGG + Intergenic
914847576 1:151291477-151291499 CCCACCCCCAGGCCCACACTGGG - Exonic
915013564 1:152712643-152712665 CCCACATATGTGCACACAGTGGG + Intergenic
915067370 1:153237364-153237386 CACACACCTTTGTCAACACTGGG - Intergenic
915900195 1:159841184-159841206 CCCACAGCTGTGCACATCCTGGG - Exonic
918089097 1:181272480-181272502 CCCACATGTCTGCCAACACTGGG + Intergenic
920044522 1:203124804-203124826 CACCCACCTCTGCCCACAGTGGG + Intronic
920650882 1:207836565-207836587 CCCACACCCATCCCAACACTTGG + Intergenic
922112011 1:222568601-222568623 TCCACATCTGTGCCAACACTTGG - Intronic
922974397 1:229771495-229771517 CCCACAGCCTTGCCCCCACTGGG - Intergenic
923224977 1:231930874-231930896 CCCACACCTCTGCTCACAGATGG - Intronic
1062957538 10:1550132-1550154 CCCACACCACAGCCCACACCTGG + Intronic
1063255024 10:4317929-4317951 TCCACAATTTTGCCCACACTTGG + Intergenic
1063428424 10:5967116-5967138 CACACACATGTGCACACACAAGG - Intronic
1066245219 10:33576421-33576443 CCCACATCCTTGCCCACACTTGG - Intergenic
1067120891 10:43471298-43471320 CCCACACTTGCTCGCACACTTGG + Intronic
1067439030 10:46297910-46297932 CCCTCACCTCTGCCCACTCACGG - Exonic
1067525606 10:47036559-47036581 CCCACACCTGTGCAGAAACAGGG - Intergenic
1067830355 10:49608272-49608294 GCCAGGCCTGTGCCCACATTGGG + Intergenic
1067947181 10:50696999-50697021 CCCACCCCTCAGCCCACACTTGG + Intergenic
1069854167 10:71430313-71430335 CCCACATCTTTGCCATCACTGGG - Intronic
1070882493 10:79861987-79862009 CCCACCCCTCAGCCCACACTTGG + Intergenic
1071649065 10:87378298-87378320 CCCACCCCTCAGCCCACACTTGG + Intergenic
1073085092 10:100883254-100883276 CCCACAGCTCTGCCCTCACTGGG + Intergenic
1074414039 10:113251529-113251551 TCCACACTGGAGCCCACACTTGG + Intergenic
1074519202 10:114202041-114202063 AGCACACCTGTGCACACACAGGG + Intronic
1075489995 10:122858599-122858621 TACACACCTGTGCCCACAGCAGG + Intronic
1075492175 10:122880430-122880452 CCTACTCCTGTGCACACAGTAGG + Intergenic
1075639806 10:124056532-124056554 CCTTCCCCTGTCCCCACACTTGG - Intronic
1075690801 10:124392924-124392946 CCCACCCCTGTGCCAGCATTTGG - Intergenic
1075757129 10:124821710-124821732 CCCACAGCCTTGCCAACACTGGG - Intronic
1075832487 10:125423352-125423374 ACCACTCCTGTGACAACACTTGG - Intergenic
1075886506 10:125904001-125904023 CCCACAGCTGTGACCACACCTGG + Intronic
1076865981 10:133166427-133166449 CACACACCCATTCCCACACTTGG - Intronic
1077034221 11:487155-487177 CGCACCCCTCAGCCCACACTTGG + Intronic
1077036442 11:497366-497388 CTCACCCATGTGCTCACACTCGG + Intronic
1077240734 11:1509118-1509140 CCAACAGCTGTCCCCACACAGGG + Intergenic
1077368251 11:2169929-2169951 CCCACAGCTGGTCCCACAGTCGG + Intronic
1077579867 11:3409974-3409996 GCCACATCTGTGGACACACTCGG - Intergenic
1078598858 11:12713347-12713369 CTCAAACCCGTGCCCACATTGGG + Intronic
1080078265 11:28179093-28179115 CACACACCTGTGTGCACACATGG + Intronic
1080139660 11:28901043-28901065 CCAACACCCTCGCCCACACTAGG - Intergenic
1082873539 11:57965688-57965710 TCCACATCTTTGCCAACACTTGG + Intergenic
1084020891 11:66417312-66417334 CACATGCCTGTGCCCACACCAGG + Intergenic
1084518094 11:69647130-69647152 CCCACACCTCTTCCCTTACTTGG + Intronic
1085259563 11:75196504-75196526 CTCCCACCAGTGCCCACCCTGGG + Exonic
1089534188 11:119150385-119150407 CCCACACCTGTGAGCACCATGGG + Intronic
1089560072 11:119339432-119339454 CACCCACCTGCACCCACACTTGG + Exonic
1089684656 11:120139063-120139085 CTCTCACCTGTCTCCACACTTGG + Intronic
