ID: 1101919797

View in Genome Browser
Species Human (GRCh38)
Location 12:108923173-108923195
Sequence TCCCCTTGATTGTGTAGATG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 196
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 180}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101919791_1101919797 6 Left 1101919791 12:108923144-108923166 CCTGGTAGTCATATTCTTGTGTA 0: 1
1: 0
2: 8
3: 49
4: 259
Right 1101919797 12:108923173-108923195 TCCCCTTGATTGTGTAGATGGGG 0: 1
1: 0
2: 0
3: 15
4: 180
1101919788_1101919797 14 Left 1101919788 12:108923136-108923158 CCCCACTTCCTGGTAGTCATATT 0: 1
1: 0
2: 1
3: 24
4: 202
Right 1101919797 12:108923173-108923195 TCCCCTTGATTGTGTAGATGGGG 0: 1
1: 0
2: 0
3: 15
4: 180
1101919786_1101919797 22 Left 1101919786 12:108923128-108923150 CCCATGATCCCCACTTCCTGGTA 0: 1
1: 15
2: 51
3: 202
4: 544
Right 1101919797 12:108923173-108923195 TCCCCTTGATTGTGTAGATGGGG 0: 1
1: 0
2: 0
3: 15
4: 180
1101919789_1101919797 13 Left 1101919789 12:108923137-108923159 CCCACTTCCTGGTAGTCATATTC 0: 1
1: 0
2: 2
3: 28
4: 218
Right 1101919797 12:108923173-108923195 TCCCCTTGATTGTGTAGATGGGG 0: 1
1: 0
2: 0
3: 15
4: 180
1101919783_1101919797 24 Left 1101919783 12:108923126-108923148 CCCCCATGATCCCCACTTCCTGG 0: 1
1: 2
2: 25
3: 113
4: 490
Right 1101919797 12:108923173-108923195 TCCCCTTGATTGTGTAGATGGGG 0: 1
1: 0
2: 0
3: 15
4: 180
1101919790_1101919797 12 Left 1101919790 12:108923138-108923160 CCACTTCCTGGTAGTCATATTCT 0: 1
1: 0
2: 2
3: 30
4: 265
Right 1101919797 12:108923173-108923195 TCCCCTTGATTGTGTAGATGGGG 0: 1
1: 0
2: 0
3: 15
4: 180
1101919787_1101919797 21 Left 1101919787 12:108923129-108923151 CCATGATCCCCACTTCCTGGTAG 0: 1
1: 1
2: 7
3: 36
4: 281
Right 1101919797 12:108923173-108923195 TCCCCTTGATTGTGTAGATGGGG 0: 1
1: 0
2: 0
3: 15
4: 180
1101919785_1101919797 23 Left 1101919785 12:108923127-108923149 CCCCATGATCCCCACTTCCTGGT 0: 1
1: 3
2: 35
3: 130
4: 482
Right 1101919797 12:108923173-108923195 TCCCCTTGATTGTGTAGATGGGG 0: 1
1: 0
2: 0
3: 15
4: 180

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101919797 Original CRISPR TCCCCTTGATTGTGTAGATG GGG Intronic
900499777 1:2998076-2998098 TCTCCTTGATTTTGTGGAGGAGG + Intergenic
900791175 1:4681855-4681877 TCCCCTTCATTTTGCAGGTGGGG - Intronic
902760410 1:18577115-18577137 TCATCTTGTTTGTGTAGGTGCGG - Intergenic
903417016 1:23190508-23190530 TCATCTTGATTTTATAGATGAGG - Intergenic
905955085 1:41986114-41986136 TTCCCTTGATTTTAAAGATGAGG - Intronic
906687111 1:47769864-47769886 TCCTGTTCATTGTGTTGATGGGG - Intronic
907908235 1:58804577-58804599 GAGCCTTGATTGTGTAAATGAGG - Intergenic