1091704206 12:2682710-2682732 CCCACATTTGTTCCCACACTTGG - Intronic
1091710899 12:2739649-2739671 CTCACATCTGTTCCCACACCAGG - Intergenic
1091713752 12:2761399-2761421 CCCAGACATGTTCCCACATTTGG - Intergenic
1092109020 12:5945724-5945746 CCCACACCTGTCTCCATACTAGG + Intronic
1093188804 12:16051755-16051777 CCTACATCTTTGCCAACACTAGG - Intergenic
1094536588 12:31326594-31326616 CTCACACCTGTCCCCACTGTCGG + Intronic
1094774189 12:33704004-33704026 TCCACAGCTTTGCCAACACTGGG + Intergenic
1095663727 12:44769458-44769480 CCCACACCCTCACCCACACTTGG - Intronic
1096353854 12:50923572-50923594 CCCACCACTGTGCCCAGATTCGG + Exonic
1097052750 12:56233118-56233140 CACACACCTGTTACCACACCCGG - Intronic
1097170793 12:57111488-57111510 CCCCCACGTGTTCCCCCACTCGG - Intronic
1099191869 12:79569513-79569535 CTCTCACCTCTCCCCACACTGGG - Intergenic
1100260411 12:92928493-92928515 CCCACGCCTGGGCCCAGGCTAGG + Intronic
1101919184 12:108919007-108919029 CCCCCACTTGTACCCACACTTGG + Intronic
1101919216 12:108919117-108919139 CCCACACCTGCACCCATACTTGG + Intronic
1101919230 12:108919164-108919186 CCCACACTTGTACCTACACTTGG + Intronic
1101919250 12:108919276-108919298 ACCCCACCTGTACCCACACTTGG + Intronic
1101919272 12:108919342-108919364 CCTATACCTGCACCCACACTTGG + Intronic
1101919297 12:108919426-108919448 CCCACACCTGTGCCCACACTTGG + Intronic
1102487557 12:113268545-113268567 CACACACCTGTGCCAGCACCTGG + Intronic
1102515260 12:113441931-113441953 CCCAGAGCTGGGCCCACACAGGG + Intergenic
1103867806 12:124067044-124067066 CCCAAACCCATGCCAACACTGGG + Intronic
1104280444 12:127371907-127371929 CCCACACCAGTGCCACCACCAGG + Intergenic
1104608270 12:130205643-130205665 CCCACACCCAGGCCCACACATGG + Intergenic
1104971894 12:132534537-132534559 GCCCCACATGTGCCCACACAGGG + Intronic
1109739458 13:66533042-66533064 GCCACTTATGTGCCCACACTGGG + Intronic
1111717898 13:91903495-91903517 TCCACATCTTTGCCAACACTTGG + Intronic
1112251037 13:97780650-97780672 CCCACTCCTTAGCCCACACAGGG + Intergenic
1112964077 13:105165471-105165493 TCCACATCTCTGCCAACACTTGG - Intergenic
1115656900 14:35451932-35451954 CCCACACCTGCCACCACACCTGG - Intergenic
1118317278 14:64732937-64732959 CTCACACCCTTGCCCAGACTGGG + Intronic
1118689371 14:68323390-68323412 CCCCCACTTGTGACCTCACTGGG + Intronic
1119712200 14:76830343-76830365 CCCACAGCTGTGTCCTCATTAGG - Intronic
1121402878 14:93696460-93696482 CCCACATCTTTGTCAACACTTGG + Intronic
1121413469 14:93763297-93763319 CACACACCTGTGACAGCACTGGG + Intronic
1122022218 14:98847668-98847690 CCAACCCCTCTTCCCACACTAGG - Intergenic
1122817144 14:104319385-104319407 CCCAGTTCTGTGCCCACACCAGG - Intergenic
1122858195 14:104570089-104570111 CCGGCACATGTGCCCACCCTGGG - Intronic
1122871633 14:104641403-104641425 CCCACAGCTGTGACCACAGCTGG + Intergenic
1123062127 14:105599187-105599209 GGCACAGCTGTGCACACACTAGG - Intergenic
1123086874 14:105720915-105720937 GGCACAGCTGTGCACACACTAGG - Intergenic
1123103158 14:105819190-105819212 GTGACACCTGTGCCCACATTCGG + Intergenic
1123448271 15:20344987-20345009 CCCACCCCAGTCCCCACACCAGG - Intergenic
1124011584 15:25843473-25843495 CCCAAACCAGAGCCCAGACTTGG + Intronic
1124079428 15:26477653-26477675 TGCACCCCTCTGCCCACACTTGG + Intergenic
1124603355 15:31152256-31152278 CCCACATCTGTGCCCATAGAGGG - Intronic
1125178255 15:36850812-36850834 TCCACATCTTTGCCAACACTTGG - Intergenic
1125307158 15:38331727-38331749 CTTACATCTCTGCCCACACTGGG - Intronic
1125532683 15:40423909-40423931 CCCCAACCCCTGCCCACACTTGG + Intronic