908673607 1:66576464-66576486 TCATCTTTATTTTGTAGATGAGG - Intronic
909332305 1:74428320-74428342 TACCCTTGGTTCTGTAGAGGAGG - Intronic
910522552 1:88139094-88139116 TTACCTTTATTTTGTAGATGAGG - Intergenic
916097280 1:161362617-161362639 TCCCCTTGTTTCTAAAGATGAGG + Exonic
916525181 1:165602895-165602917 TCCCCTTCATTTTGCATATGAGG - Intergenic
916547990 1:165824859-165824881 TTCCCTTGATTGTATTAATGTGG - Intronic
918114290 1:181483629-181483651 TCCCCGTGCTTGTCTGGATGCGG + Intronic
918438242 1:184539262-184539284 TTCCCTTTATTCTGTAAATGTGG + Intronic
919012275 1:191980926-191980948 TGCCCTTGATTCTGTTGATGTGG + Intergenic
920221980 1:204410976-204410998 TCCCCTTGATTGGCTAGAGGAGG - Exonic
920677738 1:208049703-208049725 ACCCCTTCATTGTGTAGCAGAGG - Intronic
920716864 1:208348372-208348394 ACCTCTTCATTGTGTAGATGAGG - Intergenic
921347432 1:214201198-214201220 TGCCCTTGATTTTGCAGATAGGG - Intergenic
922554336 1:226521446-226521468 GCCCTTTCATTGTGCAGATGAGG - Intergenic
923709823 1:236378266-236378288 TCCCCTTGTGTTTGTAGAAGAGG - Intronic
923893878 1:238247108-238247130 TGCCCTTTATTCTGTAAATGTGG - Intergenic
1062928083 10:1332923-1332945 TCCCATTGATTGCGGGGATGGGG - Intronic
1069974610 10:72202699-72202721 TACCCTTGATTTTGTAGACTAGG - Intronic
1072090155 10:92119348-92119370 TCCCCTTGTTTCTAAAGATGGGG + Intronic
1073042639 10:100617945-100617967 TCCCCCAGCTTGTGTAGATGGGG - Intergenic
1073181961 10:101588852-101588874 TCCACTTCATTTTATAGATGAGG - Intronic
1075011895 10:118878979-118879001 TCTCCTTTATTCTGTAAATGTGG - Intergenic
1079216595 11:18518632-18518654 TCCCTTTCATTTTATAGATGAGG - Intronic
1079355403 11:19726401-19726423 ACCCCTTCATTTTGAAGATGAGG + Intronic
1079490386 11:20982622-20982644 GCCCCTTCATTTTGTAGAAGAGG + Intronic
1081404919 11:42686844-42686866 TACCCTTCATTCTGTATATGTGG - Intergenic
1081641474 11:44758322-44758344 TCCTCTTCATTCTGTTGATGTGG + Intronic
1081686432 11:45046514-45046536 TTCTCTTCATTGTGCAGATGAGG - Intergenic
1085793171 11:79513647-79513669 TCACTTGGATTTTGTAGATGAGG + Intergenic
1089795764 11:120979774-120979796 TCCTCTTGTTTCTGTAGAGGGGG - Intronic
1089865517 11:121627971-121627993 TCTCTTTGATTGTGTAGTTCTGG + Intronic
1090772018 11:129929201-129929223 TACCCTTCATTTTGTATATGAGG + Intronic
1092619560 12:10249436-10249458 TCCCCTTCATTTTACAGATGTGG + Intergenic
1096263381 12:50106352-50106374 TCCCCATGAGTGTGCTGATGGGG + Exonic
1096630455 12:52923368-52923390 GCCCCTTCATTATATAGATGAGG - Intronic
1096870959 12:54591752-54591774 TCCCCTTCATTTTGAAGATTAGG - Intergenic
1097014414 12:55974852-55974874 TTCCCTTTAGTGTTTAGATGTGG + Intronic
1098086502 12:66849984-66850006 TATCCTTCATTTTGTAGATGAGG - Intergenic