1125537846 15:40452867-40452889 CCCACAACTCACCCCACACTGGG + Intronic
1127322384 15:57859452-57859474 TCTACTGCTGTGCCCACACTAGG - Intergenic
1128389902 15:67175738-67175760 ACCACACCTGTGCTCACACATGG - Intronic
1128986516 15:72225964-72225986 TCCACACCTTTTTCCACACTTGG + Intronic
1129697920 15:77751138-77751160 TTCACACCTGTGCTCACACCTGG - Intronic
1129767956 15:78182200-78182222 CTCACAACTGTGGCCACCCTGGG + Intronic
1130108524 15:80946740-80946762 CCCACACATCTGGCCACAGTTGG - Intronic
1131091553 15:89628286-89628308 CCCTCATCTGTACCCTCACTGGG - Exonic
1131177255 15:90217823-90217845 CCCACAGGTGAGCCCACACCTGG + Exonic
1132116943 15:99144290-99144312 GCCACCCCTCTGTCCACACTGGG - Intronic
1132308014 15:100831681-100831703 CTCACACGTGTGCCAACAATCGG + Intergenic
1132470077 16:97674-97696 CCAACACATGTGCACACACAGGG + Intronic
1132507377 16:318133-318155 CTCACACCTGTCCCGTCACTTGG + Intronic
1132613506 16:829125-829147 CCCACACCCGGGCACACACCCGG + Intergenic
1132763783 16:1524381-1524403 CCCACCCCTCTGCCCACCCCTGG - Intronic
1133193807 16:4154064-4154086 CCCAGGCCTGTGCCAACGCTTGG + Intergenic
1133813032 16:9176029-9176051 TCCACATCTTTGCCAACACTTGG + Intergenic
1135400054 16:22160695-22160717 CCCACACCTATGCCCACAGAGGG + Intergenic
1136709087 16:32219057-32219079 TCCACATCTTTGCCAACACTTGG - Intergenic
1136758822 16:32710367-32710389 TCCACATCTTTGCCAACACTTGG + Intergenic
1136809285 16:33160017-33160039 TCCACATCTTTGCCAACACTTGG - Intergenic
1136815761 16:33270097-33270119 TCCACATCTTTGCCAACACTTGG - Intronic
1137075133 16:35952551-35952573 CCCACACCGGTCCCCAGAGTGGG + Intergenic
1137267698 16:46882861-46882883 CCCGCACCTTTGTCTACACTAGG - Intergenic
1137441750 16:48504116-48504138 CCAACACCTCTGCCCAGGCTTGG - Intergenic
1137545227 16:49398139-49398161 CCCTCACCAATCCCCACACTTGG - Intronic
1137714154 16:50587726-50587748 CACAGACCTGTACCCACCCTTGG - Intronic
1138271567 16:55699538-55699560 TCCACTCCTGTGCACACACAGGG - Exonic
1139576662 16:67846608-67846630 CCCACCCCAGTGCACAGACTGGG + Intronic
1140127640 16:72131479-72131501 CCCACGCCTTTGCCTCCACTGGG + Intronic
1140769435 16:78190029-78190051 CCAGCACATGTGTCCACACTTGG + Intronic
1141163794 16:81647096-81647118 TCCACACCTTTGCCAACACTTGG + Intronic
1141455464 16:84138707-84138729 ACCACAACTGTCCCCAAACTAGG + Intronic
1141678661 16:85531210-85531232 CTCAGAGCTGTGCCCACAGTGGG - Intergenic
1142291026 16:89193603-89193625 CCCACACCTGCCCCCTCACCTGG - Exonic
1142315321 16:89340917-89340939 CCCACATCACTGCCCACATTTGG - Intronic
1203060976 16_KI270728v1_random:970692-970714 TCCACATCTTTGCCAACACTTGG + Intergenic
1142775816 17:2138069-2138091 CCCAGAACTGTGTCCACACCTGG + Intronic
1143105406 17:4527744-4527766 CCCACAGCTTTGATCACACTTGG - Intronic
1144293693 17:13853159-13853181 CCCACGTCTGTGACCACATTAGG - Intergenic
1144836382 17:18158651-18158673 CCCACCCCTCTTCCCACAGTGGG + Intronic
1146790749 17:35749241-35749263 CCCTCTCCTTTGCCCACTCTGGG + Intronic
1146926019 17:36745991-36746013 CCCACACATGAGCACACACACGG + Intergenic
1147260795 17:39208912-39208934 CCCTCCTCTGTGCCCACTCTGGG - Intergenic
1147954759 17:44126403-44126425 GCCAGACCTGTGCTCACGCTGGG + Intergenic
1147980284 17:44269848-44269870 CCAAACCCTGGGCCCACACTGGG + Intergenic
1148475785 17:47927859-47927881 CCCCCACCTGTGTCCTCCCTGGG + Exonic
1150769457 17:68029027-68029049 CTCACACCTGTGAGCACTCTGGG + Intergenic
1151568933 17:74916403-74916425 CCCACACATGTGCCCAGAGTAGG - Exonic
1151697917 17:75727509-75727531 CCCACCCCAGTCCCCACACCAGG - Intronic
1152678157 17:81652088-81652110 CTCACACGTGTGCGCACACACGG - Intronic
1152776480 17:82205107-82205129 CACACACCTGTGCACACACAGGG + Intronic
1152893999 17:82899768-82899790 CCCACATCTGTGCCAACGCTTGG + Intronic
1152948216 17:83210013-83210035 TCCAGACCTGGGGCCACACTTGG - Intergenic
1153473770 18:5474453-5474475 CACACACATGTGCACACACAAGG - Intronic
1155728155 18:29116061-29116083 CACCCACCTGTGCACACACTGGG + Intergenic
1157490767 18:48122181-48122203 CACACCTCTGTGCCTACACTGGG - Intronic
1160405126 18:78640085-78640107 CCCACATCAGTGTCAACACTGGG - Intergenic
1160684448 19:426996-427018 CCTGCCCCTGTGCCCACACCCGG - Intronic
1160920905 19:1520147-1520169 CCCCCTCCTGCGCTCACACTGGG + Intergenic
1160969645 19:1761854-1761876 CCCCCACATCTGCCCACACTCGG - Intronic
1161614752 19:5263882-5263904 TGCACACCTGTGCCCACAGGCGG + Intronic
1161943316 19:7419262-7419284 ACCCCAGGTGTGCCCACACTCGG + Intronic
1162454722 19:10776433-10776455 GCCACAGCTGTGCCCTCCCTGGG - Intronic
1162907359 19:13831640-13831662 CCCAACCCTGAGCCCACCCTGGG - Exonic
1162964287 19:14148754-14148776 CCCACACCTGTTCCCTTACACGG + Exonic
1163184242 19:15626349-15626371 CCCACACCTCAGCCAACCCTTGG + Intronic
1163576757 19:18115413-18115435 GACACACCTTTGCACACACTCGG - Intronic
1164852339 19:31494658-31494680 CCCACATCTTTGCCCATATTAGG + Intergenic
1165152804 19:33770908-33770930 CCCACACCTTTGCACACACCAGG - Intronic
1165369735 19:35397408-35397430 GCCACACCCCTGCCCACTCTTGG - Intergenic
1165920690 19:39296243-39296265 CCCACACCTGTTCCCTCATCAGG + Intergenic
1166441083 19:42815993-42816015 CCCACACCAGTGCCCAGGGTGGG - Intronic
1166460557 19:42984600-42984622 CCCACACCAGTGCCCAGGGTGGG - Intronic
1166477857 19:43144573-43144595 CCCACACCAGTGCCCAGGGTGGG - Intronic
1166958968 19:46486634-46486656 CACACACCTGTATGCACACTGGG + Intronic
1167271860 19:48510589-48510611 CCCAGCCCTGTGCCCACAGATGG - Exonic
1167326926 19:48832441-48832463 CCCAGGGCTGTGCCCTCACTTGG - Intronic
1167423111 19:49415308-49415330 CACGCACATGCGCCCACACTCGG + Intronic
1168273993 19:55266065-55266087 CCCACACCTGCACCCACCCCAGG + Intronic
925314874 2:2913851-2913873 CCCACACCTGTGCCCGTGCAGGG - Intergenic
926006891 2:9379395-9379417 CCCCCACCTGAGGCCACACTTGG + Intronic
926304490 2:11628143-11628165 AACACAGCTCTGCCCACACTGGG - Intronic
926676733 2:15630545-15630567 CCAACACCTCTACCCACCCTTGG - Intronic
927173938 2:20392284-20392306 CCCTCACTAGTGCCCACACCAGG - Intergenic
927533741 2:23836235-23836257 CCAGCACCTGTGCCAACACCTGG - Intronic
929501517 2:42494355-42494377 CCCGCACCCGAGTCCACACTGGG - Intergenic
933703573 2:85273512-85273534 CCCACACCCTTGCCCATACAAGG - Intronic
934028332 2:88018906-88018928 CCCACTCCTGTGCCAGCACTTGG - Intergenic
935175084 2:100642370-100642392 CCCACACCTGTGCTCACCTCTGG + Intergenic
935598039 2:104895043-104895065 CACTCACCTGTGCACACACATGG - Intergenic
935624755 2:105162976-105162998 CCCACATCTGAGCCCATCCTAGG - Intergenic
935765770 2:106366473-106366495 CCCACACCTGGACACACACTAGG + Intergenic
936248541 2:110849265-110849287 CCCAGACCTGTGGACACAGTAGG - Intronic
937043161 2:118836249-118836271 CCCGCACCTGCGTCCAGACTGGG - Intergenic
937280254 2:120712786-120712808 CCAACACCTGTGCCAACACCTGG + Intergenic
937914147 2:127090671-127090693 CCCACAGCTGTGCCCTGGCTGGG - Intronic
938254935 2:129849995-129850017 TCAACACCTTTGCCCACTCTTGG - Intergenic