1099236928 12:80093246-80093268 TATCCTTGATTGTATAGATCGGG - Intergenic
1101347415 12:103899494-103899516 GACCCTTCATTTTGTAGATGAGG + Intergenic
1101919797 12:108923173-108923195 TCCCCTTGATTGTGTAGATGGGG + Intronic
1102847541 12:116203065-116203087 TCCCGCTGTTTTTGTAGATGAGG - Intronic
1102870524 12:116410595-116410617 TCCCCTAGATTTTGATGATGAGG + Intergenic
1103946579 12:124530727-124530749 TCACCTTGCTTTTGTAGAGGGGG - Intronic
1105797880 13:23874371-23874393 TCCCCTTCATTTTACAGATGTGG - Intronic
1106903397 13:34379048-34379070 TCCCCATGATTTTACAGATGAGG - Intergenic
1108196358 13:47999796-47999818 ACCCTTTGCTTTTGTAGATGAGG - Intronic
1108480556 13:50865949-50865971 TCCCTCTAATTATGTAGATGAGG - Intergenic
1111948128 13:94686949-94686971 TACCCTTGATAATGCAGATGGGG + Intergenic
1113192872 13:107770329-107770351 TCTCCTTGAAAGTGTAGATGAGG + Intronic
1114373418 14:22115130-22115152 ACCCCTTGTTTCTGTACATGGGG - Intergenic
1115695574 14:35894625-35894647 TGCCCTTCATTTTGTTGATGTGG + Intronic
1115812936 14:37130785-37130807 TTCCCTTGCTTGATTAGATGAGG + Intronic
1118146889 14:63147436-63147458 TGTCCTTGATTATGTTGATGTGG + Intergenic
1120359512 14:83480584-83480606 TCCCCCAAATTGTGTAAATGTGG + Intergenic
1125735915 15:41925815-41925837 AGCCCTTGATTGGGTAGAAGGGG - Intronic
1126475172 15:49058376-49058398 TCCCATGCATTGTGCAGATGAGG - Intergenic
1128411238 15:67400448-67400470 TCCCATTCATTGTGTATATAAGG - Intronic
1132100095 15:99016664-99016686 TCTCCTCTATTTTGTAGATGAGG - Intergenic
1133733112 16:8592810-8592832 TGCCCTTGATAATGAAGATGAGG - Intergenic
1135657215 16:24261144-24261166 TCCAAATGTTTGTGTAGATGAGG + Intronic
1137341317 16:47609171-47609193 TCCCCTTTATTTTGTTGATATGG + Intronic
1137939938 16:52674273-52674295 TCACCTCCATTGTGTAGAGGAGG + Intergenic
1138047773 16:53743796-53743818 TCCCCCTGATTTTAGAGATGAGG + Intronic
1139210249 16:65070132-65070154 ACCTCTTGATTGTTCAGATGGGG - Intronic
1141140087 16:81491685-81491707 TCCACGTGATTGTGGAGTTGGGG - Intronic
1141240926 16:82264483-82264505 TCCCAGGGAATGTGTAGATGAGG - Intergenic
1142731042 17:1857833-1857855 TCCCCTTGTTTCTAAAGATGAGG - Intronic
1143722633 17:8823383-8823405 TTACCTTGACTGTGTAGATCTGG + Exonic
1146235386 17:31155382-31155404 TCCCTTCAATTGTGTAGCTGAGG + Intronic
1148820714 17:50358066-50358088 ACCCCTTCATTTTGCAGATGGGG + Intronic
1152056403 17:78031272-78031294 TCACCTTGATTTTACAGATGAGG + Intronic
1153383678 18:4468266-4468288 TCCCCTTGACTATTTAGATTTGG + Intergenic
1155648853 18:28115566-28115588 TCCTCAGGATTGTGTAGCTGGGG - Intronic
1155653241 18:28165929-28165951 TCCCCTGGATTTTGTATATGTGG - Intronic
1157421146 18:47548664-47548686 TCCCCTTGAAGGGGGAGATGAGG - Intergenic