939044478 2:137233929-137233951 CCCACACCTGTGCCTGGAGTGGG - Intronic
939358685 2:141139696-141139718 CCTACATCTTTGCCAACACTTGG - Intronic
939643679 2:144670474-144670496 CCTCCAGCTGAGCCCACACTTGG + Intergenic
939805478 2:146770888-146770910 CCCACACTTTTGACAACACTTGG + Intergenic
944105293 2:196073119-196073141 CCCACTTCTGTGGCCACACTGGG - Intergenic
946154854 2:217800684-217800706 CCCAATCCTGCCCCCACACTCGG - Exonic
946231685 2:218295448-218295470 CCCACCCCATTCCCCACACTGGG - Intronic
947582527 2:231330505-231330527 CCCAGACTTCTACCCACACTTGG - Intronic
947873150 2:233450739-233450761 CCCAAACATGTGCACCCACTCGG + Intronic
947916937 2:233838883-233838905 CCCACTCCTGTGCCCACTTGGGG - Intronic
948478568 2:238236780-238236802 CCCACACCAGTGACCACTGTTGG - Intergenic
948570966 2:238916887-238916909 CCCACTCCTGTTTCCACAGTGGG - Intergenic
948661524 2:239509527-239509549 CCCACACATGTTCACACAATCGG + Intergenic
948836096 2:240626705-240626727 CCCGTACCTGTGACCCCACTGGG - Intronic
948894573 2:240922217-240922239 CCCAGAGCTATGCCCCCACTGGG + Intronic
949041162 2:241850559-241850581 CCCACTCCTGTGCCCAGTCTTGG + Exonic
949059827 2:241950276-241950298 TGCACACCTGTGCTCACACACGG - Intergenic
949059831 2:241950304-241950326 TGCACACCTGTGCTCACACATGG - Intergenic
1170061698 20:12265824-12265846 CCCTCACCCCTGCCCTCACTGGG - Intergenic
1170531773 20:17300290-17300312 CCCACAGCAGTGCACACACTGGG - Intronic
1171464035 20:25315496-25315518 CCCACCCCTGTGCCCTTGCTGGG + Intronic
1171481937 20:25460874-25460896 CCCGCACCTGTGTCCACACTGGG + Intronic
1171954417 20:31449491-31449513 CCCAGACCTGTGCAATCACTGGG + Intronic
1172130381 20:32650973-32650995 CCCACACCTGGGCTGACACTGGG - Intergenic
1172275393 20:33676382-33676404 CACACACATGTGGACACACTGGG + Exonic
1172486743 20:35303050-35303072 CCCAGACCTGTGCCCAGCTTTGG - Exonic
1175695053 20:61096653-61096675 CCCACATCTTTGCCATCACTTGG + Intergenic
1175894606 20:62330577-62330599 ACCACCCATGTGCCCACGCTGGG - Exonic
1176050912 20:63119350-63119372 CCCACAACTGTGCCAACACAGGG + Intergenic
1176089372 20:63312187-63312209 CCCACATCTGCCCCCACACCAGG - Intronic
1178349823 21:31864722-31864744 CTCACACCTATGGCCACATTTGG + Intergenic
1178586061 21:33872150-33872172 CCCAGATCTTTGCCAACACTGGG - Intronic
1179716328 21:43290628-43290650 CTCACACCTGTGCGCACAGTTGG - Intergenic
1179788393 21:43741996-43742018 CCCACTCCTGTGACCACACTGGG + Intronic
1179893853 21:44350746-44350768 CCCGCGCCTCTGCGCACACTGGG - Intronic
1179898662 21:44377604-44377626 CCCACCTCTGTCCCCTCACTCGG + Intronic
1180054963 21:45352921-45352943 CCCATTCCTGTGCCCACAGCCGG + Intergenic
1180581739 22:16845042-16845064 GCCAAACCTGGGCCCAGACTGGG + Intergenic
1181038806 22:20182335-20182357 CCCATGCCTGTGCCCACCCTGGG - Intergenic
1181047652 22:20223225-20223247 CGGGCACCTGAGCCCACACTGGG + Intergenic
1181166630 22:20987482-20987504 ACCACCCCTGTGCCCACCCCAGG + Exonic
1181409067 22:22705341-22705363 CTCAGAGCTGTGCCCTCACTGGG + Intergenic
1181410313 22:22713725-22713747 CTCAGAGCTGTGCCCTCACTGGG + Intergenic
1181417868 22:22773101-22773123 CTCAGAGCTGTGCCCACAATGGG + Intronic
1183058776 22:35322810-35322832 ACCATACCTCTGCCCACCCTAGG + Intronic
1183366909 22:37411674-37411696 CCCATCCCTGTCTCCACACTGGG - Intronic
1183373592 22:37449423-37449445 CCCCCGCCTGTGCCCCCACTGGG - Intergenic
1183929369 22:41227308-41227330 CCCACACCTGCGGCCACAGGAGG - Exonic
1184191742 22:42899543-42899565 CACCCACCTCTGCCCACACTTGG - Intronic
1184255981 22:43287215-43287237 TCCTCCTCTGTGCCCACACTGGG - Intronic
1184488355 22:44795272-44795294 CCCAGCCCAGAGCCCACACTGGG - Intronic
1184862349 22:47179989-47180011 TCCACATCCTTGCCCACACTGGG + Intergenic
1185179353 22:49350243-49350265 CCCACAGGGGTGTCCACACTGGG - Intergenic
1185362999 22:50420290-50420312 CCCATGCTTGTGTCCACACTGGG - Intronic
950550398 3:13662645-13662667 CCCACGGCTGTGCCCACGCTAGG + Intergenic
950578851 3:13850126-13850148 CCCACACCTGTGCCCAGGGGCGG + Intronic
950590129 3:13931060-13931082 CCCTCACCTGCTCCCACCCTGGG + Intergenic
951707273 3:25555894-25555916 CCCACACCCATGCCCAGAATGGG - Intronic
952280368 3:31917153-31917175 ATCCCACCGGTGCCCACACTAGG + Intronic
953819510 3:46193116-46193138 CCCACATCTTTACCAACACTTGG - Intronic
954748890 3:52802823-52802845 CCCCCACCTGTGCCTACCCCTGG + Intronic
958157287 3:89771283-89771305 CCCACAGCCGAGTCCACACTGGG - Intergenic
958796359 3:98710293-98710315 CCCACACCTGAGCCTAGCCTTGG - Intergenic
961653827 3:128430638-128430660 GCAGCACCTGTGCCCACACCAGG - Intergenic
962557798 3:136573281-136573303 CACCCACCTATGCCCATACTTGG - Intronic
964833738 3:160914075-160914097 TCCACATCTTTGCCAACACTTGG + Intronic
965184573 3:165446586-165446608 CCCATATCTCTGCCCCCACTTGG + Intergenic
966139923 3:176745378-176745400 CCCACAGCTGTGCCCACATCTGG + Intergenic
966447892 3:180024007-180024029 CCCACACCCAGGCACACACTTGG - Intronic
967865398 3:194186152-194186174 CCCACAACTCTGCACACACCGGG - Intergenic
967938425 3:194747703-194747725 CCCACACCTGTGACATCACGTGG - Intergenic
968382035 4:104723-104745 CCTACACCTGTGCTCACACCAGG + Intergenic
968446763 4:656031-656053 CCCACAGCCTTGCCCTCACTGGG + Intronic
968608909 4:1548161-1548183 CCCACCTCGGTGCCCACACCTGG - Intergenic
968747882 4:2370428-2370450 CCCACACCCCAGCTCACACTTGG + Intronic
968902180 4:3436942-3436964 TCCAGACCTGAGGCCACACTGGG - Intronic
969686578 4:8678392-8678414 TCCACACCTTTGACAACACTTGG + Intergenic
969732506 4:8965009-8965031 CCCTCTCCTGTGCCCACAAGAGG - Intergenic
970829146 4:20314914-20314936 CCCACACCTTTAACAACACTAGG - Intronic
971191772 4:24435370-24435392 GCCATGCCTTTGCCCACACTGGG + Intergenic
971230735 4:24798945-24798967 CCAGCACCTGGGCCCACACCTGG - Intronic
971405770 4:26320067-26320089 CACACACCTGGGCTCACACACGG + Intronic
972075413 4:35080146-35080168 CCAGCACCTGTGCCGACACCTGG + Intergenic
974755832 4:66206164-66206186 TCCACACCTTTGTCAACACTTGG + Intergenic
977755297 4:100663515-100663537 CCTACACCCTTGCCAACACTGGG + Intronic
980961254 4:139478617-139478639 CCCACCCCAGTTCCCACGCTGGG + Intergenic
981777471 4:148386294-148386316 CTCAGACCTGTGACCACACAAGG - Intronic
982070758 4:151692564-151692586 CACACACCTGTTCCCAGACCAGG + Intronic
982228022 4:153183459-153183481 CCCACACCTGTGCTCAGAGCTGG - Intronic
982735390 4:159001143-159001165 TCCACATCTTTGCCAACACTTGG + Intronic
983437409 4:167732658-167732680 CACACACATATGCACACACTAGG - Intergenic
983586025 4:169355520-169355542 TCCACATCTCTGCCAACACTTGG - Intergenic
984606415 4:181790217-181790239 CCCACACATCTGGCCACACGTGG + Intergenic
985012078 4:185593111-185593133 CCCATATCTGAGCACACACTGGG - Intronic
985263790 4:188139644-188139666 ACAAAAGCTGTGCCCACACTCGG - Exonic
985716454 5:1465896-1465918 CACACACGTGTGCACACACACGG + Intronic
985744274 5:1637547-1637569 CCCCCACCACTGCCCACACATGG - Intergenic
986109258 5:4695025-4695047 CCCACACCTGCCTCCACCCTTGG - Intergenic