1158342178 18:56478321-56478343 TCCCCTTGGGTGTCTGGATGAGG - Intergenic
1158396181 18:57079844-57079866 TTCCCTTGTTTGTGAAGGTGCGG - Intergenic
1159057200 18:63477853-63477875 GCCCCCTCATTCTGTAGATGAGG + Intronic
1165818427 19:38658162-38658184 GCCAGTTGATTGTGTTGATGAGG + Intronic
926181314 2:10646246-10646268 TCCTTTTGGTTGTGAAGATGTGG - Intronic
926989881 2:18667233-18667255 TCCAGTTGCTTGTGTAGATCTGG + Intergenic
927544990 2:23944535-23944557 TCCCCTTGTTTCTAAAGATGGGG + Intronic
929302433 2:40321125-40321147 TCCCCTTTAATTTGTAGATGAGG - Intronic
930418178 2:51116513-51116535 TCCCCAAGATTGTGTGGATAAGG - Intergenic
933045985 2:77538195-77538217 ACCCCTTGAATGTCTTGATGTGG - Intronic
933144209 2:78831304-78831326 TCCCCTGGAATGTGGAGATGAGG + Intergenic
935866075 2:107389028-107389050 TCCCCCAGAATGTGGAGATGTGG + Intergenic
938017613 2:127880540-127880562 CCCCCTTGAGTGTGTACATCAGG - Intronic
938709005 2:133959150-133959172 TCATCTTCATTGTGCAGATGAGG + Intergenic
941417979 2:165245538-165245560 TCCCCTGGATTGAGCAAATGAGG + Intronic
941925253 2:170887939-170887961 TCCCATTCATTGTAAAGATGAGG + Intergenic
942420481 2:175801809-175801831 TGACCTTGATTTTGTAGATGAGG - Intergenic
943436744 2:187873737-187873759 TCCCAGTGTTTGTGTAGATGCGG - Intergenic
946459213 2:219854230-219854252 CACCCTTGATTTAGTAGATGTGG + Intergenic
946533332 2:220598363-220598385 TACCATTGGTTGTGTAAATGGGG + Intergenic
1170272836 20:14547765-14547787 TCTCCTCGATTGTGTACCTGAGG + Intronic
1173660700 20:44731599-44731621 TCCTCTTGTTTGTGGAGAAGAGG + Intergenic
1173935681 20:46860762-46860784 TCTCCTTGATTCTGTTAATGTGG + Intergenic
1174881338 20:54282511-54282533 GCTCATTGATTGTATAGATGAGG - Intergenic
1175170701 20:57079147-57079169 TCCCCTTCATTCTGTTAATGTGG + Intergenic
1175913024 20:62413663-62413685 TTCCCTTTATAGTGTGGATGAGG + Intronic
1176206099 20:63888929-63888951 ACCCCTTGACTGTGCAGCTGGGG - Intronic
1178015906 21:28345862-28345884 TCCACTTGTTTGTGTATATAAGG + Intergenic
1179339829 21:40495408-40495430 TCCCCTTCATTGTGGTAATGTGG - Intronic
1182513121 22:30833529-30833551 CTCCCTTGATTTTGTAGGTGTGG + Intronic
1182687661 22:32133354-32133376 TCATCTTGATTCTATAGATGAGG + Intergenic
1184682481 22:46079708-46079730 CCCCCTTCTTTCTGTAGATGGGG + Intronic
949695277 3:6687280-6687302 ACCCTTTGTTTGTGTAGCTGTGG + Intergenic
954434250 3:50487628-50487650 GCCCCTTGCTTGTGCAGCTGTGG - Intronic
955472476 3:59300185-59300207 TACTCTTTATTGAGTAGATGAGG - Intergenic
956526185 3:70164704-70164726 TCCTCTGGATTTTATAGATGAGG - Intergenic
957394660 3:79622116-79622138 TTCCCTTGACTGTGGAGAGGTGG - Intronic