987114283 5:14713958-14713980 TCCAGTCCTGTCCCCACACTTGG + Intronic
988642878 5:33060795-33060817 CCCACACCTTCCCTCACACTTGG - Intergenic
988982789 5:36588266-36588288 CCACCACCTGGGACCACACTGGG + Intergenic
989425327 5:41290197-41290219 CCAACACCTGTGCCAGCACCTGG - Intergenic
990757983 5:59096907-59096929 TACACACTTGTGTCCACACTTGG - Intronic
993092981 5:83449997-83450019 CACACATATGTGCCCACACATGG + Intergenic
997178076 5:131798664-131798686 CGCACACCTGTGGTCCCACTCGG + Intergenic
998392640 5:141797228-141797250 CCAACACCTAGGCACACACTTGG + Intergenic
1000371777 5:160543511-160543533 TCTACACCTCTGCCCACACCAGG - Intergenic
1001114337 5:168926309-168926331 CCCACACCTTTCCCCACAGTTGG - Intronic
1001807669 5:174601863-174601885 CCCACATCTTTGCCAACACTTGG + Intergenic
1002099600 5:176850842-176850864 CATACACCACTGCCCACACTAGG - Intronic
1002742383 5:181443168-181443190 TCCAGACCTGGGGCCACACTTGG - Intergenic
1004079722 6:12380328-12380350 CCCAGACCTGTCACCACACCTGG - Intergenic
1005390167 6:25324830-25324852 TTCACACCTGTGCCCTCACCTGG - Intronic
1005854253 6:29848577-29848599 TCTGCAGCTGTGCCCACACTTGG - Intergenic
1006319600 6:33312743-33312765 TCCCCACCTGCGCCCACACCCGG - Intronic
1006737851 6:36287381-36287403 CCCACCCCTCAGCCCACCCTAGG - Intronic
1007214894 6:40229194-40229216 CCAACACCTGTGCCAGCACCTGG + Intergenic
1007259921 6:40556225-40556247 CCTACACCTTGGCCCAGACTGGG + Intronic
1011509125 6:88080644-88080666 GACAGATCTGTGCCCACACTTGG + Intergenic
1012539162 6:100340441-100340463 TCCACATCTTTGCCAACACTTGG - Intergenic
1013438488 6:110138168-110138190 CCAACACCTGTGCCAGCACCTGG - Intronic
1013472983 6:110481619-110481641 CCCACATCTTTGCCAATACTTGG + Intergenic
1015366233 6:132401087-132401109 CCCGCACCTGCGCCCTCTCTGGG + Intronic
1015678874 6:135781582-135781604 CCCACCCCTGCACCAACACTGGG + Intergenic
1018765405 6:166929044-166929066 GACACACCTGTGACCACACCAGG + Intronic
1018795967 6:167185917-167185939 ACCACGCCTGTGTCCACGCTCGG - Intronic
1018820351 6:167369147-167369169 ACCACGCCTGTGTCCACGCTCGG + Intronic
1019100235 6:169624108-169624130 CACACACCTGACCCCACACACGG - Intronic
1019166772 6:170102446-170102468 CCCACATCAGTGCCAACATTTGG - Intergenic
1019247519 6:170718907-170718929 TCCAGACCTGGGGCCACACTTGG - Intergenic
1019408596 7:896991-897013 CCCACAGCTGTGTCCACGCGGGG + Intergenic
1019613106 7:1946863-1946885 CCCACACCTGTGCCTCCAGGAGG + Intronic
1019628624 7:2034657-2034679 GCCACAGCAGTCCCCACACTCGG + Intronic
1020379681 7:7529662-7529684 CCTACACCTGTGGCCAAACAAGG + Intronic
1020410192 7:7883624-7883646 CCAACACCTGTGGCCACACAAGG - Intronic
1021280546 7:18711597-18711619 CCACCACCCCTGCCCACACTTGG + Intronic
1021835502 7:24669047-24669069 CACACAGCTGTTGCCACACTGGG - Intronic
1022048431 7:26642368-26642390 CACATATGTGTGCCCACACTTGG - Intronic
1022645716 7:32227111-32227133 CCCAGACTTGAGCACACACTAGG - Intronic
1023141353 7:37105417-37105439 CCTACACCTGTACCCATCCTTGG - Intronic
1024607114 7:51031091-51031113 CACATACCTGTGCACACACATGG - Intronic
1024951173 7:54861842-54861864 CCCACATCCCTGCCTACACTTGG + Intergenic
1027572702 7:79890700-79890722 TCCACATCATTGCCCACACTTGG - Intergenic
1029582225 7:101444766-101444788 CCCTCACAGGTGGCCACACTTGG + Intronic
1029652942 7:101906250-101906272 ACCAACCCTGTGCCCAGACTAGG + Intronic
1030714124 7:112789156-112789178 CCCACCCCAGTGCTCACACCTGG + Intronic
1032024440 7:128430439-128430461 CCCACCCCTGTCCCCACCTTGGG + Intergenic