960194109 3:114743926-114743948 TCACTTTGAATGTGTAGACGAGG + Intronic
964277907 3:155027290-155027312 TCCTTATGGTTGTGTAGATGAGG - Intronic
967258701 3:187620443-187620465 TACCTCTGATTGTGTAGATAGGG - Intergenic
968022754 3:195408821-195408843 TTCCCTTCATTCTGTTGATGTGG - Intronic
968714884 4:2149375-2149397 TCCCCTGGCTTTTGTAGATCTGG - Intronic
969067869 4:4503198-4503220 TCTCCTTGTTTATGTAAATGAGG + Intronic
970424406 4:15933091-15933113 TCACCTTCATTTTCTAGATGAGG - Intergenic
971263690 4:25079108-25079130 TCCTCATGATTCTGTAGATCAGG - Intergenic
973117965 4:46485010-46485032 TATCTTTGATTGTGTAGGTGGGG + Intergenic
973596176 4:52492697-52492719 TGCCCTTCATTCTGTTGATGTGG - Intergenic
975110333 4:70616405-70616427 GCCCTTTTATTGTGTAGATAAGG - Intergenic
977105313 4:92875695-92875717 TCACATTTATTGTATAGATGAGG + Intronic
980163545 4:129197183-129197205 TTCCCTTTATTCTGTTGATGTGG + Intergenic
980214899 4:129839446-129839468 TCCCTTTGCTTGTGTATATATGG - Intergenic
983772698 4:171570967-171570989 TCCACTTGATAGTGTTGGTGGGG - Intergenic
985313559 4:188630627-188630649 CCCCCTTGTCTGTGTAGCTGTGG - Intergenic
989193745 5:38695691-38695713 ACCCCTTCATTCTGCAGATGGGG - Intergenic
989454262 5:41623876-41623898 ATCACTTGATTGTGTACATGAGG - Intergenic
990753861 5:59046217-59046239 TCCCCTTTCCTGTGTAGATGAGG - Intronic
991604338 5:68385197-68385219 TGCCTTTGATTGTTTAAATGTGG + Intergenic
993637186 5:90358872-90358894 TCCCTTTCACTGTGTAGATCTGG + Intergenic
994228039 5:97276903-97276925 TCCCCTTGATTCTGAGGATGAGG + Intergenic
996033762 5:118735136-118735158 TTACCTTCATTTTGTAGATGGGG + Intergenic
997395192 5:133554037-133554059 ACCCCTTATTTGTATAGATGAGG - Intronic
998925456 5:147119436-147119458 TGCCCTTCATTCTGTTGATGTGG + Intergenic
999080925 5:148843006-148843028 GCCCCTTAATTTTATAGATGAGG - Intergenic
999275558 5:150327637-150327659 TCCCCTTGGCTGTGGAGGTGAGG - Intronic
1003301524 6:4887965-4887987 TCCCCTTTATTCTATTGATGTGG + Intronic
1005082845 6:21974166-21974188 TCCCCATTATAGTGAAGATGGGG - Intergenic
1005490581 6:26343751-26343773 TCCTTTTGATTGTTTATATGAGG - Intergenic
1005995153 6:30926315-30926337 TCGCCTTCATTGTGTAAATGAGG + Exonic
1008705628 6:54155248-54155270 TCACTTTGATTGTCTAGTTGGGG - Intronic
1010297348 6:74215188-74215210 TCTCCTTTATTGTGTTGAGGAGG + Intergenic
1013070014 6:106720669-106720691 TCCCCCCAATTGTGGAGATGGGG + Intergenic
1014239919 6:119005606-119005628 TCTCCTTCATTGTGCAGATGTGG + Intronic
1014250749 6:119113317-119113339 TCCCCTTCACTGTTTAAATGAGG + Intronic
1014333248 6:120097684-120097706 TACCCTTGCTTGTCCAGATGTGG - Intergenic
1017440644 6:154461588-154461610 TCCTCTCCATTTTGTAGATGAGG - Intronic
1017551200 6:155509865-155509887 TGGCCTTCATTGTATAGATGAGG + Intergenic
1022280105 7:28899608-28899630 TCCCCATGAGTCTGTAGAAGTGG + Intergenic
1024026220 7:45412209-45412231 TCTCCTTGATTTTGTTCATGTGG + Intergenic
1027271253 7:76520294-76520316 TCCCCAGGACTGTGTAGTTGGGG + Intergenic
1027321017 7:77010229-77010251 TCCCCAGGACTGTGTAGCTGGGG + Intergenic
1032490141 7:132318297-132318319 TCCCCTTTAGTGAGCAGATGGGG - Intronic
1037295966 8:17400790-17400812 TCCACTTAAAAGTGTAGATGTGG + Intronic
1039785220 8:40828881-40828903 TCCCCTGGTTTGTTTAGAAGAGG + Intronic
1040524998 8:48214180-48214202 TTCCCTTTATTGTGTTAATGTGG - Intergenic
1044973294 8:97640596-97640618 TGCCCTTCATTTTATAGATGAGG - Intergenic
1045558851 8:103241130-103241152 TTCCCCTCATTCTGTAGATGAGG + Intergenic
1046113641 8:109758285-109758307 TCCCCTTTATTATATTGATGTGG + Intergenic
1046137537 8:110048663-110048685 TCCCCTTCACTTTATAGATGAGG - Intergenic
1047869389 8:129065886-129065908 TCCCTTTCATTTTATAGATGAGG - Intergenic
1048826449 8:138432096-138432118 TCCCCTAAATTGTGTTGAGGAGG + Intronic
1049203666 8:141353554-141353576 TCCCCGTGAGTGTGGAGAGGGGG + Intergenic
1049264519 8:141660341-141660363 ACCCCTTCATTGTGGAGTTGAGG - Intergenic
1055402002 9:75933904-75933926 TCACATTGATTTTGTACATGAGG - Intronic
1055708254 9:79031948-79031970 TCATCTTTATTTTGTAGATGTGG + Intergenic
1057768522 9:97945153-97945175 TCCCTTTAATTGCCTAGATGTGG + Intergenic
1059048684 9:110898707-110898729 TCTCCTTCATTTTGTAGATGAGG - Intronic
1059443403 9:114323560-114323582 TCTCCCTGATTTTGCAGATGGGG - Intronic
1059444592 9:114330331-114330353 TCTCCCTGATTTTGCAGATGGGG - Intronic
1059796321 9:117701074-117701096 ACCGCTTGATAGTCTAGATGAGG - Intergenic
1060762043 9:126261723-126261745 TCCCCATGATTGTGGTGGTGGGG - Intergenic
1061158226 9:128878048-128878070 TCACCTTCATTGTACAGATGAGG - Intronic
1187812248 X:23192178-23192200 TCCCATTGAGTGTGTAGAATTGG + Intergenic
1189068794 X:37841893-37841915 GCCCTTTTAGTGTGTAGATGGGG - Exonic
1190108912 X:47577463-47577485 ACCCCGTGGTTGTGAAGATGGGG - Exonic
1190393382 X:49954899-49954921 ACCCCTTTCTTTTGTAGATGGGG + Intronic
1193235681 X:79104168-79104190 TCCCCTTCATTCTGTTAATGTGG + Intergenic
1194115918 X:89898271-89898293 TCCCCTTTATTCTGTTAATGTGG - Intergenic
1194349796 X:92811853-92811875 TCACATTTATTGTGCAGATGGGG - Intergenic
1195475945 X:105285555-105285577 TTCCCCTCATTCTGTAGATGAGG + Intronic
1196708128 X:118734585-118734607 TCCCCTTTATTCTGTTAATGTGG + Intronic
1197771377 X:130091780-130091802 ACCCCCTCATTGTGCAGATGAGG - Intronic
1200468719 Y:3555400-3555422 TCCCCTTTATTCTGTTAATGTGG - Intergenic
1200658115 Y:5928463-5928485 TCACATTTATTGTGCAGATGGGG - Intergenic