1032192479 7:129772779-129772801 CCCACACCAGTGCCTGCACTCGG + Intergenic
1033318151 7:140315652-140315674 CCCAGGCCTGGACCCACACTAGG + Intronic
1033585472 7:142771573-142771595 CCCTCAACTCTGCCCTCACTGGG + Intergenic
1034399136 7:150849828-150849850 CCCACATCTCTGTCAACACTTGG + Intronic
1034498045 7:151433638-151433660 CCCACACCTGTGCCACAGCTGGG + Intronic
1035115922 7:156523848-156523870 CCCTCACCTGTTCCCACTCTTGG - Intergenic
1035500618 8:89029-89051 TCCAGACCTGGGGCCACACTTGG + Intergenic
1035678011 8:1468526-1468548 ACCACACCTGTTCCAACACATGG + Intergenic
1035731175 8:1854330-1854352 CCCACAGCTGTGCCCACGGCGGG - Intronic
1037934311 8:22904338-22904360 CCTAGACCTGTGCCCACGCCTGG + Intronic
1037989321 8:23309344-23309366 CACAAACCTGTGGACACACTTGG + Intronic
1040419312 8:47224302-47224324 CACACTCATGTGCCCCCACTTGG + Intergenic
1040512239 8:48105662-48105684 CGCACACCTGTGGCCACACTGGG - Intergenic
1043737594 8:83767856-83767878 CCTGCACCTGTGCCGACACCTGG - Intergenic
1044839961 8:96329135-96329157 CTCACAGCTGTCCCCACAGTTGG + Intronic
1046395128 8:113631761-113631783 CCCACACCTCTGAAGACACTGGG + Intergenic
1046614759 8:116463786-116463808 CACTAAGCTGTGCCCACACTGGG - Intergenic
1046837478 8:118818889-118818911 CCTACATCTTTGCCAACACTTGG + Intergenic
1049192978 8:141298984-141299006 CCCTCACCAGTGCCCCCACCAGG + Intronic
1049397957 8:142410543-142410565 CCCACACCTCCTCCCACCCTTGG + Intergenic
1049794442 8:144490133-144490155 CCCACAGCGGTGTCCACACGTGG - Exonic
1050071144 9:1815733-1815755 CTCACTCCTGTTCCCAGACTTGG + Intergenic
1051430361 9:16975696-16975718 CTCACACCTTTGCCAACAGTGGG - Intergenic
1051885016 9:21883378-21883400 TCCACATCTTTGCCCAAACTTGG - Intronic
1052426354 9:28310003-28310025 TCCACACCCTTGCCAACACTTGG - Intronic
1054253350 9:62739988-62740010 CCCGCTCCTGTGCCAGCACTTGG - Intergenic
1054567467 9:66774487-66774509 CCCGCTCCTGTGCCAGCACTTGG - Intergenic
1054748534 9:68880819-68880841 CACCCACCTGTGCCTGCACTGGG + Intronic
1056028646 9:82527184-82527206 CTCACACCTGTGACCACATTTGG + Intergenic
1057274713 9:93670214-93670236 GCCACTCCTGGGCCCATACTTGG - Intronic
1057305531 9:93910123-93910145 CCCACATCTGAGCCCCCACCAGG - Intergenic
1057508922 9:95661660-95661682 TCCACACCTGTGCTGAGACTTGG - Intergenic
1057975377 9:99600506-99600528 CAGGCACCTGTGCCCACCCTGGG - Intergenic
1058619022 9:106863792-106863814 CCTACTCCTGTCCCCACACTCGG - Intronic
1058879976 9:109277705-109277727 ACCTCACCTGTGTCCTCACTTGG - Intronic
1061871333 9:133522315-133522337 CACTCACCTGAGCCCCCACTGGG - Intronic
1062000776 9:134214669-134214691 CCCCCACCTGAGCTCCCACTGGG - Intergenic
1062042995 9:134412618-134412640 CCCCCACCTCTGCCCACCCCTGG - Intronic
1062177169 9:135169892-135169914 CACACACATGTGCTCACACATGG - Intergenic
1062524681 9:136973416-136973438 CCCACCTCTGTGCCCACCCCCGG - Intergenic
1203608292 Un_KI270748v1:74387-74409 TCCAGACCTGGGGCCACACTTGG - Intergenic
1186187922 X:7040167-7040189 CCCACACCAGTGCCCAGGGTGGG - Intergenic
1187506373 X:19881653-19881675 CCCACATCTGTCCCCAGTCTTGG - Intronic
1188859752 X:35243317-35243339 CCGGCACCTGTGCTCACACCTGG - Intergenic
1194036478 X:88879937-88879959 CACACACATGTGCACACACACGG - Intergenic
1198865663 X:141120484-141120506 ACCACATCAGTGCCCCCACTAGG - Intergenic
1199531533 X:148853326-148853348 CCCACATCTGTGACCTCTCTAGG - Intronic
1201567434 Y:15381628-15381650 CCCACAGCTGTGCTCACACCAGG - Intergenic
1201689371 Y:16745849-16745871 CAGACACCTGTGACCACACCTGG + Intergenic